JBC Avanti Polar Lipids

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M401352200 on April 23, 2004

J. Biol. Chem., Vol. 279, Issue 26, 27108-27115, June 25, 2004
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
279/26/27108    most recent
M401352200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Subramaniam, K.
Right arrow Articles by Tholanikunnel, B. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Subramaniam, K.
Right arrow Articles by Tholanikunnel, B. G.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

The 3'-Untranslated Region of the {beta}2-Adrenergic Receptor mRNA Regulates Receptor Synthesis*

Kothandharaman Subramaniam{ddagger}§, Kenneth Chen{ddagger}§, Kusumam Joseph{ddagger}, John R. Raymond{ddagger}§, and Baby G. Tholanikunnel{ddagger}§||

From the {ddagger}Department of Medicine and the Divisions of §Nephrology and Pulmonary, Critical Care Medicine, Allergy, and Clinical Immunology, Medical University of South Carolina, Charleston, South Carolina 29425-2221

Received for publication, February 6, 2004 , and in revised form, April 8, 2004.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
{beta}2-Adrenergic receptors ({beta}2-ARs) are low abundance integral membrane proteins that mediate the effects of catecholamines at the cell surface. Post-transcriptional regulation of {beta}2-AR is dependent, in part, on sequences within the 5'- and 3'-untranslated regions (UTRs) of the receptor mRNA. In this work, we demonstrate that 3'-UTR sequences regulate the translation of the receptor mRNA. Deletion of the 3'-UTR sequences resulted in 2–2.5-fold increases in receptor expression. The steadystate levels of {beta}2-AR mRNA did not change significantly in the presence or absence of the 3'-UTR, suggesting that the translation of the receptor mRNA is suppressed by 3'-UTR sequences. Introduction of the receptor 3'-UTR sequences into the 3'-UTR of a heterologous reporter gene (luciferase) resulted in a 70% decrease in reporter gene expression without significant changes in luciferase mRNA levels. Sucrose density gradient fractionation of cytoplasmic extracts from Chinese hamster ovary cells transfected with full-length receptor cDNA demonstrated that the receptor transcripts were distributed between polysomal and non-polysomal fractions. Deletion of 3'-UTR sequences from the receptor cDNA resulted in a clear shift in the distribution of receptor mRNA toward the polysomal fractions, favoring increased translation. The 3'-UTR sequences of the receptor mRNA were sufficient to shift the distribution of luciferase mRNA from predominantly polysomal fractions toward non-polysomal fractions in cells transfected with the chimeric luciferase construct. Taken together, our results provide the first evidence for translational control of {beta}2-AR expression by 3'-UTR sequences. Presumably, this occurs by affecting the receptor mRNA localization.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
{beta}2-Adrenergic receptor ({beta}2-AR)1 mRNA, which is transcribed from a single intronless gene, makes low abundance membrane-integrated proteins that mediate the effects of catecholamines at the cell surface (1, 2). These receptors are widely distributed and play important roles in regulating cardiac, vascular, and pulmonary functions. Conservation of the {beta}2-AR sequences in different species extends beyond the coding region into the 5'- and 3'-untranslated regions (UTRs) (3, 4). The similarities of the {beta}2-AR 5'- and 3'-UTRs from humans and rodents were calculated to be 73 and 79%, respectively (4). Thus, it was presumed that these regions contain genetic elements that are required to regulate receptor expression and therefore been subject to selective pressure to preserve their sequence (4). This speculation has been shown to be correct by demonstrating translational suppression of receptor mRNA by a small open reading frame termed the 5'-leader cistron (5'-LC), which is present in the 5'-UTR of all mammalian {beta}2-AR mRNAs (5, 6). The 3'-UTR sequence of this receptor is important in regulating agonist-mediated mRNA destabilization (7–9).

Post-transcriptional regulation of mRNAs by 3'-UTRs is not limited to changes in message stability, as these sequences can specifically control subcellular targeting and translation of many transcripts (10–22). The 3'-UTR-mediated translational regulation leads mostly to translational silencing (10–13, 15–22), with a few exceptions where the 3'-UTR sequences are reported to promote translation (14, 22). This modulation of translation could be due to secondary structures in the UTR (15), which can influence mRNA translation either by increasing the binding affinity of eukaryotic initiation factors or by interacting with cellular proteins that can inhibit translational initiation (23–27). Transcript-specific translational control is generally directed by trans-acting proteins that bind to structural elements in the UTR of the target mRNA (28–33). 3'-UTR-mediated regulation of gene expression is important in diverse biological processes, including normal development and differentiation of eukaryotes (34, 35). Adenosine/uridine-rich elements (AREs) are sequences found in the 3'-UTR of many mRNAs and are evolutionarily highly conserved (22, 36). AREs are known to be present in several unstable mammalian oncogene and cytokine mRNAs (36). In addition to regulating mRNA stability (36), AREs also are known to affect mRNA translation and localization (11, 37–40). Several ARE-binding proteins that are involved in transcript-specific regulation of mRNA stability and translation have been identified (32, 33, 41, 42). Several conserved non-ARE sequences have also been identified in the 3'-UTR of mRNAs that are involved in transcript-specific translational control (19, 29, 43, 44). In addition to sequences of the 3'-UTR and its binding proteins, poly(A) tail length and poly(A)-binding proteins (45–47) are also known regulators of translation.

We previously identified a 20-nucleotide (A + U)-rich region present in the proximal region of the {beta}2-AR mRNA 3'-UTR that is important in agonist-mediated receptor mRNA destabilization (7, 9). In the present work, we demonstrate a major role for 3'-UTR sequences in translational control of {beta}2-AR mRNA. Generation of constructs in which the 3'-UTR was progressively truncated showed that sequences 3' to the 20-nucleotide (A + U)-rich region that regulate the agonist-mediated mRNA stability (7) are involved in translational control of receptor mRNA. Stable expression of the wild-type receptor and 3'-UTR deletion constructs showed that 3'-UTR sequences are involved in subcellular targeting of receptor mRNA. We further demonstrate that the 3'-UTR sequences of the {beta}2-AR can suppress the expression and localization of a heterologous reporter gene-like luciferase. Finally, the 3'-UTR-mediated translational control is independent of the 5'-LC and coding region sequence. These data provide the first evidence that the 3'-UTR sequence of the {beta}2-AR is involved in mRNA localization and translational control.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Cell Culture—Chinese hamster ovary (CHO) and human embryonic kidney 293 cells were grown in nutrient mixture F-12 supplemented with 10% heat-inactivated fetal bovine serum (Invitrogen).

Hamster {beta}2-AR Deletion Constructs—A pcDNA3 (Invitrogen)-based mammalian expression vector was used to make the various deletion constructs of {beta}2-AR cDNA. The entire 5'-UTR and coding region from hamster {beta}2-AR cDNA including the stop codon were PCR-amplified using Pfu polymerase and cloned into pcDNA3 for expression in cells. Similarly, the various deletion constructs and the full-length 3'-UTR without polyadenylation sequences were PCR-amplified and inserted into pcDNA3 with the 5'-UTR and coding region. The PCR-amplified regions were sequenced on both the sense and antisense strands. All of the constructs were made to use the bovine growth hormone polyadenylation signal.

Reporter Gene Constructs—Luciferase reporter gene constructs were also made in pcDNA3 to use the cytomegalovirus promoter to drive luciferase upstream of the polylinker site and to facilitate insertion of the 3'-UTR of {beta}2-AR cDNA into the 3-UTR sequence of the luciferase gene. All of the constructs were made to use the bovine growth hormone polyadenylation signal as described for the receptor constructs.

Transfection of CHO Cells—CHO cells were transfected with pcDNA3 harboring wild-type receptor cDNAs or various deletion constructs or with empty vector plasmids using LipofectAMINE (Invitrogen) following the manufacturer's instructions. Plasmid DNA concentrations were determined by UV spectrophotometry and confirmed by agarose gel electrophoresis of linearized plasmid DNA. A stable transfection system was used to evaluate the role of the 3'-UTR in regulating expression of the {beta}2-AR. CHO cells were transfected in 100-mm dishes using 5 µg of plasmid DNA. Stable transfectant clones were selected for neomycin resistance in nutrient mixture F-12 containing 10% fetal bovine serum and G418 (400 µg/ml). Antibiotic-resistant clones (always >200) were pooled for receptor assays. At least four independent transfection studies were performed using each receptor construct. CHO cells of the same passage and LipofectAMINE from the same lot number were used in each group of transfections to reduce differences in transfection efficiency. Cells were cotransfected with firefly luciferase to confirm equal transfection efficiency. The level of expression of the {beta}2-AR was determined for CHO cells by radioligand binding assay (48) of whole cells and crude membrane preparations.

Whole Cell Radioligand Binding Assay—Nearly confluent cells grown as monolayers on plates were washed with ice-cold phosphate-buffered saline (PBS) and removed from the plates with 1.0 mM EDTA in PBS. The cells were centrifuged at low speed; washed twice with ice-cold PBS; counted; and resuspended in ice-cold 75 mM Tris-HCl (pH 7.4), 5 mM MgCl2, and 2 mM EDTA. Binding assays were carried out using 50,000 or 100,000 cells/tube in a total volume of 0.1 ml, and 125I-cyanopindolol (400 pM) was used as the radioligand. Specific binding was defined as binding displaced by 10 µM DL-propranolol. Nonspecific binding was <10% of the total binding in whole cell binding assays. Assays were carried out for 90 min at 23 °C and terminated by rapid filtration through Whatman GF/C glass fiber filters previously soaked in PBS. Receptor number is expressed as femtomoles/105 cells or femtomoles/mg of membrane protein.

Crude Membrane Preparation—When crude membrane preparations were used for radioligand binding assays, cells expressing receptor were lysed by three cycles of freeze-thawing in 15 mM Tris-HCl (pH 7.4), 2 mM MgCl2, and 0.3 mM EDTA containing protease inhibitors. The lysate was centrifuged at 450 x g for 5 min at 4 °C, and the supernatant was centrifuged at 43,000 x g for 30 min at 4 °C. The final pellet was washed twice with the lysis buffer; resuspended at 1–2 mg/ml protein in 75 mM Tris-HCl (pH 7.4), 5 mM MgCl2, and 2 mM EDTA with protease inhibitors; and immediately used for radioligand binding assays as described for the whole cell binding assay. Nonspecific binding was <5% of the total binding in crude membrane binding assays. Protein concentrations were determined by the method of Bradford (49) with the Bio-Rad protein assay system using bovine serum albumin as the standard.

RNA Extraction and Determination of mRNA Levels—Total RNA was extracted from individual culture dishes using RNA STAT-60 reagent (Tel-Test, Inc., Tyler, TX) following the manufacturer's instructions with an extra step of extraction using 1.0 ml of chloroform/isoamyl alcohol (24:1) as described previously (50). Total RNA extracted was dissolved in RNase-free water and quantified, and the integrity of the RNA was tested directly by agarose gel electrophoresis. The amount of {beta}2-AR and luciferase mRNAs was determined by RNase protection assay as described (7, 9). An antisense riboprobe corresponding to 285 nucleotides (positions 1201–1485) from the coding region of {beta}2-AR mRNA was employed in the RNase protection assay. Similarly, luciferase mRNA levels were determined using an antisense riboprobe corresponding to 310 nucleotides (positions 1341–1650) from the coding region of the luciferase gene (Promega).

Expression of the Reporter Construct in CHO Cells—For direct comparison with receptor-transfected cells, the reporter (luciferase) construct with and without the receptor 3'-UTR region was transfected into CHO cells. Stable transfectant clones were selected with the antibiotic G418 and used for luciferase assay and RNA measurements.

Luciferase Assay—Luciferase assay was performed using a luciferase assay system (Promega) following the manufacturer's protocol. Briefly, stably transfected cells were washed once with cold PBS and removed from the plate with 1 mM EDTA in PBS. Cells were lysed by three cycles of freeze-thawing with vortexing; cellular debris was removed by centrifugation; and the supernatant was used for luciferase activity assay using a Victor 1420 multilabel counter (PerkinElmer Life Sciences). Activity is expressed as relative light units after normalizing for cell count.

Cell Fractionation and Polysome Analysis of {beta}2-AR mRNA with and without 3'-UTR Sequences—Polysomes were isolated following the method described previously (15, 32). CHO cells expressing either the wild-type receptor or complete 3'-UTR deletion constructs of the {beta}2-AR in pcDNA3 were washed twice with ice-cold PBS containing 150 µg/ml cycloheximide. Cells were detached and collected into 1.0 ml of ice-cold hypotonic lysis buffer (10 mM Tris (pH 7.2), 10 mM KCl, 10 mM MgCl2, 20 mM dithiothreitol, 150 µg/ml cycloheximide, 0.5 µg/ml heparin, 0.5% Nonidet P-40, and 100 units/ml RNasin) and allowed to swell for 5 min. Cells were mechanically disrupted by 10 strokes in a Dounce tissue homogenizer. Nuclei and cell membranes were removed by microcentrifugation for 10 min at 2000 x g. The supernatant was layered onto 11 ml of a 10–50% continuous sucrose gradient. Centrifugation was performed at 35,000 rpm for 3 h at 4 °C in an SW 40Ti rotor. 0.850-ml fractions were collected starting from the top of the gradient. Proper separation of fractions containing monosomes and polysomes was monitored by UV absorption at 254 nm. To obtain enough receptor RNA for RNase protection assay, two successive fractions were pooled, making a total of seven fractions. RNA from each fraction was extracted using phenol-containing reagent, re-extracted with chloroform/isoamyl alcohol, and then ethanol-precipitated. The RNA was dissolved in RNase-free water, and the distribution of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA was also determined in each fraction by reverse transcription (RT)-PCR to confirm proper loading of RNA in sucrose gradient analysis before using the samples for RNase protection assay of {beta}2-AR mRNA. Amplification primers for GAPDH were as follows: forward primer, CCTTCATTGACCTCAACTACAT; and reverse primer, CAAAGTTGTCATGGATGACC. {beta}2-AR mRNA in each fraction was determined by RNase protection assay using a {beta}2-AR-specific antisense probe as described previously (7).

Polysome Profile Analysis of Luciferase mRNA with and without Receptor 3'-UTR Sequences—Cytoplasmic extracts were made from CHO cells expressing luciferase constructs with the full-length receptor 3'-UTR sequences and luciferase without receptor 3'-UTR sequences. Fractionation of luciferase mRNA was done as described above for receptor mRNA, and the distribution of GAPDH mRNA was determined using the primers described above. The distribution of luciferase mRNA in each fraction was determined by RT-PCR using forward primer GCGAAAAAGTTGCGCGGAGGA and reverse primer CTAGAAGGCACAGTCGAGGCT. The number of cycles used in amplification was adjusted to avoid reaching a plateau during PCR cycles.

Mutagenesis of the 5'-LC ATG—Mutation of ATG to CTG at the 5'-LC was done by standard PCR mutagenesis, incorporating the nucleotide modifications into PCR primers on hamster {beta}2-AR cDNA by overlap extension PCR as described previously (7, 9). To circumvent the need to sequence the entire cDNA after mutagenesis, a 5'-KpnI fragment of {beta}2-AR cDNA was cut and ligated into the pcDNA3 vector carrying the rest of the receptor cDNA. The KpnI fragment was sequenced on the sense and antisense fragments to confirm the sequences before transfection into CHO cells.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
Regulation of {beta}2-AR Expression by the 3'-UTR—These experiments were undertaken to study the regulation of {beta}2-AR expression by its 3'-UTR sequences. For this, we made pcDNA3 bearing hamster {beta}2-AR cDNAs corresponding to the full-length receptor transcript and deletion mutants lacking either the full-length 3'-UTR or various regions of the 3'-UTR as shown in Fig. 1A. We used stable transfection into CHO and human embryonic kidney 293 cells to identify the regions within the 3'-UTR of the {beta}2-AR transcript that regulate receptor expression. Both of these cell lines express very few endogenous {beta}2-ARs and thus provide ideal cell types for ectopic expression of various {beta}2-AR deletion constructs. Both CHO and human embryonic kidney 293 cells gave similar results. Because the cDNA used is of hamster origin, the results reported here are those obtained from stable transfections into CHO (hamster) cells. {beta}2-AR expression was quantitated by a radioligand binding assay using (-)-125I-cyanopindolol performed in triplicate. These results show that deletion of the 3'-UTR sequences of the receptor resulted in 2–2.5-fold increases in receptor expression (Fig. 1B). All of the constructs were also cotransfected with firefly luciferase in pcDNA3 to avoid possible differences in transfection efficiency. Radioligand binding studies and luciferase assays were then carried out in cotransfected cells to confirm the above results. The average values obtained in the whole cell radioligand binding assay in CHO cells transfected with wild-type {beta}2-AR cDNA and 3'-UTR deletion mutants were 3 and 7 fmol/105 cells, respectively. Similar assays using crude membranes from transfected CHO cells gave average values of 400 fmol/mg if protein for the wild-type receptor and 1025 fmol/mg of protein for 3'-UTR deletion constructs. These results suggest the presence of negative regulatory element(s) within the 3'-UTR of {beta}2-AR mRNA.



View larger version (20K):
[in this window]
[in a new window]
  		FIG. 1.
Truncation of the {beta}2-AR 3'-UTR results in increased receptor expression without a significant change in receptor mRNA levels. A, shown are the deletion constructs of {beta}2-AR cDNA in pcDNA3. Plasmids expressing various deletion constructs of hamster {beta}2-AR were made as described under "Experimental Procedures." For all constructs, transcription of the receptor cDNA was under the control of the cytomegalovirus promoter, and the polyadenylation signal was derived from the bovine growth hormone gene. Numbering begins with the first nucleotide (nt) of the 3'-UTR of {beta}2-AR cDNA. The dashed lines show nucleotides deleted. 240 + (1) and 240 + (2) refer to deletion of the 100-nucleotide region from the 5'- and 3'-ends of the 340-nucleotide 3'-UTR sequences, respectively. 340 + (CR) refers to the 340-nucleotide fragment of the coding region (nucleotides 771–1110) replacing the 340-nucleotide fragment of the 3'-UTR sequence. B, CHO cells were transfected with equal quantities of the wild-type receptor (W-type) and various 3'-UTR deletion constructs of the {beta}2-AR. All transfections were done at the same time using CHO cells of the same passage and LipofectAMINE from the same lot number. G418-resistant clonal transfectants were used for receptor expression in radioligand binding assays using saturating concentrations of the {beta}2-AR ligand 125I-cyanopindolol (400 pM). Assays were performed in triplicate in whole cells and are calculated as femtomoles/105 cells. Data represent the means ± S.D. of four or more separate transfections with each construct. Cells were also cotransfected with firefly luciferase as a control for transfection efficiency. C, shown are the steady-state levels of {beta}2-AR mRNA in cells transfected with the wild-type receptor and various 3'-UTR deletion mutants of {beta}2-AR sequences. Total RNA was extracted from transfected CHO cells, and 25 µg of total RNA was used in ribonuclease protection assays using a {beta}2-AR-specific antisense probe as described previously (7). The RNase protection assay was done a total of three times using pools of >200 clones from each construct with similar results. D, equal quantities of RNA were run on agarose gel and stained with ethidium bromide to check for equal loading. E, the representative autoradiogram shows quantification of cytosolic RNA from CHO cells expressing various deletion constructs of the {beta}2-AR. CHO cells were lysed in hypotonic lysis buffer containing RNase inhibitor, and RNA was extracted from the cytosolic fraction as described under "Experimental Procedures." 25 µg of total RNA was used for RNase protection assays. Experiments were done twice, and similar results were obtained. One way analysis of variance using the data of two independent experiments did not show significant differences (p = 0.3332).

 
Compared with the full-length 3-UTR deletion, truncation of the distal 340 nucleotides while retaining the proximal 190 nucleotides did not result in significant changes in receptor expression (Fig. 1B). However, CHO cells transfected with the {beta}2-AR construct containing the distal 340 nucleotides after deletion of the proximal 190-nucleotide region resulted in >50% suppression of receptor expression compared with cells expressing complete 3'-UTR deletion constructs (Fig. 1B). These results indicate the importance of sequences beyond the first 190 nucleotides of 3'-UTR sequences in regulating receptor expression. To further characterize the sequence motifs within the 340-nucleotide region that are important in translational control of {beta}2-AR mRNA, we created two more {beta}2-AR constructs with deletions of 100 nucleotides each from the 5'- and 3'-ends of the 340-nucleotide region (Fig. 1A). CHO cells transfected with these constructs did not suppress the receptor expression, and the receptor levels were comparable with constructs with complete 3'-UTR deletions (Fig. 1B). Thus, further deletions from the 5'- or 3'-end of the 340-nucleotide 3'-UTR made these sequences nonfunctional for translational suppression of {beta}2-AR mRNA. Replacing the 340-nucleotide 3'-UTR sequences with sequences of similar length from the coding region also did not inhibit the translation of receptor mRNA (Fig. 1, A and B), suggesting that the translational suppression is specific to 3'-UTR sequences.

Decreased Expression of the Receptor Gene Occurs through Decreased Receptor mRNA Translation—Changes in receptor levels could result from alterations in either message stability or rates of mRNA translation. To distinguish between these two possibilities, we measured the steady-state levels of receptor mRNA in CHO cells expressing the wild-type receptor and different deletion constructs by RNase protection assay. Receptor mRNA levels in cells transfected with the wild-type receptor and different deletion constructs did not show significant differences (Fig. 1C). Thus, the increased receptor expression in 3'-UTR deletion constructs was not due to increased stability of receptor mRNA. Equal quantities of total RNA were subjected to agarose gel electrophoresis and stained with ethidium bromide as a loading control for the RNase protection assays (Fig. 1D). These measurements were done on total RNA that was isolated from CHO cells transfected with the wild-type receptor and 3'-UTR deletion constructs.

It was necessary to rule out the possibility of poor processing of full-length versus truncated mRNA that could be reflected in failure of the full-length transcript to move out of the nucleus. For this, we compared the relative amounts of cytoplasmic {beta}2-AR mRNA in transfectants that expressed the wild-type receptor with those that expressed various deletion constructs. Nearly equal amounts of {beta}2-AR mRNA were found in the cytoplasmic compartment of cells transfected with the wild-type receptor and the various 3'-UTR deletion constructs (Fig. 1E). These results suggest that the decreased expression of receptors in cells transfected with wild-type {beta}2-AR cDNAs was due to decreased translation of the receptor mRNA imposed by the 3'-UTR sequences.

Translational Suppression of the Luciferase Reporter Gene by {beta}2-AR 3'-UTR Sequences—Luciferase reporter gene constructs were made to determine the role of {beta}2-AR 3'-UTR sequences in mRNA translation independent of the rest of the receptor sequences. For this, the complete 3'-UTR or the distal 340 nucleotides of the receptor 3'-UTR were inserted into the 3'-UTR of luciferase. All the constructs were made in pcDNA3 to use the bovine growth hormone polyadenylation signal at the end of the multiple cloning site of the pcDNA vector. Thus, the three reporter constructs differed only in the 3'-UTR of the {beta}2-AR that was inserted into the luciferase 3'-UTR as shown in Fig. 2A. Because both of the reporter constructs contained identical promoter elements, differences in luciferase activity reflect differences in the regulation as a result of post-transcriptional events contributed by the receptor 3'-UTR sequences. We used CHO cells to study the regulation of luciferase expression by receptor 3'-UTR sequences. Reporter gene constructs were transfected into CHO cells, and G418-resistant clones were pooled and assayed for luciferase activity. Luciferase activity measured in cells transfected without receptor 3'-UTR sequences was designated as 100%. Insertion of the complete 3'-UTR or the distal 340-nucleotide region resulted in 60–70% decreases in luciferase activity as measured by enzymatic activity (Fig. 2B) and confirmed by Western blot analysis using anti-luciferase antibody (Fig. 2C). This suggested the presence of negative regulatory element(s) within the 3'-UTR of {beta}2-AR message. To confirm that the changes in luciferase expression were due to translational suppression as seen in the receptor-transfected cells, we measured the steady-state levels of luciferase mRNA in transfected cells by RNase protection assay (Fig. 2D). Insertion of the receptor 3'-UTR had no significant effect on the steady-state levels of luciferase mRNA compared with transfectants devoid of receptor 3'-UTR sequences. These results suggest that the decreased luciferase activity measured using these reporter constructs resulted from decreased translation of luciferase mRNA imposed by {beta}2-AR 3'-UTR sequences.



View larger version (29K):
[in this window]
[in a new window]
  		FIG. 2.
Inclusion of sequences from the 3'-UTR of {beta}2-AR cDNA in the luciferase reporter gene causes a decrease in luciferase activity. A, structures of reporter gene constructs. Both constructs contain the firefly luciferase coding region as a reporter gene. The entire hamster {beta}2-AR 3'-UTR or the distal 340 nucleotides from the 3'-UTR were inserted between the luciferase coding region and the bovine growth hormone polyadenylation signal in pcDNA3 in one construct. B, luciferase expression in CHO cells transfected with various deletion mutants. Data represent the means ± S.D. of four separate transfections with control and chimeric constructs. C, Western blot showing luciferase protein expression in reporter gene constructs with and without full-length 3'-UTR sequences. Western blotting was done twice, and similar results were obtained. D, representative autoradiogram of RNase protection assay of luciferase mRNA in CHO cells transfected with luciferase reporter gene constructs with and without full-length 3'-UTR sequences. The experiment was repeated using RNA isolated from three separate transfections each with control luciferase and chimeric constructs and showed similar results.

 
Cellular Localization of {beta}2-AR Transcripts—The 3'-UTR of the {beta}2-AR could regulate the translation of the receptor mRNA by several means, including translational blockage by localization of {beta}2-AR mRNA away from the translationally active population of ribosomes in the cytoplasm as well as blockage of translational elongation or termination. Processing of transcripts involves several steps, including capping, polyadenylation, and transport out of the nucleus and movement within, and localization within the cytoplasm (25, 51, 52). We eliminated the possibility of poor processing and transport of full-length versus truncated mRNA out of the nucleus by comparing the relative levels of {beta}2-AR mRNA in the cytosol from cells transfected with the wild-type receptor and 3'-UTR truncated constructs (Fig. 1E). To determine the basis for the post-transcriptional differences in {beta}2-AR mRNA translation induced by 3'-UTR sequences, we examined the association of its mRNA with polysomes. For this, CHO cells were transfected with wild-type receptor cDNA or complete 3'-UTR deletion constructs. Stable transfectant clones were pooled, and cytoplasmic lysates were prepared and subjected to sucrose density gradient ultracentrifugation. Fourteen continuous fractions, from lightest to heaviest, were collected. Absorbance at 260 nm was checked to monitor the presence of ribosomal subunits, ribosomes, and polysomes (Fig. 3A). Fractions 1–8 contained mainly small and large ribosomal subunits and monosomes. High molecular weight polysomes were found in fractions 9–14. To obtain sufficient quantities of receptor mRNA for quantitation by RNase protection assay, we pooled successive fractions to get a total of seven fractions. Total RNA from each fraction was extracted by phenol/chloroform, and the content of receptor mRNA in individual fractions was measured by RNase protection assay (Fig. 3, B and D). GAPDH mRNA levels in each fraction were determined by RT-PCR to check the proper loading of RNA in sucrose gradients (Fig. 3, C and E). When cytoplasmic extracts from CHO cells transfected with the wild-type receptor were subjected to sucrose density gradient centrifugation, a substantial portion of the receptor mRNA was associated with low molecular weight polyribosomes and monoribosomes (toward the top of the gradient) (Fig. 3B), indicating that wild-type receptor mRNA was inefficiently translated. However, similar experiments using cytoplasmic lysates from cells transfected with {beta}2-AR constructs with 3'-UTR deletions showed a clear shift in receptor mRNA to heavier ribosomal fractions (toward the bottom of the gradient) (Fig. 3D), indicating more efficient translation of this transcript. The efficiently translated GAPDH mRNA endogenously expressed in CHO cells was used as a control to test the validity of this approach. GAPDH mRNA was preferentially associated with the heaviest polyribosomal fractions in both experiments (Fig. 3, C and E).



View larger version (36K):
[in this window]
[in a new window]
  		FIG. 3.
Distribution of {beta}2-AR mRNA with and without 3'-UTR sequences in polysome preparations. CHO cells were transfected with either the wild-type receptor or 3'-UTR deletion constructs in pcDNA3. G418-resistant clonal transfectants were collected and used for preparation of cytoplasmic extracts. These experiments were done three times with the wild-type receptor and 3'-UTR deletion constructs, and similar results were obtained. A, representative profile of the 260 nm UV absorption through the sucrose gradients. Cytoplasmic lysates (1.0 ml) were prepared as described under "Experimental Procedures," layered over a 10–50% sucrose gradient, and centrifuged at 38,000 rpm for 3 h in an SW 40Ti rotor. A total of 14 fractions (0.850 ml) were collected from the top of the gradient, and absorbance was measured at 260 nm to identify fractions containing monosomes and polysomes. The first two fractions were devoid of any ribosomes, and fractions 3–8 contained monosomes. Polysomes were present in fractions 9–14. B, representative autoradiogram of RNase protection assay showing distribution of {beta}2-AR mRNA in CHO cells transfected with wild-type {beta}2-AR cDNA in sucrose density gradient analysis. Successive fractions were pooled to obtain a total of seven fractions. (This was necessary to obtain sufficient receptor RNA for quantification.) Total RNA was extracted from each fraction, and {beta}2-AR mRNA was analyzed by RNase protection assay. W, wild-type. C, GAPDH mRNA analysis by RT-PCR using RNA from each fractions as described for B. D, representative autoradiogram of RNase protection assay showing distribution of {beta}2-AR mRNA in CHO cells transfected with complete 3'-UTR deletion constructs in sucrose density gradient analysis. The experimental details were as described for B. E, GAPDH mRNA analysis by RT-PCR using RNA from each fractions as described for D.

 
Change in Reporter Gene mRNA Localization by Receptor 3'-UTR Sequences—To examine more directly the role of receptor 3'-UTR sequences in mRNA localization, we assayed the distribution of luciferase reporter gene mRNA with and without {beta}2-AR 3'-UTR sequences in polysomal fractions. CHO cells were transfected with luciferase cDNA with and without {beta}2-AR 3'-UTR sequences, and cytoplasmic lysates were subjected to sucrose density gradient ultracentrifugation. Absorbance at 260 nm was checked to confirm proper separation of ribosomal subunits, ribosomes, and polysomes (Fig. 4A). The polysome profiles of luciferase mRNA as measured by RT-PCR showed clear differences in distribution in the presence and absence of receptor 3'-UTR sequences. The patterns of luciferase mRNA distribution with and without receptor 3'-UTR sequences are shown in Fig. 4 (B and D). Although luciferase transcripts were found in the polysomal fraction (toward the bottom of the gradient) (Fig. 4D) in the absence of receptor 3'-UTR sequences, there was a clear shift in luciferase mRNA to nonpolysomal fractions (toward the top of the gradient) in the presence of receptor 3'-UTR sequences (Fig. 4B). Densitometric analysis was used to determine the relative distribution of luciferase transcripts found in polysomal and non-polysomal fractions of the gradient (Fig. 4F). These results indicate that {beta}2-AR 3'-UTR sequences can cause redistribution of chimeric luciferase transcripts away from actively translating polysomal fractions, thus inhibiting the translational initiation of significant quantities of reporter mRNA. Control polysome profiling of endogenous GAPDH mRNA showed similar profiles for both transfections (Fig. 4, C and E).



View larger version (22K):
[in this window]
[in a new window]
  		FIG. 4.
3'-UTR sequences of the {beta}2-AR cause redistribution of luciferase mRNA in polysome preparations. CHO cells were transfected with luciferase cDNA with and without {beta}2-AR 3'-UTR sequences. G418-resistant clones were pooled, and cytoplasmic lysates were prepared and subjected to sucrose density gradient centrifugation as described for receptor constructs. Other experimental details were as described in the legend to Fig. 3. Experiments were done three times with both constructs, as described for Fig. 3. Luciferase mRNA in each fraction was quantified by both RNase protection assay and RT-PCR. Both methods showed similar results. Because GAPDH mRNA was quantified by RT-PCR, the data presented in Fig. 3 (B and C) are those obtained by RT-PCR. A, fractions eluted from the gradients were monitored by absorbance and showed identical patterns as demonstrated in Fig. 3A. A total of 14 fractions were collected, and successive fractions were pooled for a total of seven fractions to be able to compare with receptor mRNA distribution. Total RNA was extracted from each fraction, and GAPDH and luciferase mRNAs were analyzed in each fraction by RT-PCR. B, shown are the results from RT-PCR analysis of the distribution of luciferase mRNA in polysome preparations using cytoplasmic extracts of CHO cells expressing luciferase mRNA with full-length receptor 3'-UTR sequences. C, shown are the results from RT-PCR analysis of the GAPDH mRNA distribution in each fractions. D, shown are the results from RT-PCR analysis of the distribution of luciferase mRNA in polysome preparations using cytoplasmic extracts of CHO cells expressing control luciferase mRNA. E, shown are the results from RT-PCR analysis of GAPDH mRNA to verify proper RNA loading. F, quantification of luciferase transcripts in individual fractions with and without full-length receptor 3'-UTR sequences was done by densitometric analysis. Data represent the means ± S.D. of three separate experiments.

 
We determined the distribution of luciferase mRNA by sucrose density gradient analysis using cytosolic extracts of CHO cells expressing the luciferase open reading frame and the distal 340-nucleotide region of the {beta}2-AR. RT-PCR analysis of luciferase mRNA from the various fractions demonstrated clearly that this 340-nucleotide region was sufficient to cause redistribution of luciferase mRNA to prepolysomal fractions (Fig. 5A). GAPDH mRNA distribution in each fraction was tested to check the proper loading of RNA in sucrose gradient fractions (Fig. 5B).



View larger version (25K):
[in this window]
[in a new window]
  		FIG. 5.
The distal 340-nucleotide region of {beta}2-AR mRNA is sufficient to shift the distribution of luciferase mRNA in polysome preparations. CHO cells were transfected with luciferase cDNA with the distal 340-nucleotide region of the {beta}2-AR 3'-UTR. Cytoplasmic lysates were prepared and subjected to sucrose density gradient centrifugation as described in the legend to Fig. 3. Luciferase and GAPDH mRNAs in each fraction were quantified by RT-PCR. A, RT-PCR analysis showing the distribution of luciferase mRNA in polysome preparations using cytoplasmic extracts of CHO cells expressing luciferase mRNA with the distal 340-nucleotide region of the receptor 3'-UTR; B, RT-PCR analysis showing the distribution of GAPDH mRNA from individual fractions.

 
5'-LC and 3'-UTR Sequences Act Independently in Regulating Receptor mRNA Translation—Cellular expression of the {beta}2-AR is also controlled in part by a 19-amino acid peptide termed the {beta}2-AR 5'-LC, which regulates mRNA translation (5, 6). This peptide is encoded by a short open reading frame ~100 nucleotides upstream of the {beta}2-AR coding region and is highly conserved in all of the species (5). Mutational inactivation of the 5'-LC results in a 2-fold increase in receptor expression in transfected cells (5, 6). For comparative purposes and also to confirm that the 3'-UTR sequences act independently of the 5'-LC in regulating receptor mRNA translation, we tested two more constructs. In the first construct, the 5'-leader ATG codon was mutated to CTG, thus eliminating the translational initiation at the 5'-LC. In the second construct, the 3'-UTR region was deleted from the 5'-LC mutant construct (Fig. 6A). These constructs were transfected into CHO cells, and receptor expression was measured by 125I-cyanopindolol binding. Fig. 6B demonstrates that the mutation of 5'-leader sequences resulted in 2-fold increases in receptor expression as reported previously (5). Deletion of the 3'-UTR while retaining the mutation in the 5'-LC region resulted in a >3-fold increase in receptor expression (Fig. 6B). These results suggest that the effects of 3'-UTR deletion and the 5'-LC mutation on receptor expression are independent and additive. Measurement of receptor mRNA levels in CHO cells transfected with these constructs showed similar mRNA levels (Fig. 6C), confirming the earlier report (5) that the 5'-LC mutation inhibits the translation of receptor mRNA without affecting the steady-state levels of the mRNA.



View larger version (15K):
[in this window]
[in a new window]
  		FIG. 6.
Independent and additive translational suppression of receptor mRNA by 5'-LC and 3'-UTR sequences. The constructs were transfected into CHO cells, and receptor expression was measured in G418-resistant clones by 125I-cyanopindolol binding. Assays were performed in triplicate using crude membrane preparations, and values are calculated as femtomoles/mg of protein. A, features of the mutations and deletions in hamster {beta}2-AR 5'-LC and 3'-UTR sequences. Mutation and deletion constructs were made as described under "Experimental Procedures." B, receptor expression in CHO cells transfected with the wild-type receptor (W-type), 5'-LC mutant, and 3'-UTR deletion constructs. Data represent the means ± S.D. of four separate transfections with each construct. C, representative autoradiogram of ribonuclease protection assays showing levels of {beta}2-AR mRNA in CHO cells expressing various constructs as shown in A. The data represent one of three RNase protection assays with similar results.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
This study provides evidence in support of a role for 3'-UTR sequences of {beta}2-AR mRNA in translational suppression. The data presented here also demonstrate that downstream insertion of the 3'-UTR sequences of the {beta}2-AR into a heterologous reporter gene (luciferase) results in translational suppression of luciferase mRNA. Thus, translational suppression by the 3'-UTR sequences of {beta}2-AR mRNA is independent of the coding region and 5'-UTR sequences. Deletion of the entire 3'-UTR sequences from the receptor cDNA while retaining the complete 5'-UTR and coding region did not result in significant changes in the steady-state levels of receptor mRNA, suggesting that the increases in receptor protein in the 3'-UTR deletion constructs did not result from increased stability of receptor mRNA. Measurement of the steady-state levels of luciferase mRNA with and without the full-length receptor 3'-UTR sequences also demonstrated that the decreased expression of luciferase protein in chimeric constructs did not result from decreased luciferase mRNA levels.

Our results using the deletion constructs demonstrate that the distal 340-nucleotide region is important in regulating {beta}2-AR mRNA translation. We previously identified an (A + U)-rich region present in the proximal 190-nucleotide region as a determinant for agonist-mediated {beta}2-AR mRNA destabilization (7, 9). Thus, it seems likely that the 3'-UTR sequences of {beta}2-AR mRNA contain multiple cis-acting elements that can regulate mRNA translation and stability. A comparison of the 340-nucleotide region of the {beta}2-ARs from human (2), mouse (53), and hamster (1) revealed the presence of U-rich and (A + T)-rich regions distributed within the 340-nucleotide region. Multiple regulatory cis-acting elements that alter message stability and translational efficiency are present in the 3'-UTR of many other transcripts, including cyclooxygenase-2 (21) and tumor necrosis factor-{alpha} and granulocyte/macrophage colony-stimulating factor (22, 39).

Transcript-specific translational control by 3'-UTR sequences, such as that observed here for the {beta}2-AR, has been reported in a variety of mRNAs, including other G-protein-coupled receptors (15). Although {beta}2-AR transcripts were distributed between polysomal and prepolysomal fractions in CHO cells expressing the wild-type receptor, there was a clear shift in receptor transcript toward polysomal fractions when the complete 3'-UTR sequences were removed. This suggests that {beta}2-AR 3'-UTR sequences control translation of receptor mRNA by blocking the translational initiation. The 3'-UTR sequences of {alpha}2C-AR mRNA also inhibit the expression of the receptor by inhibiting the translation of its mRNA (15), whereas the expression of a closely related subtype ({alpha}2A/D-AR) is not inhibited by its 3'-UTR sequences (15). However, the translational suppression of {alpha}2C-AR mRNA by its 3'-UTR region is due to impaired translational elongation or termination because the receptor mRNA with the full-length 3'-UTR sequences was found in the polysomal fractions upon sucrose density gradient ultracentrifugation (15). These findings suggest that the {alpha}2C-AR 3'-UTR does not block the translational initiation of the receptor mRNA (15). On the contrary, in the {beta}2-AR, the 3'-UTR sequences cause significant changes in mRNA distribution in polysomal fractions. Moreover, the 3'-UTR of the {beta}2-AR can regulate translation as well as mRNA localization in a heterologous mRNA such as luciferase. The 3'-UTR of {alpha}2C-AR does not inhibit the translation of a heterologous mRNA, suggesting that additional interactions of {alpha}2C-AR mRNA 3'-UTR sequences with other domains are necessary for the translational control (15). Thus, the 3'-UTR sequences of {alpha}2C-AR and {beta}2-AR mRNAs use different mechanisms to control the translation of their mRNAs.

{beta}2-AR mRNA translation is also suppressed by a 5'-LC that codes for a small peptide (5, 6). Because our studies using deletion constructs demonstrated for the first time translational suppression of receptor mRNA by 3'-UTR sequences, it is of interest to check whether the translational control by both 5'- and 3'-UTR sequences is independent and additive. Mutational inactivation of the 5'-leader ATG codon resulted in translational activation of the receptor mRNA as reported before (5). More important, our data also demonstrate that the effects of the 3'-UTR and 5'-LC are independent and additive. Thus, mutational inactivation of the 5'-LC and 3'-UTR deletion show additive effects on receptor expression. The mechanism through which the 5'-LC of the {beta}2-AR inhibits receptor translation is thought to be by interaction of this small peptide with receptor mRNA (5). Our data suggest that the 3'-UTR sequences of {beta}2-AR mRNA inhibit the receptor translation by localizing the receptor mRNA away from the actively translating polysomes, thus preventing the translational initiation. Complex interactions between 5'- and 3'-UTR sequences in the translational control of ornithine decarboxylase mRNA have been reported (14). Although the 3'-UTR of ornithine decarboxylase mRNA by itself appears to have a minor effect on translation, together with the 5'-UTR sequences of this mRNA, the 3'-UTR sequences can increase the translational efficiency of ornithine decarboxylase and reporter gene mRNAs by several-fold (14). Similarly, the 5'-UTR of p27 mRNA has been reported to suppress or overcome the negative effect of the 3'-UTR sequence on its mRNA translation (54). Although the nature of this interaction is not understood, these examples demonstrate diversity in the ways through which the 5'- and 3'-flanking sequences can regulate gene expression.

In conclusion, our results suggest that the 3'-UTR sequences of {beta}2-AR mRNA inhibit its translation and that the distal 340 nucleotides are essential for this translational control. Receptor 3'-UTR sequences can similarly inhibit the translation of a reporter gene mRNA. Finally, both the 5'LC and 3'-UTR sequences of {beta}2-AR mRNA ensure a slow rate of translation of this low abundance membrane protein.


   FOOTNOTES
 
* This work was supported by Grant 1RO1 GM58740 from the U. S. Public Health Service, Grant 9960245U from the Mid-Atlantic Affiliate of the American Heart Association (to B. G. T.), and Veterans Affairs Merit support and National Institutes of Health Grant ROI GM63909 (to J. R. R.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

|| To whom correspondence should be addressed: Dept. of Medicine, Div. of Nephrology, Medical University of South Carolina, 96 Jonathan Lucas St., 829 CSB, Charleston, SC 29425-2221. Tel.: 843-789-6773; Fax: 843-876-5129; E-mail: tholanik{at}musc.edu.

1 The abbreviations used are: {beta}2-AR, {beta}2-adrenergic receptor; UTR, untranslated region; 5'-LC, 5'-leader cistron; ARE, adenosine/uridine-rich element; CHO, Chinese hamster ovary; PBS, phosphate-buffered saline; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; RT, reverse transcription. Back



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Dixon, R. A., Kobilka, B. K., Strader, D. J., Benovic, J. L., Dohlman, H. G., Frielle, T., Bolanowski, M. A., Bennett, C. D., Rands, E., Diehl, R. E., Mumford, R. A., Slater, E. E., Sigal, I. S., Caron, M. G., Lefkowitz, R. J., and Strader, C. D. (1986) Nature 321, 75-79[Medline] [Order article via Infotrieve]
  2. Kobilka, B. K., Frielle, T., Dohlman, H. G., Bolanowski, M. A., Dixon, R. A., Keller, P., Caron, M. G., and Lefkowitz, R. J. (1987) J. Biol. Chem. 262, 7321-7327[Abstract/Free Full Text]
  3. Kobilka, B. K., Dixon, R. A., Frielle, T., Dohlman, H. G., Bolanoeski, M. A., Sigal, I. S., Yang-Feng, T. L., Francke, U., Caron, M. G., and Lefkowitz, R. J. (1987) Proc. Natl. Acad. Sci. U. S. A. 84, 46-50[Abstract/Free Full Text]
  4. Nakada, M. T., Haskell, K. M., Ecker, D. J., Stadel, J. M., and Crooke, S. T. (1989) Biochem. J. 260, 53-59[Medline] [Order article via Infotrieve]
  5. Parola, A. L., and Kobilka, B. K. (1994) J. Biol. Chem. 269, 4497-4505[Abstract/Free Full Text]
  6. McGraw, D. W., Forbes, S. L., Kramer, L. A., and Liggett, S. B. (1998) J. Clin. Investig. 102, 1927-1932[Medline] [Order article via Infotrieve]
  7. Tholanikunnel, B. G., and Malbon, C. C. (1997) J. Biol. Chem. 272, 11471-11478[Abstract/Free Full Text]
  8. Danner, S., Frank, M., and Lohse, M. L. (1998) J. Biol. Chem. 273, 3223-3229[Abstract/Free Full Text]
  9. Tholanikunnel, B. G., Raymond, J. R., and Malbon, C. C. (1999) Biochemistry 38, 15564-15572[CrossRef][Medline] [Order article via Infotrieve]
  10. Kruys, V., Wathelet, M., Poupart, P., Contreras, R., Fiers, W., Content, J., and Huez, G. (1987) Proc. Natl. Acad. Sci. U. S. A. 84, 6030-6034[Abstract/Free Full Text]
  11. Kruys, V., Marinx, O., Shaw, G., Deschamps, J., and Huez, G. (1989) Science 245, 852-857[Abstract/Free Full Text]
  12. Ch'ng, J. L., Mulligan, R. C., Schimmel, P., and Holmes, E. W. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 10006-10010[Abstract/Free Full Text]
  13. Ch'ng, J. L., Shoemaker, D. L., Schimmel, P., and Holmes, E. W. (1990) Science 248, 1003-1006[Abstract/Free Full Text]
  14. Grens, A., and Scheffler, I. E. (1990) J. Biol. Chem. 265, 11810-11816[Abstract/Free Full Text]
  15. Yang, Q., McDermott, P. J., Duzic, E., Pleij, C. W. A., Sherlock, J. D., and Lanier, S. M. (1997) J. Biol. Chem. 272, 15466-15473[Abstract/Free Full Text]
  16. Fu, L., and Benchimol, S. (1997) EMBO J. 16, 4117-4125[CrossRef][Medline] [Order article via Infotrieve]
  17. Mazumder, B., and Fox, P. L. (1999) Mol. Cell. Biol. 19, 6898-6905[Abstract/Free Full Text]
  18. Ranganathan, G., Li, C., and Kern, P. A. (2000) J. Biol. Chem. 275, 40986-40991[Abstract/Free Full Text]
  19. Mbella, E. G., Bertrand, S., Huez, G., and Octave, J. N. (2000) Mol. Cell. Biol. 20, 4572-4579[Abstract/Free Full Text]
  20. Dixon, D. A., Kaplan, C. D., McIntyre, T. M., Zimmerman, G. A., and Prescott, S. M. (2000) J. Biol. Chem. 275, 11750-11757[Abstract/Free Full Text]
  21. Cok, S. J., and Morrison, A. R. (2001) J. Biol. Chem. 276, 23179-23185[Abstract/Free Full Text]
  22. Spicher, A., Guicherit, O. M., Duret, L., Aslanian, A., Sanjines, E. M., Denko, N. C., Giaccia, A. J., and Blau, H. M. (1998) Mol. Cell. Biol. 18, 7371-7382[Abstract/Free Full Text]
  23. Conne, B. F., Stutz, A. F., and Vassalli, J. D. (2000) Nat. Med. 6, 637-641[CrossRef][Medline] [Order article via Infotrieve]
  24. Dever, T. E. (2002) Cell 108, 545-556[CrossRef][Medline] [Order article via Infotrieve]
  25. Mazumder, B., Seshadri, V., and Fox, P. L. (2003) Trends Biochem. Sci. 28, 91-98[CrossRef][Medline] [Order article via Infotrieve]
  26. Jacobs, G. H., Rackham, O., Stockwell, P. A., Tate, W., and Brown, C. M. (2002) Nucleic Acids Res. 30, 310-311[Abstract/Free Full Text]
  27. Mikulits, W., Pradet-Balade, B., Habermann, B., Beug, H., Garcia-Sanz, J. A., Mullner, E. W. (2000) FASEB J. 14, 1641-1652[Abstract/Free Full Text]
  28. Sampath, P., Mazumder, B., Seshadri, V., and Fox, P. L. (2003) Mol. Cell. Biol. 23, 1509-1519[Abstract/Free Full Text]
  29. Ostareck-Lederer, A., Ostareck, D. H., Standart, N., and Thiele, B. J. (1994) EMBO J. 13, 1476-1481[Medline] [Order article via Infotrieve]
  30. Izquierdo, J. M., and Cuezva, J. M. (1997) Mol. Cell. Biol. 17, 5255-5268[Abstract]
  31. Duquette, M., and Laneuville, O. (2002) J. Biol. Chem. 277, 44631-44637[Abstract/Free Full Text]
  32. Piecyk, M., Wax, S., Beck, A. R. P., Kedersha, N., Gupta, M., Maritim, B., Chen, S., Gueydan, C., Kurys, V., Streuli, M., and Anderson, P. (2000) EMBO J. 19, 4154-4163[CrossRef][Medline] [Order article via Infotrieve]
  33. Yu, Q., Cok, S. J., Zeng, C., and Morrison, A. R. (2003) J. Biol. Chem. 278, 1579-1584[Abstract/Free Full Text]
  34. Seydoux, G. (1996) Curr. Opin. Genet. Dev. 6, 555-561[CrossRef][Medline] [Order article via Infotrieve]
  35. L'Ecuyer, T. J., Tompach, P. C., Morris, E., and Fulton, A. B. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 7520-7524[Abstract/Free Full Text]
  36. Chen, C. A., and Shyu, A. B. (1995) Trends Biochem. Sci. 20, 465-470[CrossRef][Medline] [Order article via Infotrieve]
  37. Dalgleish, G., Veyrune, J.-L., Blanchard, J.-M., and Hesketh, J. (2001) J. Biol. Chem. 276, 13593-13599[Abstract/Free Full Text]
  38. Di Noia, J. M., D'Orso, I., Sanchez, D. O., and Frasch, A. C. C. (2000) J. Biol. Chem. 275, 10218-10227[Abstract/Free Full Text]
  39. Zhang, T., Kruys, V., Huez, G., and Gueydan, C. (2002) Biochem. Soc. Trans. 30, 952-958[CrossRef][Medline] [Order article via Infotrieve]
  40. Wiklund, L., Sokolowski, M., Carlsson, A., Rush, M., and Schwartz, S. (2002) J. Biol. Chem. 277, 40462-40471[Abstract/Free Full Text]
  41. Gueydan, C., Droogmans, L., Chalon, P., Huez, G., Caput, D., and Kruys, V. (1999) J. Biol. Chem. 274, 2322-2326[Abstract/Free Full Text]
  42. Dixon, D. A., Balch, G. C., Kedersha, N., Anderson, P., Zimmerman, G. A., Beauchamp, R. D., and Prescott, S. M. (2003) J. Exp. Med. 198, 475-481[Abstract/Free Full Text]
  43. Reimann, I., Huth, A., Thiele, H., and Thiele, B. J. (2002) J. Mol. Biol. 315, 965-974[CrossRef][Medline] [Order article via Infotrieve]
  44. Mazumder, B., Sampath, P., Seshadri, V., Maitra, R. K., DiCorleto, P. E., and Fox, P. L. (2003) Cell 115, 187-198[CrossRef][Medline] [Order article via Infotrieve]
  45. Jackson, R. J., and Standart, N. (1990) Cell 62, 15-24[CrossRef][Medline] [Order article via Infotrieve]
  46. Mazumder, B., Seshadri, V., Imataka, H., Sonenberg, N., and Fox, P. L. (2001) Mol. Cell. Biol. 21, 6440-6449[Abstract/Free Full Text]
  47. Gray, N. K., Coller, J. M., Dickson, K. S., and Wickens, M. (2000) EMBO J. 19, 4723-4733[CrossRef][Medline] [Order article via Infotrieve]
  48. Dixon, R. A., Sigal, I. S., Rands, E., Register, R. B., Candelore, M. R., Blake, A. D., and Strader, C. D. (1987) Nature 326, 73-77[CrossRef][Medline] [Order article via Infotrieve]
  49. Bradford, M. M. (1976) Anal. Biochem. 72, 248-254[CrossRef][Medline] [Order article via Infotrieve]
  50. Tholanikunnel, B. G., and Malbon, C. C. (2000) in Regulation of G-Protein-Coupled Receptor Function and Expression (Benovic, J. L., ed) pp. 273-292, Wiley-Liss, Inc., New York
  51. Ross, J. (1995) Microbiol. Rev. 59, 423-450[Abstract/Free Full Text]
  52. Kloc, M., Zearfoss, N. R., and Etkin, L. D. (2000) Cell 108, 533-544
  53. Allen, M. J., Baetge, E. E., Abrass, I. B., and Palmiter, R. D. (1988) EMBO J. 7, 133-138[Medline] [Order article via Infotrieve]
  54. Millard, S. S., Vidal, A., Markus, M., and Koff, A. (2000) Mol. Cell. Biol. 20, 5947-5959[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us