| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
J. Biol. Chem., Vol. 279, Issue 25, 26768-26779, June 18, 2004
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
¶¶
From the
¶Division of Neonatology and Developmental Biology, Department of Pediatrics, David Geffen School of Medicine, UCLA, Los Angeles, California 90095-1752, the Department of Obstetrics, Gynecology, and Reproductive Sciences, Magee-Womens Research Institute and University of Pittsburgh, Pittsburgh, Pennsylvania 15213, and ||Division of Endocrinology, Department of Pediatrics, University of Michigan, Ann Arbor, Michigan 48109
Received for publication, March 10, 2004
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
Both the processes of neuro-development and depolarization of cultured neurons cause a pre-translational increase in neuronal GLUT 3 expression (13, 20). Furthermore, conditions of substrate deficiency such as chronic hypoglycemia or hypoxic ischemia, which depolarize neurons, also pre-translationally increase neuronal GLUT 3 concentrations (21, 22). By determining transcriptional mechanism(s) underlying the pre-translational increase in neuronal GLUT 3 expression, we had previously characterized the murine Glut 3 promoter. We demonstrated that the murine Glut 3 promoter activity resides in the -203- to +237-bp region of the gene, with reference to the transcriptional start site (23). Additionally, we demonstrated nuclear factors Sp1 to repress and Sp3 to activate Glut 3 gene transcription in cultured murine neuroblasts (23). In the present study, we extended these observations by determining whether Sp1 and Sp3 present in postnatal murine brain nuclear extracts could bind to the identified Glut 3 promoter cis-elements. We have also confirmed that by in vivo Sp3, and we established that in vitro and in vivo phosphorylated cyclic AMP-regulatory element-binding (pCREB)1 protein and the mouse Y box-binding protein-1 (MSY-1) bind the Glut 3 promoter region and activate GLUT 3 expression in neurons. We speculate that although Sp1/Sp3 along with MSY-1 may regulate the transcriptional activation of GLUT 3 during neuro-development, trans-activation of GLUT 3 expression by pCREB may mediate the processes of neuronal synaptic activity and neuro-protection under conditions of substrate deficiency.
|
EXPERIMENTAL PROCEDURES |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
Animals—Balb/c mice were purchased from The Jackson Laboratories (Bar Harbor, ME) and housed in cages. The protocol for the care and use of animals was approved by the Animal Care and Use Committee of the Magee Womens Research Institute in accordance with the guidelines set by the National Institutes of Health. Mice were allowed access to laboratory chow and water ad libitum and were maintained in 12-h light-dark cycles.
Cells—N2A murine neuroblastoma cells (American Tissue Culture Collection, Manassas, VA) were grown at 37 °C with 95% air, 5% CO2 in poly-L-lysine-coated culture flasks and maintained in Dulbecco's modified Eagle's medium supplemented with 2 mM glutamine, penicillin (100 units/ml), streptomycin (100 units/ml), and 10% fetal bovine serum (23).
RNA Studies—Poly(A+)-enriched RNA was extracted as per the manufacturer's instructions using the miniribosep extraction kit (Collaborative Biomedical Products, Bedford, MA) from confluent cultured N2A cells (
1 x 108 cells) or whole brains from the 1- and 21-day-old mice. The extracted RNA was subjected to Northern blot analysis as described previously (23). A 32P-labeled 1.5-kb XhoI-XbaI fragment of the murine GLUT 3 cDNA served as the probe (24). Inter-lane loading variability was standardized by re-hybridization of the stripped filters with a 32P-labeled rat 18 S rRNA probe (25).
Protein Studies—Thirty to fifty µg of either cellular or brain homogenate or extracted nuclear protein (26) were solubilized in 50 mM Tris, pH 6.8, containing 2% SDS and the protein concentration determined by the Bio-Rad dye-binding assay (27). Western blot analysis was carried out as described previously (23). The primary antibody consisted of an affinity-purified rabbit anti-mouse GLUT 3 IgG that was generated against a keyhole limpet-linked terminal 17 amino acids of the mouse GLUT 3 protein and the isoform specificity previously characterized by us (23). The primary anti-mouse GLUT 3 antibody was used at a 1:500 dilution, and the incubation with filters containing the transferred proteins was carried out at room temperature for 16 h. To detect nuclear proteins, the rabbit anti-synthetic human Sp1 peptide (436-454 amino acid region), anti-synthetic human Sp3 peptide (676-695 amino acids at the C-terminal region) (Santa Cruz Biotechnology, Santa Cruz, CA), anti-rat CREB (Upstate Biotechnology, Inc., Lake Placid, NY), and anti-mouse c-Jun (247-263 amino acids) (Santa Cruz Biotechnology, Santa Cruz, CA) antibodies were employed. Antibodies raised in rabbit against the MSY-1 peptide sequence NH2-DPPAENSSAPEAEQGGAECOOH (28) were affinity-purified by using an Amino-link Immobilization kit (Pierce). In certain instances 125I-labeled goat anti-rabbit secondary antibody (50,000 cpm/sample, PerkinElmer Life Sciences) was used to detect the primary antigen-antibody complex. Autoradiography of the filters was carried out for optimal lengths of time to maintain linearity of the signal. Detection of protein bands for MSY-1 was carried out by subjecting the immunoblots to the chemiluminescent method (Amersham Biosciences) of detection.
Primer Extension Assay—Primer extension was carried out as described previously (23). Briefly, an antisense oligonucleotide (Cruachem Inc., Dulles, VA) complementary to the +299 to +320 bp of the murine GLUT 3 mRNA (CTTCGTTGTCCCCATGGTCCCA) was end-labeled with [
-32P]ATP (DuPont). 5 x 106 cpm (50 fmol) of the labeled oligonucleotide and 5 µg of poly(A+) mRNA were mixed in 1 µl of the hybridization buffer (80% formamide, 0.4 M NaCl, 40 mM PIPES, pH 6.8, and 1 mM EDTA) and incubated for 10 min at 95 °C. Hybridization between the mRNA and labeled oligonucleotide was accomplished for 16 h at 42 °C. Reverse transcription was initiated by adding 30 units of avian myeloblastosis virus-reverse transcriptase (Promega, Madison, WI) to the mRNA/oligonucleotide mixture in 20 µl of a mixture consisting of 50 mM Tris, pH 8.3, 6 mM MgCl2, 40 mM KCl, 10 units of RNasin, 0.625 mM dNTPs, and the reaction was carried out at 42 °C for 1 h. The primer-extended products were purified using Jetsorb (Genomed Inc., Research Triangle Park, NC) and separated on 8% polyacrylamide gels.
RNase Protection Assay—A 341-bp fragment spanning -203 to +237 bp of the mouse Glut 3 gene was amplified by PCR and cloned into pGEM3z(f). 32P-Labeled antisense RNA probe was synthesized by the Sp6 polymerase using a riboprobe kit (Promega, Madison, WI). About 50,000 cpm (0.5 fmol) of gel-purified riboprobe was hybridized overnight at 45 °C with 5 µg of mRNA from the 21-day-old mouse brain in a hybridization buffer containing 80% formamide, 100 mM sodium citrate, pH 6.4, 300 mM sodium acetate, pH 6.4, and 1 mM EDTA. The hybrid was digested with 200 µl of a 1:50 dilution of RNase A (250 units/ml) and RNase T1 (10,000 units/ml) for 30 min at 37 °C prior to analysis on a 5% polyacrylamide gel.
Transient Transfection and Reporter Expression Assays—A 1.8-kb fragment of the mouse GLUT 3 spanning the -1553- to +237-bp region was amplified by PCR and cloned into an enhancerless and promoterless firefly luciferase reporter gene containing vector (pGL2-basic: Promega, Madison, WI). Subsequently, serial 5'-deletional mouse GLUT 3-Luc fusion gene constructs were created by using a PCR-based strategy employing primers listed in Table I. The sequence and orientation of the individual clones were confirmed by direct DNA sequencing. The sequence information was managed using the MacVector5.0 sequence analysis program (Oxford Molecular Group, Campbell, CA).
|
The luciferase reporter activity was assessed by the dual luciferase assay (Promega, Madison, WI). Briefly, 36-48 h of post-transfection the cells were washed with PBS and lysed using 0.5 ml of passive lysis buffer (Promega, Madison, WI). The supernatant on centrifugation at 10,000 rpm for 10 min was stored at -70 °C until analysis. Twenty µl of this cellular extract was mixed with 100 µl of the luciferase assay buffer, and the firefly luciferase activity was measured as light output (15 s) in a Monolight 2010 luminometer (Analytical Luminescence, San Diego, CA) (23). Subsequently the Renilla luciferase activity was estimated after the addition of 100 µl of the Stop and Glo reagent, and the light output (15 s) was measured separately. The Renilla-driven luciferase activity was used to standardize the Glut 3 promoter-driven firefly luciferase activity for transfection efficiency. The corrected Glut 3 promoter-driven luciferase activity was expressed as a percentage of the SV40 promoter-driven luciferase activity that served as the positive control in every transfection experiment.
Small Interference (Si) RNA Transfection Experiments—SiRNA was constructed to target the mouse CREB (Dharmacom Inc., Dallas, TX) sequence between the +810- to +830-bp coding region by using the following oligonucleotides: sense, 5'-GAGAGAGGUCCGUCUAAUGUU-3', and antisense, 5'-CAUUAGACGGACCUCUCUCUU-3' (29). Complementary oligonucleotides were converted to a 2'-hydroxyl annealed and desalted duplex strands with a 9-base spacer, thereby creating a short hairpin RNA that was driven by the RNA polymerase III promoter followed by a (T)5 RNA poly III transcriptional stop signal. Co-transfections into N2A cells were performed by using the -203-bp GLUT3-luciferase DNA construct (2 µg) and the constructed SiRNA targeted at CREB (100 nM) in 6-well plates using Trans-It-LTI and Trans-IT-TKO (Mirus Corp., Madison, WI) as transfection reagents, respectively (29, 30). PGL2 basic consisting of the firefly luciferase as the reporter in the absence of a promoter region was used as a negative control. To assess the transfection efficiency, 0.25 µg of pRL-TK plasmid DNA (thymidine kinase promoter-driven Renilla luciferase; Promega, Madison, WI) was co-transfected as well. Luciferase activity was measured in 10 µl of the N2A cellular extract (Zylux FB 15 tube luminometer, Fisher) at 48 h post-transfection by the dual luciferase assay system (Promega, Madison, WI). In addition, 30 µg of protein from SiRNA-transfected N2A cell lysates was subjected to SDS-PAGE, and the separated proteins were transferred onto nitrocellulose membranes. Each nitrocellulose membrane was washed twice for 10 min in distilled water. The membranes were then blocked by incubating with freshly prepared 5% bovine milk solution in PBS for 1 h at room temperature under constant agitation. The membranes were then washed with distilled H2O and incubated with 1:1000 dilution of the anti-CREB (Upstate Biotechnology, Inc.) antibody that was diluted in PBS containing 1% bovine milk solution. The incubation with primary antibody was conducted overnight with constant agitation at 4 °C, washed twice with distilled H2O, and incubated with the secondary antibody that was the anti-rabbit horseradish peroxidase-conjugated IgG (Sigma) diluted in a PBS, 1% milk solution for 1.5 h at room temperature with agitation. The nitrocellulose membranes were washed twice with diluted H2O, followed by a wash in PBS, 0.05% Tween 20 for 5 min, and rinsed twice in distilled H2O. Detection of protein bands for CREB was carried out by subjecting the immunoblots to the chemiluminescent method (Amersham Biosciences) of detection and then exposing them to x-ray film. Autoradiography of the filters was carried out for optimal lengths of time to maintain linearity of the signal (31).
Electromobility Shift Assay (EMSA)—Nuclear extracts from the N2A cells, 1- and 21-day-old mouse brains were prepared as described by Wildeman et al. (26). Briefly, brain tissue was obtained, or 5 x 108 cells were retrieved by a rubber policeman and suspended in 10 mM Hepes, pH 7.8, 10 mM KCl, 1.5 mM MgCl2, 0.5 mM dithiothreitol, 0.5 mM phenylmethylsulfonyl fluoride, and 25% glycerol to extract the nuclear proteins. The extracted nuclear proteins were collected as the supernatant after centrifugation at 10,000 rpm for 30 min and precipitated with solid (NH4)2SO4 by centrifugation at 15,000 rpm for 15 min, and the supernatant was stored in aliquots at -70 °C. The concentration of the solubilized nuclear protein was measured by the method of Bradford (27), and the concentration was adjusted to 1 mg/ml.
Synthesized double-stranded oligonucleotides using the primers listed in Table II were end-labeled with [-32P]ATP and T4 polynucleotide kinase. Approximately 6 fmol of the labeled DNA oligoprobe was added to 5 µg of nuclear extract in a final volume of 20 µl containing 1 µg of poly(dl-dC), 10 mM Tris-HCl, pH 7.5, 50 mM NaCl, 0.5 mM EDTA, 1 mM MgCl2, 4% glycerol, 1 mM dithiothreitol and incubated for 15 min at room temperature. Subsequently, the DNA-protein complexes were separated from the unbound DNA by electrophoresis through a 5% non-denaturing polyacrylamide gel in a 90 mM Tris borate, 2 mM EDTA buffer (23). The gels were dried and subjected to autoradiography in the presence of intensifying screens (PerkinElmer Life Sciences) at -80 °C. Competition experiments included the addition of 10-1000-fold excess of unlabeled DNA oligonucleotides, whereas supershift analysis included the addition of 2 µg of the respective antibody to the reaction mix for 15 min.
|
-mercaptoethanol, and heating for 5 min at 90 °C. The eluted protein was then analyzed by Western blot analysis by probing with antibodies against MSY-1. Identification of MSY-1 as a Glut 3 Promoter Binding Protein by Shift-Western Analysis—Because the MSY-1 antibody available for the current studies did not supershift MSY-1 protein when complexed with single-stranded DNA (data not shown), the presence of MSY-1 in the protein-DNA complex was ascertained by the shift-Western technique (28). Briefly, following a preparative electromobility shift analysis, the location of the DNA-protein complex was determined by using a PhosphorImager. The portion of the gel containing the shifted band was excised and transferred to nitrocellulose membrane (Bio-Rad) and subjected to Western blot analysis using the antibody raised against MSY-1 (28).
Confirmation of the Sp3, CREB, and MSY-1 DNA Bindability by the Chromatin Immunoprecipitation Assay—Chromatin immunoprecipitation (ChIP) assay was performed as described by Boyd and Farnham (33). N2A murine neuroblastoma cells (2 x 107 in a 150-mm culture dish) were fixed with 1% formaldehyde for 15 min at room temperature. The cell pellet was resuspended in cell lysis buffer (5 mM Pipes (KOH), pH 8.0, 8.5 mM KCl, 0.5% Nonidet P-40) containing protease inhibitors and homogenized with a type B Dounce homogenizer. The nuclei were lysed in the nuclear lysis buffer (50 mM Tris, pH 8.1, 10 mM EDTA, 1% SDS) containing protease inhibitors. The chromatin was sonicated (Fisher model 60 Sonic Dismembrator) on ice with three pulses of 15 s each at setting 3 with a 1-min interval. The chromatin was sonicated to an average length of about 600 bp as determined by resolving the purified DNA on a 1.5% agarose gel. The sample was then centrifuged at 4 °C in an Eppendorf centrifuge (10 min at 14,000 rpm) to remove the cell debris from crude chromatin lysate. Ten percent of the lysate was set aside as the input chromatin. The sheared chromatin from 107 cells was pre-cleared at 4 °C for 15 min with 10 µl of staphylococcus A cells (Sigma) which were blocked with 10 µl of herring sperm DNA and 10 µl of bovine serum albumin both at a concentration of 10 mg/ml. One hundred µl of pre-cleared chromatin lysate was incubated with 1 µg of either Sp3 (Santa Cruz Biotechnology, Santa Cruz, CA), CREB, or pCREB polyclonal antibody (Upstate Biotechnology, Inc.) and shaken on a nutator at 4 °C. Then 1 µg of a rabbit secondary antibody (Sigma) was added to the sample and incubated at room temperature for an additional hour. Ten µl of blocked staphylococcus A cells was added to the sample and incubated at room temperature for 15 min. The sample was centrifuged at 14,000 rpm for 15 min at room temperature. The supernatant was removed, and the pellet was washed twice in 1.4 ml of a dialysis buffer (100 mM Tris-HCl, pH 9.0, 500 mM LiCl, 1% Nonidet P-40, 1% deoxycholic acid). Antibody-protein-DNA complexes were eluted with an elution buffer (50 mM NaHCO3, 1% SDS) by vortexing the sample for 30 min at setting 3. The staphylococcus A cells were separated as a pellet, and the supernatant was collected. The elution process was repeated once more, and the combined supernatants were incubated at 65 °C for 5 h with 1 µl of RNase A (10 mg/ml) for reversal of the formaldehyde cross-links. Precipitation of DNA in the supernatants was carried out overnight at -20 °C in 2.5 volumes of absolute ethanol. The precipitated pellet was air-dried, subsequently dissolved in Tris/EDTA buffer (10 mM Tris-HCl, pH 8.0, and 1 mM EDTA), and treated with proteinase K at 45 °C for 2 h. The DNA was purified once with phenol/chloroform/isoamyl alcohol and once with chloroform/isoamyl alcohol and subsequently precipitated overnight at -20 °C in ethanol with 5 µg of tRNA and 5 µg of glycogen. The DNA concentration was determined by the Dip Stick kit (Invitrogen). DNA (4 ng) that was complexed with the immunoprecipitated protein was used as a template in each PCR.
Our initial attempts at cross-linking with formaldehyde did not immunoprecipitate MSY-1-associated DNA. We speculated that this may be due to MSY-1 being tethered to chromatin by another protein cofactor. Thus to increase the efficiency of cross-linking the MSY-1 complex to its DNA target sites in vivo, we treated the cells first with dimethyl adipimidate (Pierce), a protein-protein cross-linking agent, followed by formaldehyde as per the method of Kurdistani and Grunstein (34) with some modifications. After washing the adherent N2A cells once with ice-cold PBS, 10 µl of a fresh solution of 10 mM dimethyl adipimidate in ice-cold PBS containing 0.25% dimethyl sulfoxide (Me2SO, Sigma) was added and incubated for 45 min with gentle shaking on a rotary platform at room temperature, followed successively by an ice-cold PBS wash and a final concentration of 1% (w/v) formaldehyde in PBS at room temperature for 3 h on a rotary platform. The reaction was stopped by adding glycine, and the subsequent experimental steps of the ChIP assay as outlined above were undertaken employing an affinity-purified rabbit anti-MSY-1-(242-267) antibody (32). The primers used in the ChIP assay were designed and synthesized by Retrogen Inc. (San Diego, CA). The sequence of the forward primer for detecting Sp3 and CREB/pCREB-binding sites was 5'-agcagcactgactctactctgcg-3' extending from -192 bp of the mouse Glut 3 gene, and the reverse primer for detecting Sp3 and CREB/pCREB-binding sites was 5'-ttactacatcctcctcgtgg-3' beginning at the -7 bp of the mouse Glut 3 gene. The intervening sequence that would be amplified contained the MSY-1-binding site as well. The sequence of the forward primer for detection of the MSY-1-binding site was 5'-aggctgtcggctctt-3' extending from -89 bp of the mouse Glut 3 gene, and reverse primer for detecting the MSY-1-binding site was 5'-gtatccagccaatgttctcg-3' starting from the +260 bp of the mouse Glut 3 gene. The intervening sequence that would be amplified excluded the Sp3- and the CREB/pCREB-binding sites.
The PCR employed in the ChIP assay consisted of 50 µl of the PCR mix containing 5 µl of the DNA template, 0.25 µl of each primer (0.5 µM), 5.0 µl of PCR buffer (10 times) with 15 mM MgCl2, 4 µl of 2.5 mM dNTPs, and 0.25 µl of Taq polymerase (5 units/µl), which was subjected to amplification in a T3 thermocycler (Biometra). The PCR parameters for the Sp3 binding region or the CREB/pCREB-bound AP-1 region of the Glut 3 gene were initially at 95 °C for 2 min, followed by 30 cycles at 95 °C for 30 s to denature, 55 °C for 30 s to anneal, and 72 °C for 90 s to extend the DNA. The PCR parameters for amplifying the MSY-1-bound sequence of the Glut 3 gene were 30 cycles at 95 °C for 30 s to denature, 58 °C for 30 s to anneal, and 72 °C for 30 s to extend the DNA. The final PCR-amplified product was purified and identified by the predicted size on a 2% agarose gel along with the 100-bp DNA ladder (Bayou BioLabs, Los Angeles, CA). In addition, co-immunoprecipitation of MSY-1 with CREB was accomplished by immunoprecipitating chromatin from N2A with 1 µg of the MSY-1 antibody as described above. The immunoprecipitated antibody-antigen-DNA complex was subjected to a reversal of the cross-link followed by Western blot analysis as described above by using the anti-CREB antibody (dilution 1:1000) as the primary antibody, with the HeLa cell nuclear extract serving as the antigen (CREB)-positive control.
Data Analysis—All data are depicted as mean ± S.E. Differences between two groups were validated by the Student's t test, and differences between more than two groups were determined by the one-way analysis of variance, and inter-group differences were validated by the Neuman-Kuel's test.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
|
|
|
To test the putative AP-1 site for protein binding activity, an oligoprobe encompassing the -187- to -180-bp region was used in gel-shift assays with nuclear proteins from N2A cells. These experiments revealed the presence of four protein-DNA complexes (Fig. 4A). Competition experiments using unlabeled oligoprobe established that there was a dose-dependent abrogation of DNA binding of protein complexes 1-3 with complex 4 deemed to be nonspecific because of lack of competition (Fig. 4B, lanes 5-7). To establish the identity of the proteins that participated in the formation of complexes 1-3, we performed competition experiments with unlabeled oligonucleotides containing canonical binding sites for common DNA-binding proteins. An oligonucleotide containing the AP-1 consensus sequence competed for the binding proteins to this region (Fig. 4A). In contrast, oligoprobes representing CTF/NF1, C/EBP, Sp1, GRE, and TFIID consensus binding sites failed to abrogate formation of the protein-DNA complexes at this site (Fig. 4A). When a mutant oligoprobe was employed, it did not show the band that was displaced by AP-1 and CREB sequences (Fig. 4A, lane 11). To determine the identity of the proteins in the protein-DNA complex, supershift assays were performed. These experiments revealed a supershift in the presence of the anti-CREB antibody (Fig. 4, B, lane 3, and C, lanes 3, 7, and 11) with no change in the presence of the anti-c-Jun antibody (Fig. 4, B, lane 4, and C, lanes 4, 8, and 12). In the presence of an antibody targeted toward the phosphorylated CREB (Ser-133), the supershift was more prominent when compared with the anti-dephosphorylated CREB antibody alone (Fig. 4C, lanes 5, 9, and 13). This pattern was evident in N2A cells, and the 1- and 21-day-old mouse brain nuclear extracts as well. The identity of complexes 1 and 3 remain to be determined. Western blot analysis, using the anti-CREB antibody, and anti-phospho-CREB (Ser-133) antibodies revealed CREB expression in the 21- and 1-day-old mouse brains similar to the N2A cells (Fig. 4D).
|
|
|
In addition, transient transfection experiments utilizing deletion luciferase-fusion constructs containing the region between -104 and -63 bp of the Glut 3 gene indicated the presence of a regulatory element (Fig. 7A). EMSA experiments further established that nuclear protein(s) from N2A cells and 1- and 21-day-old mouse brains (1-day > 21-day) specifically bound to this region of the Glut 3 promoter (Fig. 7B). The precise identity of the protein(s) in this DNA-protein complex remains to be determined.
|
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
It is very well established that genes lacking a typical "TATA" box in their promoter sequence depend on multiple upstream regulator sequences for their activation (35). The murine Glut 3 gene does not possess a TATA box but has a GC-rich promoter region (23), suggesting the possibility that the Sp family of proteins may interact with this promoter region (36-42). Our present investigation demonstrates that both Sp1 and Sp3 are present in nuclei obtained from the 1- and 21-day-old mouse brains, at a developmental stage beyond neurogenesis or neuronal proliferation (14-16). Both of these nuclear proteins bound the Glut 3 gene exactly in the same manner as described previously (23) in N2A neuroblastoma cells. Although both Sp1 and Sp3 bind the Glut 3 promoter, both of these proteins demonstrate opposing effects on GLUT 3 expression in neurons/brain (23). Various other systems have demonstrated that Sp1 can function as an activator of genes, whereas Sp3 competing for the same DNA-binding site represses gene activation (43, 44). Yet in other systems, Sp3 has been observed to be the activator, being synergistic or antagonistic to the action of Sp1 (45-47). Whether the Sp family of proteins function as gene activators or repressors depends on the number of Sp-binding sites present in the promoter region. The presence of a single Sp1 site that is capable of interacting with Sp3 (45, 48) results in Sp3 not functioning as a gene repressor, whereas multiple sites result in Sp3 acting as a repressor (44, 47). In the case of GLUT 3, a single Sp-binding site capable of interacting with Sp3 is present in the immediate 5'-flanking region. Thus, Sp3 functions as an activator, whereas Sp1 functions as a repressor of the Glut 3 gene expression (23). Sp1 suppresses other genes as well, such as the -globin gene activation when a site-specific cytosine in the promoter region is methylated (49). In addition, both Sp1 and Sp3 have been observed to regulate transcriptional activation of histones (44, 50) and the DNA methyltransferase enzyme 1 gene, thereby altering the methylation status of genes (51). Thus Sp1 and Sp3 can suppress genes by activating mechanisms that influence the epigenetic regulation of gene expression (44, 49-51).
It is of interest to note that Sp1 and Sp3 are implicated in the regulation of Glut 1 gene expression during myogenesis (52, 53) and independently regulate genes necessary for neuronal differentiation (54). Based on the results of the present study, we speculate that Sp1/Sp3 may play a role in the developmental regulation of neuronal GLUT 3 expression. Thus, Sp1/Sp3 concentrations and GLUT 3 DNA bindability may change during different stages of neuronal maturation (proliferation, early embryonic versus differentiation, postnatal stage (11, 12, 55)). Sp1/Sp3 phosphorylation state or transcription could also be induced by certain neuron-specific stimuli (growth factors such as brain-derived neurotrophic factor and transforming growth factor-) similar to the induction by insulin observed in other cell systems (56, 57).
CREB, a basic leucine zipper transcription factor, binds the cAMP-response element sequence or occasionally the AP-1 site to activate gene expression (58-60). On binding of cAMP, protein kinase A translocates to the nucleus and phosphorylates CREB on serine 133, which can result in transcriptional activation of CREB. In addition, phosphorylation of serine 133 can occur by Ca2+-activated calmodulin kinase, ribosomal S6 kinase 2, or mitogen-activated protein kinase. Thus numerous upstream signaling factors can lead to the phosphorylation of CREB. Although many factors phosphorylate CREB at serine 133, calcium influx phosphorylates serine 133 and two additional sites, serine 142 and serine 143 (61). Phosphorylation of CREB at these different sites may have important physiological consequences. Phosphorylation at the serine 133 leads to the recruitment of the CREB-binding protein (CBP) to the genome; however, the subsequent phosphorylation of serine 142 and serine 143 via the calcium-activated pathways prevents the interaction of CREB with CBP (58, 61). Variance in how CREB is being phosphorylated determines those co-regulatory proteins that are recruited to the transcriptional complex. The formation of unique transcriptional complexes may be a mechanism by which CREB can induce different patterns of gene transcription within the brain (58, 61-64). CBP also increases genomic activity by acetylating histones, leading to a reduction in higher order chromatin structures and making DNA more accessible to transcription factors (65, 66). CBP also enhances transcription by bridging transcriptional factors, such as CREB, to the basal transcriptional complex (65, 66). Although we did not specifically investigate the role of CBP in regulating GLUT 3 transcription, we observed that Ser-133 phosphorylation led to enhanced binding of CREB to the enhancer AP-1 site of the Glut 3 gene (within a linearized DNA fragment and chromatin), thereby trans-activating gene expression. Furthermore, employing SiRNAs against CREB in transient transfection experiments resulted in a suppression of endogenous CREB protein concentrations and decreased GLUT 3 transcription in neurons.
CREB is believed to play a vital role in signal transduction that promotes survival and differentiation of neurons (67). -Adrenergic receptors that mediate the action of dopamine and norepinephrine in neurons increase intracellular cAMP concentrations that activate protein kinase A. In contrast, peptides such as nerve growth factor and brain-derived neurotrophic factor (68, 69), N-methyl-D-aspartate, or the excitatory -aminobutyric acid neurotransmitters (69) trans-activate CREB by phosphorylation via the calcium/calmodulin-dependent kinase IV and a mitogen-activated protein kinase (68, 69). Phosphorylation of CREB leads to induction of downstream early genes such as c-fos (70), zif/268 (71), hsp70 (72), and bcl-2 (73) that may either increase biosynthesis of neurotrophic factors or block cell death pathways (69, 73). c-Fos induces biosynthesis of neurotrophic factors by increasing activator protein-1 (AP-1) binding activity (75). Heat shock protein 70 acts as a molecular chaperone that prevents the aggregation of denatured proteins and promotes the refolding of damaged polypeptides. Bcl-2 is an anti-apoptotic protein that blocks the mitochondrial permeability transition pore (73). Formation of mitochondrial permeability transition under adverse conditions, such as mitochondrial calcium overload and reactive oxygen species, permits the release of cytochrome c and apoptotic inducing factor into the cytoplasm that subsequently trigger cell death pathways, eventually causing cell death either by apoptosis or by necrosis (73, 74).
Phosphorylation of CREB is also proposed as a "memory molecule." Disruption of the regulatory subunit of cAMP-dependent protein kinase specifically impairs late phase transcription-dependent long term potentiation and the performance in learning tasks (75), whereas conditional knock out of CREB has led to some contradictory results due to redundancy because of the presence of closely related isoforms (76). Regardless, phosphorylated CREB is a key molecule in activating gene expression in neurons that mediate critical physiological processes. CREB is a transcription factor in control of many genes related to synaptic plasticity, long term potentiation, cell survival, and differentiation (73-75). In the present report we have established that CREB binds GLUT 3 DNA and enhances its expression in neurons both in vitro and in vivo. This is the first report demonstrating pCREB (Ser-133) binding to the Glut 3 gene in neurons during development. This interaction exists at both postnatal stages examined, namely day 1 and 21. Thus, pCREB-activated GLUT 3 in neurons may play a role in fueling normal synaptic activity, the process of neuro-development, and potentially in neuro-protection (13, 20, 31). Along with the other neuro-protective genes such as hsp70, c-fos, and bcl-2 (70, 72, 73), trans-activation of neuronal GLUT 3 by CREB may ensure adequate neuronal glucose supply. Furthermore, as seen in other systems (77, 78), during neuronal development interaction between CREB and Sp3 may be necessary for trans-activation of the Glut 3 gene (23).
The protein that binds the downstream Glut 3 gene-activating element (region C) is the single-strand binding protein MSY-1, which is developmentally regulated and functions in regulating storage and translation of germ cell RNAs (79, 80). MSY-1 is responsible for binding to a single strand of DNA in the 5'-flanking region of a gene and thereby enhancing the ability of this region to bind other transcription factors (28). MSY-1 demonstrates an affinity to asymmetric polypurinepolypyrimidine cis-elements found in the 5'-flanking regions of genes (32). MSY-1 protein is expressed in fibroblasts, hepatocytes, and spermatogenic cells (28, 32, 80). Our present report is the first to demonstrate expression of MSY-1 in neurons/brain and its ability to bind the Glut 3 gene either directly or indirectly through a protein-protein interaction. This protein has been described to activate or repress various genes during development and in the adult (28, 32, 80). We observed that MSY-1 bound the -89- to -66-bp region of the Glut 3 gene and moderately activated GLUT 3 expression. Other nuclear proteins could potentially bind the double-stranded DNA in this region, as was seen with NF-Y and MSY-1 in the case of the murine growth hormone receptor gene (28). Our preliminary studies suggest that a nuclear protein binds the double-stranded DNA in the -83- to -69-bp region of the Glut 3 gene activating GLUT 3 expression in transient transfection experiments. Thus it is quite possible that this protein interacts with MSY-1 thereby bringing about GLUT 3-MSY-1 bindability. However, this protein is not CREB, because CREB does not bind MSY-1 when the Glut 3 gene is tethered to MSY-1. Because co-immunoprecipitation demonstrates some interaction between the two nuclear factors, it is possible that MSY-1 interacts with CREB when CREB binds the Glut 3 gene, thereby modulating CREB-mediated GLUT 3 transcription.
We conclude that in addition to Sp1/Sp3, the DNA-binding proteins CREB and MSY-1 bind the neuronal Glut 3 gene and augment the expression of GLUT 3. We speculate that CREB may mediate neuronal glucose transport necessary to fuel and meet the energy demands imposed by cyclic AMP-dependent protein kinase or Ca2+/calmodulin kinase-mediated synaptic activity and neurotransmission, whereas Sp1/Sp3 and MSY-1 in conjunction with another yet to be identified nuclear factor may play a role in developmentally regulating GLUT 3 expression. Future studies will focus on the role these transcription factors play in developmentally (neuronal proliferation and differentiation, e.g. synaptogenesis) regulating GLUT 3 expression in neurons, during neuronal activity (depolarization), and during conditions of substrate deficiency such as hypoxicischemic brain injury.
|
FOOTNOTES |
|---|
These authors contributed equally to this work.
** To whom correspondence should be addressed: Dept. of Pediatrics, David Geffen School of Medicine, UCLA, 10833 Le Conte Ave., MDCC B2-375, Los Angeles, CA 90024-1752. Tel.: 310-825-9357; Fax: 310-794-6638.
1 The abbreviations used are: pCREB, phosphorylated cAMP-regulatory element-binding protein; ChiP, chromatin immunoprecipitation; Si, small interference RNA; CREB, cAMP-response element-binding protein; PBS, phosphate-buffered saline; EMSA, electromobility shift assay; oligo, oligonucleotide; PIPES, 1,4-piperazinediethanesulfonic acid; CBP, CREB-binding protein; AP-1, activator protein-1.
|
ACKNOWLEDGMENTS |
|---|
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
