JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M403773200 on May 11, 2004

J. Biol. Chem., Vol. 279, Issue 29, 30133-30142, July 16, 2004
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
279/29/30133    most recent
M403773200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zachara, N. E.
Right arrow Articles by Hart, G. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zachara, N. E.
Right arrow Articles by Hart, G. W.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Dynamic O-GlcNAc Modification of Nucleocytoplasmic Proteins in Response to Stress

A SURVIVAL RESPONSE OF MAMMALIAN CELLS*

Natasha E. Zachara{ddagger}, Niall O'Donnell§, Win D. Cheung{ddagger}, Jessica J. Mercer{ddagger}, Jamey D. Marth§||, and Gerald W. Hart{ddagger}**

From the {ddagger}Department of Biological Chemistry, The Johns Hopkins University School of Medicine, Baltimore, Maryland 21205-2185 and §The Howard Hughes Medical Institute, Glycobiology Research and Training Center, Department of Cellular and Molecular Medicine, University of California, San Diego, La Jolla, California 92093

Received for publication, April 5, 2004 , and in revised form, May 11, 2004.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Cellular response to environmental, physiological, or chemical stress is key to survival following injury or disease. Here we describe a unique signaling mechanism by which cells detect and respond to stress in order to survive. A wide variety of stress stimuli rapidly increase nucleocytoplasmic protein modification by O-linked {beta}-N-acetylglucosamine (O-GlcNAc), an essential post-translational modification of Ser and Thr residues of metazoans. Blocking this post-translational modification, or reducing it, renders cells more sensitive to stress and results in decreased cell survival; and increasing O-GlcNAc levels protects cells. O-GlcNAc regulates both the rates and extent of the stress-induced induction of heat shock proteins, providing a molecular basis for these findings.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Key metabolic proteins in the nucleus and cytoplasm of metazoans are dynamically modified by monosaccharides of O-linked {beta}-N-acetylglucosamine (O-GlcNAc)1 (1). O-GlcNAc is thought to act as a modulator of protein function, in a manner analogous to protein phosphorylation; the addition of O-GlcNAc to the protein backbone is dynamic and responds to morphogens, the cell cycle, and changes in glucose metabolism (1). The mechanisms by which O-GlcNAc act are complex, and changes in O-GlcNAc levels have been shown to alter the behavior of specific proteins by modulating the following: 1) the half-life and proteolytic processing of proteins (27); 2) subcellular localization (814); 3) protein-protein interactions (6, 15, 16); 4) DNA binding (17); and 5) enzyme activity or regulation (1820). One mechanism by which O-GlcNAc may mediate these events is by altering protein phosphorylation. Notably, phosphorylation and O-GlcNAc are reciprocal on some well studied proteins, which include the C-terminal domain of the large subunit of RNA polymerase (21, 22), the c-myc protooncogene (2325), SV40 large T-antigen (26), estrogen receptor-{beta} (7), and endothelial nitric-oxide synthase (18). These observations suggest that O-GlcNAc and phosphorylation may modulate each other (2729).

Increasing extracellular glucose concentrations affects the functioning of key cellular proteins in an O-GlcNAc-dependent manner, including endothelial nitric-oxide synthase (18), mSin3a (30), the transcription factors, YY1 (31), Sp1 (5, 3234), CREB (35), and the 26 S proteosomal complex (36, 37). UDP-GlcNAc:polypeptide O-{beta}-N-acetylglucosaminyltransferase (OGT; EC 2.4.1.94 [EC] ), the enzyme that adds O-GlcNAc, is responsive across the physiological range of UDP-GlcNAc. Moreover, the substrate specificity of OGT changes at different UDP-GlcNAc concentrations (38). Both in vitro and in vivo data support a model where increased UDP-GlcNAc levels, due to hyperglycemia, result in increased O-GlcNAc levels, leading to insulin resistance, a hallmark of type II diabetes (1, 39). These data and others have led researchers to propose that O-GlcNAc is a nutritional sensor (1, 3941).

In response to multiple forms of stress, cells rapidly increase glucose uptake. The ability of cells to transport glucose has been linked to the capacity of cells to respond and survive deleterious cellular conditions (4256). In many studies, blocking both glycolysis (48, 51, 57) and the hexosamine biosynthetic pathway (5861) results in decreased survival of cells. In some instances, alternative energy sources have been provided suggesting that depletion of ATP levels does NOT explain the decrease in survival (48, 51, 57). Several insulin-resistant models, including the long lived Caenorhabditis elegans Daf-2 knockout, have an increased stress tolerance to a variety of agents (6264). Based upon these data, and recent observations suggesting that heat shock protein (HSP) 70 may act as an O-GlcNAc lectin (65), we investigated the possible link between stress tolerance and O-GlcNAc. We demonstrate that in response to all forms of cellular stress tested, multiple cell lines rapidly and dynamically increase O-GlcNAc levels on a myriad of nuclear and cytoplasmic proteins. Moreover, modulation of O-GlcNAc levels alters thermotolerance. Increasing O-GlcNAc levels result in cells that are more thermotolerant, whereas decreasing levels of O-GlcNAc protein modification led to cells that are more sensitive to thermal stress. The extent of O-GlcNAc protein modification appears to affect the levels of the heat shock proteins, HSP70 and HSP40, suggesting a molecular mechanism for these findings. This study provides a molecular link, O-GlcNAc, between glucose metabolism and stress tolerance and suggests a new paradigm in the regulation of stress-mediated signal transduction pathways.


    EXPERIMENTAL PROCEDURES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Cell lines and Culture Conditions—All cells (unless indicated) were from the ATCC and were maintained in DMEM (1 g/liter; Mediatech) supplemented with 10% (v/v) fetal bovine serum (FBS) and penicillin/streptomycin at 37 °C in a humidified incubator at 5% CO2. Cells were seeded ~48 h prior to the beginning of stress treatments as follows: COS-7 (green monkey kidney cells), HeLa (human), Chinese hamster ovary cells (CHO), and mouse neuroblastoma cells (Neuro-2A) cells were seeded at 4 x 105 cells in 100-mm plates or 5 x 104 in 6-well plates, whereas human embryonic kidney 293 (HEK293) cells were seeded at 8 x 105 cells in 100-mm plates. Mouse embryonic fibroblasts (MEFs) were maintained in DMEM (4.5g/liter glucose) supplemented with 10% (v/v) FBS and penicillin/streptomycin (66). Cells were seeded at 1 x 106 in 100-mm plates or 2 x 105 in 6-well plates. Primary human coronary artery endothelial cells (HCAEC, Clonetics) were cultured according to the manufacturer's instructions. Cells were treated with 100 µM O-(2-acetamido-2-deoxy-D-glucopyranosylidene) amino-N-phenylcarbamate (PUGNAc; in phosphate-buffered saline (PBS); Carbogen, Switzerland) or 20 µM 6-diazo-5-oxonorleucine (DON; in Me2SO; Sigma) for 18 h prior to the beginning of experiments. 20 µg/ml cycloheximide (in ethanol; Sigma), 100 µM chloroquine (in PBS; Sigma), and 20 µM ALLN (in Me2SO; Sigma) were incubated with cells for 1 h prior to the initiation of experiments.

Stress Treatments—Cell culture media were changed 1 h prior to stress treatments. Thermal treatments were performed in a humidified incubator (5% CO2), and at the end of the heat treatment cells were returned to 37 °C. COS-7, CHO, HeLa, and Neuro-2A cells were placed at 45 °C for 1 h, whereas HEK293, HCAEC, and MEF cells were placed at 42 °C for 1 h. The different temperatures are representative of different basal levels of thermotolerance. Treatments were optimized and resulted in less than 10% cell death. Experiments were performed in duplicate a minimum of four times.

For multiple stress experiments, cells were serum-starved for 18 h prior to stress treatments. Cells were treated for 8 h as follows: 1 mM H2O2, 50 µM CoCl2, 4% (v/v) ethanol, 100 mM NaCl (in addition to physiological saline), 75 µM sodium arsenite. In other treatments, cells were thermally stressed as above or treated with UVB light for 90 s and recovered at 37 °C for 8 h. Treatment levels were chosen that resulted in <10% cell death and are similar to those reported by others. Experiments were performed in duplicate a minimum of four times. In densitometry derived from these experiments, error bars represent 1 S.D. p values are the result of a paired Student's t test (two-tailed). For densitometry O-GlcNAc levels were normalized to actin to control for protein load

Analysis of Proteins—Cells were washed with ice-cold PBS, harvested, and extracted with 1% (v/v) Nonidet P-40 in Tris-HCl, pH 7.4, 0.1 mM phenylmethylsulfonyl fluoride, 1 mM dithiothreitol, 2 µM PUGNAc, 5 mM KF, 0.5 mM orthovanadate, 5 mM {beta}-glycerophosphate, 2 mM EDTA, PIC1, and PIC2. Extracts were separated by noncontinuous reducing SDS-PAGE on Tris-glycine gels (Criterion, Bio-Rad). Proteins transferred to nitrocellulose and blocked with 3% (w/v) bovine serum albumin were detected with anti-HSP110, HSP90, HSP/HSC70, HSP70, HSP40, and HSP27 antibodies (Stressgen), anti-O-GlcNAc antibody (CTD 110.6; Covance, PA) (67), anti-OGT (AL28) (68), anti-heat shock factor 1 (HSF1; Stressgen), anti-tubulin (Sigma), or anti-actin (Sigma).

Densitometry was performed by using nonsaturated chemiluminescent exposed films and quantitated using MacBAS bio-imaging analyzer (version 2.5, Fuji Photo Film Co). Typically, multiple exposures from the same experiment were used to confirm that the signal was within the linear range. Levels of O-GlcNAc in the entire lane were normalized to the appropriate control (actin or tubulin) and then expressed as a percentage of control (set at 100%). In all instances, data are averaged from independent experiments.

O-GlcNAcase and OGT Assays—Total cell extracts (40 µg), either Nonidet P-40 (described above) or nuclear/cytoplasmic extracts (69), were assayed for O-GlcNAcase (EC 3.2.1.52 [EC] ) activity, the enzyme that removes O-GlcNAc, by using p-nitrophenyl phosphate-GlcNAc as described earlier (70, 71). Activity is reported as micromoles of cleavage per min per mg of cell extract. To determine OGT activity, OGT was immunoprecipitated from Nonidet P-40 extracts (described above) of heat-stressed cells as follows. Nonidet P-40 extracts (500 µg) were diluted to 0.5 mg/ml and 0.2% Nonidet P-40 and were pre-cleared with preimmune antibody (100 µl) covalently coupled to CNBr-activated agarose (6 mg/ml) for 2 h at 4 °C. Extracts were then precipitated with anti-OGT antibody (AL28; 100 µl) covalently coupled to CNBr-activated agarose (6 mg/ml) for 2 h at 4 °C. Resin was washed with 1 ml each of Tris-HCl-buffered saline, pH 7.4 (Tris-buffered saline), 0.2% (v/v) Nonidet P-40, Tris-buffered saline, and OGT desalting buffer (20 mM Tris-HCl, pH 7.8, 20% glycerol, 0.02% azide). OGT was assayed on beads against the casein kinase II acceptor peptide as reported previously (38). Activity is reported as micromoles of GlcNAc transferred to casein kinase II per min per mg of cell extract immunoprecipitated. Activity was normalized to levels of OGT in cell precipitates by densitometry.

Cre-Lox Recombination—Viral infections using adenovirus carrying either a control vector (Neo) and Cre-recombinase vector (Cre) were carried out as reported previously (66), except that 1 x 106 cells were seeded in 100-mm plates. Infected cells were selected in G418 (final 1 mg/ml). Prior to stress and thermal kill experiments, G418 was washed out, and cells were allowed to recover for 2 h.

Thermal Survival—Media were changed 1 h prior to the initiation of thermal survival experiments. Cells were stressed at the indicated temperatures (45–48 °C depending on cell type) in a humidified incubator (5% CO2) for 0–80 min and then placed at 37 °C for 24 h. Cell viability was assessed using the crystal violet method (72). To allow for differences in growth rates derived from modulating O-GlcNAc levels, viability is expressed as a percentage of unstressed cells. All experiments were performed a minimum of three times, and numbers are derived from at least four replicates. Error bars represent 1 S.D.; p values are the result of a paired Student's t test (two-tailed).

RNA Interference (RNAi)—Neuro-2A cells were seeded at 1 x 105 in 6-well plates in DMEM (1g/liter glucose) supplemented with 10% (v/v) FBS and penicillin/streptomycin. At 24 h media were changed to Opti-MEM (Invitrogen), and cells were transfected with duplex (5 nM) using siPORTamine (Ambion, TX) according to the manufacturer's instructions. Media were changed after 24 h, and experiments were initiated at 36 h post-transfection. RNAi duplexes were designed against the murine OGT sequence. Note an equal mixture of OGT1 and OGT2 was used. Duplexes were created using the SilencerTM siRNA construction kit (Ambion, TX) according to the manufacturer's instructions. The oligonucleotides used are as follows: OGT1, AAGCAATCGAGCATTATCGAC; OGT2, AAGTTTGAGCCCAAATCATGC; scrambled, CAGTCGCGTTTGCGACTGGTT.

Plasmids and Transfections—OGT was subcloned from pCiteOGT (SalI/NotI; gift of S. Iyer, The Johns Hopkins University) into pShuttle (NheI/NotI). COS-7 cells were seeded at 1 x 105 in 6-well plates in DMEM (1g/liter glucose) supplemented with 10% (v/v) FBS and penicillin/streptomycin, and the latter was removed ~24 h prior to transfection. Cells were transfected with 2–3 µg of DNA (pShuttle or pShuttle-OGT) using FuGENE 6 (Roche Applied Science) according to the manufacturer's instructions. Transfection reagent was replaced with media after 8 h. After 24 h, media were again replaced, and thermotolerance was determined.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
O-GlcNAc Levels Increase in Response to Multiple Forms of Cellular Stress—To investigate the possible role of the O-GlcNAc protein modification in stress response pathways, levels of O-GlcNAc were determined after cells were subjected to different forms of cellular stress. Remarkably, in response to all stress-inducing agents tested, levels of O-GlcNAc became elevated (Fig. 1, A and E) as follows: lane 1, control; lane 2, H2O2 (144 ± 12%); lane 3, CoCl2 (151 ± 13%); lane 4, UVB light (145 ± 18%); lane 5, ethanol (142 ± 21%); lane 6, NaCl (195 ± 18%); lane 7, heat shock (172 ± 24%); and lane 8, sodium arsenite (230 ± 27%). Similar data were observed in cells with and without serum (data not shown). The level of OGT, the enzyme that catalyzes the addition of O-GlcNAc to the protein backbone, was also examined. All forms of stress, except hyperthermia, induced higher levels of OGT protein expression (Fig. 1C). Notably, increased O-GlcNAc protein modification in response to stress is dose-dependent (Fig. 2).



View larger version (41K):
[in this window]
[in a new window]
 
FIG. 1.
Global O-GlcNAc levels are elevated in response to multiple forms of cellular stress in COS-7 cells. A, COS-7 cells were treated at 37 °C for 8 h as follows: lane 1, no treatment; lane 2, 1 mM H2O2; lane 3, 50 µM CoCl2; lane 4, UVB light for 90 s, recovery at 37 °C for 8 h; lane 5, 4% (v/v) ethanol; lane 6, 100 mM NaCl; lane 7, stressed at 45 °C for 1 h, recovered at 37 °C for 8 h, and lane 8, 75 µM sodium arsenite. Total cellular extract (30 µg/lane) was separated by SDS-PAGE and levels of O-GlcNAc (A), HSP/HSC70 (Stressgen) (B), and OGT (C) were determined in duplicate by immunoblot. D, immunoblots for actin are shown as a loading control. E, densitometry was performed on immunoblots from duplicate samples normalized to actin from four separate experiments. Levels of O-GlcNAc are expressed as a percentage of control samples. Error bars represent 1 S.D. p values are the result of a paired Student's t test (two-tailed). WB, Western blot.

 



View larger version (54K):
[in this window]
[in a new window]
 
FIG. 2.
Increased O-GlcNAc protein modification of nucleocytoplasmic proteins is dose-dependent. A, COS-7 cells were treated with iodoacetamide (25–75 µM, as indicated) for 7 h. Levels of O-GlcNAc (upper panel) and actin (middle panel) in total cell extract (30 µg/lane) were determined in duplicate by immunoblot. Densitometry of O-GlcNAc normalized to actin is shown in the lower panel. C, control; WB, Western blot. B, COS-7 cells were treated with UVB light (30–90 s, as indicated) and recovered at 37 °C for 7 h. Levels of O-GlcNAc (upper panel) and actin (middle panel) in total cell extract (30 µg/lane) were determined in duplicate by immunoblot. Densitometry of O-GlcNAc normalized to actin is shown in the lower panel. C, COS-7 cells were treated with heat shock (HS) 45 °C for 1 h (recovery for 6 h at 37 °C) or were treated with 1% v/v or 4% v/v ethanol for 7 h. Levels of O-GlcNAc (upper panel) and actin (middle panel) in total cell extract (20 µg/lane) were determined in duplicate by immunoblot. Densitometry of O-GlcNAc normalized to actin is shown in the lower panel. D, COS-7 cells were treated with heat shock (HS) at 45 °C for 1 h (recovery for 6hat37 °C) or were treated with 25 or 75 µM sodium arsenite for 7 h. Levels of O-GlcNAc (upper panel) and actin (middle panel) in total cell extract (20 µg/lane) were determined in duplicate by immunoblot. Densitometry of O-GlcNAc normalized to actin is shown in the lower panel. In all figures, error bars represent 1 S.D. p values are the result of a Student's t test (two-tailed).

 
Increased O-GlcNAc protein modification induced by cellular stress is a widespread response. Elevated O-GlcNAc in response to thermal and osmotic stress was observed in several different cell types including MEFs, CHO cells, HEK293 cells, Neuro-2a cells, HeLa cells, and primary HCAECs (data not shown). These data suggest that increased O-GlcNAc is a target and effector of stress response pathways.

O-GlcNAc Is Added Rapidly and Dynamically in Response to Thermal Stress—To determine whether O-GlcNAc was added to proteins in a dynamic fashion, consistent with a role in stress-associated signal transduction pathways, the rate of addition of O-GlcNAc in response to hyperthermia was studied. O-GlcNAc levels were appreciably elevated at the termination of thermal stress (Fig. 3A, time post-heat stress, 0 min), suggesting that O-GlcNAc addition is rapidly induced soon after the initiation of hyperthermia. This addition is dynamic, as levels of O-GlcNAc continued to increase for 9 h but are reduced by 24 h and return to normal by 48 h (Fig. 3B). Notably, O-GlcNAc induction occurs prior to elevation of HSP70 protein levels (Fig. 3B). Additionally, OGT levels appear to become somewhat depressed post-stress (Fig. 3B).



View larger version (64K):
[in this window]
[in a new window]
 
FIG. 3.
Levels of O-GlcNAc increase rapidly and dynamically in response to thermal stress. A, COS-7 cells were thermally stressed at 45 °C for 1 h and returned to 37 °C for varying lengths of time (indicated). Levels of O-GlcNAc (upper panel) and actin (lower panel) in total cell extract (30 µg/lane) were determined in duplicate by immunoblot. Densitometry of O-GlcNAc normalized to actin is shown. Cont, control; WB, Western blot. B, COS-7 cells were thermally stressed at 45 °C for 1 h and returned to 37 °C for varying lengths of time (indicated). Levels of O-GlcNAc (upper panel), HSP/HSC70 (upper middle panel), OGT (lower middle panel) and tubulin (lower panel) in total cell extract (30 µg/lane) were determined in duplicate by immunoblot. Densitometry of O-GlcNAc normalized to tubulin is shown. C, cells were incubated with 20 µM ALLN, 100 µM chloroquine (CHQ), and 20 µg/ml cycloheximide (CYX) for 1 h and then heat-stressed at 45 °C for 1 h, and returned to 37 °C for varying lengths of time (indicated). Unstressed samples are indicted by C. Levels of O-GlcNAc (upper panel), HSP70 (middle panel), and actin (lower panel) were determined by immunoblot on total cell extracts (15 µg). Densitometry of O-GlcNAc normalized to actin is shown.

 
The rapid elevation of O-GlcNAc in response to hyperthermia was insensitive to cycloheximide (20 µg/ml), the proteosome inhibitor 20 µM ALLN (20 µM MG132, data not shown), and the lysosomal inhibitor chloroquine (100 µM) indicating that protein synthesis and degradation are not required (Fig. 3C). The former is consistent with protein synthesis being inhibited at temperatures above 42 °C in mammalian cells. Notably, inhibition of the proteasome and lysosome augmented the increase in O-GlcNAc in response to stress (Fig. 3C), which may represent a decrease in the degradation of O-GlcNAc-modified proteins. Levels of O-GlcNAc in control cells are elevated in chloroquine- and ALLN-treated cells, suggesting that increased O-GlcNAc is because of inhibition of protein degradation. Inhibition of the proteasome has been shown previously to initiate a cellular stress response (73, 74). These data suggest that like tyrosine phosphorylation (75), O-GlcNAc protein modification is rapidly increased after stress and that O-GlcNAc may mediate stress-induced signal transduction pathways.

Increased OGT Activity in Response to Hyperthermia—To determine what meditates increased O-GlcNAc in response to stress, we next examined the levels and activities of the enzymes that add and remove O-GlcNAc. In response to thermal stress, no difference in O-GlcNAcase protein level was observed (Fig. 4A). Moreover, O-GlcNAcase activity was not decreased (Fig. 4B), suggesting that increased O-GlcNAc removal is not contributing to increased O-GlcNAc protein modification in response to stress. Levels of OGT protein are also not increased in response to thermal stress (Fig. 4C), unlike other forms of stress (Fig. 1C). However, OGT activity is increased in response to thermal stress (Fig. 4D), suggesting post-translational regulation of the enzyme.



View larger version (23K):
[in this window]
[in a new window]
 
FIG. 4.
Increased OGT activity is observed in response to thermal stress. COS-7 cells were treated for 30 min (C1, HS1) or 60 min at 37 °C (C) or 45 °C (HS) and then harvested or recovered at 37 °C for 0 (C2, HS2), 2 (C3, HS3), or 4 h (C4, HS4). A, levels of O-GlcNAcase in whole cell extract (20 µg) were determined by immunoblot; actin levels are shown as a loading control. WB, Western blot. B, O-GlcNAcase activity against p-nitrophenyl phosphate-GlcNAc was determined in quadruplicate in whole cell extracts (40 µg) as reported previously and is expressed as µmol/min/mg. Control cells are shown in black, and stressed cells are shown in gray. Error bars represent 1 S.D. C, COS-7 cells were treated for 30 min (C1, HS1) or 60 min at 37 °C (C) or 45 °C (HS), and then harvested or recovered at 37 °C for 0 (C2, HS2), 3 (C3, HS3), or 6 h (C4, HS4). OGT levels in whole cell extract were determined by immunoblot. D, OGT was immunoprecipitated (saturating) from cell extracts, and activity was assayed in duplicate as reported previously by using the CKII reporter assay. Activity is expressed as µmol of UDP-GlcNAc transferred per min/mg of cell extract precipitated. This number is then normalized to the levels of OGT determined by densitometry. Control cells are shown in black, and stressed cells are shown in gray. Representative assays and blots are shown (n = 4). Error bars represent 1 S.D. p values are the result of a paired Student's t test (two-tailed).

 
Thermotolerance Is Affected by O-GlcNAc Levels—To determine what function O-GlcNAc might play in stress response pathways, thermotolerance of cells was determined after the levels of O-GlcNAc were directly modulated by using a MEF cell line in which the OGT gene is flanked by loxP sites (66). Infection of these cells with retrovirus carrying a vector encoding Cre recombinase leads to cells lacking the OGT gene and results in reduced OGT protein (Fig. 5A, upper panel) and O-GlcNAc (Fig. 5A, middle panel). Deletion of OGT has been shown previously to be lethal (76). Nevertheless, these cells like ES cells and OGT knockout tissues remain viable for several days during which time protein and RNA synthesis appear unaffected (66). Notably, in control cells an increase in O-GlcNAc levels is seen in response to viral infection (Fig. 5A), and this is observed with both adenoviral and retroviral infections in other systems (data not shown) and is consistent with viral infection inducing stress response pathways (77, 78). As shown (Fig. 5B), when cells were challenged with an osmotic stress (100 mM NaCl), Cre-infected cells were unable to increase levels of O-GlcNAc. The thermotolerance of the MEF cells that received the control retrovirus vector lacking Cre was found to be greater (at time points where there was significant cell death) (Fig. 5C). To control for differences in growth rate, cell viability is expressed as a percentage of unstressed cells.



View larger version (58K):
[in this window]
[in a new window]
 
FIG. 5.
Deletion of OGT results in cells that are more sensitive to thermal stress. A, MEFs containing OGT flanked by Lox recombination sites were infected with adenovirus containing an unmodified vector (neo) or a Cre recombinase containing vector (Cre). Infected cells were selected in G418 (final 1 mg/ml), and levels of OGT (upper panel), O-GlcNAc (middle panel), and actin (lower panel) in total cell extract (20 µg/lane) were determined by immunoblot at the indicated times. WB, Western blot. B, at 74 h, G418 was removed, and cultures were allowed to recover for 2 h before being challenged with 100 mM NaCl for 6 h. Levels of O-GlcNAc (upper panel) and actin (lower panel) in total cell extract (20 µg/lane) were determined in duplicate by immunoblot. Cont, control. C, G418 was washed out of cultures at 74 h, and cultures were allowed to recover for 2 h. Cells were stressed at 45 °C for 0–60 min and then returned to 37 °C for 24 h. Cell viability was assessed using the crystal violet method (72) and is expressed as a percent of the untreated cells. Control cells are indicated by triangles and OGT null cells by squares. A representative experiment is presented (n = 3), and numbers are derived from 6 samples per point. D, levels of OGT (upper panel), O-GlcNAc (middle panel), and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (lower panel) were determined in Neuro-2A cells where the OGT message had been reduced by RNAi. E, neuro-2A cells in which OGT had been reduced by RNAi were stressed at 48 °C for 0–60 min and then returned to 37 °C for 24 h. Cell viability was assessed using the crystal violet method (72) and is expressed as a % of the untreated cells. Control cells are indicated by triangles and OGT null cells by squares. A representative experiment is presented (n = 3).

 
To confirm these data in an independent system, OGT levels were reduced using RNAi in Neuro-2A cells (Fig. 5D). The thermotolerance of the wild-type cells (transfected with scrambled siRNA duplex) was compared and found to be greater than those with less OGT and O-GlcNAc (Fig. 5E). These data suggest that O-GlcNAc/OGT is necessary for cells to withstand cellular stress.

We next determined the thermotolerance of cells whose levels of O-GlcNAc were elevated by inhibiting the enzyme that removes O-GlcNAc. Cells treated with the competitive inhibitor PUGNAc (Ki = 53 nM) of O-GlcNAcase (79, 80) had increased viability when challenged with a lethal thermal stress (Fig. 6, A and B). An increase in thermotolerance after PUGNAc treatment was also observed in Neuro-2A cells (data not shown). Notably, PUGNAc did not appear to affect HSP70 levels suggesting that the drug itself was not causing stress (Fig. 6A). Moreover, this is consistent with the data of Haltiwanger et al. (80) who showed that prolonged treatment of multiple cell lines with PUGNAc had little effect on growth rates.



View larger version (58K):
[in this window]
[in a new window]
 
FIG. 6.
Increasing O-GlcNAc levels with PUGNAc increases thermotolerance. A, COS-7 cells treated with or without 100 µM PUGNAc for 18 h were stressed at 45 °C for 1 h, followed by recovery at 37 °C for 6 h. Levels of O-GlcNAc (upper panel), HSP/HSC70 (middle panel), and actin (lower panel) in total cell extract (20 µg/lane) were determined in duplicate by immunoblot. WB, Western blot. B, COS-7 cells were treated with 100 µM PUGNAc (Carbogen, Switzerland) for 18 h and were stressed at 48 °C for 0–75 min and then returned to 37 °C for 24 h. Cell viability was assessed as described and is expressed as a % of the untreated cells. Control cells are indicated by triangle and PUGNAc-treated cells by squares. A representative viability curve is presented (n = 5). Data shown are the average of 10 data points. C, COS-7 cells transfected with 3 µg of pShuttle ({blacktriangleup}) or pShuttle-OGT ({blacksquare}) using FuGENE 6 (Roche Applied Science) were grown for 24 h. Thermotolerance (at 48 °C) of the transfected cell lines was determined as described above. A representative viability curve is presented (n = 3). Numbers are derived from the average of four data points. Levels of OGT (inset) were determined by immunoblot. D, COS-7 cells transfected with pShuttle or pShuttle OGT were stressed at 45 °C for 1 h and returned to 37 °C for the indicated lengths of time. Levels of O-GlcNAc (upper panel) and actin (lower panel) in total cell extract (20 µg) were determined by immunoblot.

 
In independent experiments, COS-7 cells were transiently transfected with either vector (pShuttle) or vector containing OGT (pShuttle-OGT), and thermotolerance was measured. As shown (Fig. 6, C and D), cells overexpressing OGT exhibited both an increase in basal O-GlcNAc levels (Fig. 6D) and in thermotolerance (Fig. 6C). Notably, levels of O-GlcNAc are elevated prior to stress and appeared to increase faster in cells transfected with OGT (Fig. 6D). These data indicate that cells elevate the O-GlcNAc modification of proteins as part of a pro-survival mechanism.

Modulating O-GlcNAc Levels Alters Expression of HSP70 and HSP40 To determine what role O-GlcNAc plays in protecting cells from stress, the induction of HSP70 in response to thermal stress was studied. In the presence of PUGNAc, HSP70 levels are appreciably elevated at 5 h, whereas they do not reach an equivalent level in control cells until 9 h (Fig. 7A, upper panel). In response to stress, the transcription factor HSF1 becomes hyperphosphorylated and translocates to the nucleus where it activates the transcription of HSP70. As the cell's requirement for HSP70 abates, HSP70 can bind to and deactivate HSF1 (81). In cells treated with PUGNAc, no difference in the basal level of activated HSF1 was observed, again suggesting the cells were not stressed by treatment with PUGNAc. However, consistent with the increased rate of induction of HSP70 expression, HSF1 activation is suppressed by 9 h in PUGNAc-treated cells but not in control cells (Fig. 7A, lower panel).



View larger version (35K):
[in this window]
[in a new window]
 
FIG. 7.
Modulating O-GlcNAc levels alters heat shock protein expression. A, levels of HSP70 and HSF1 in COS-7 cells treated ±100 µM PUGNAc (18 h) and thermally stressed (45 °C, 1 h) before being returned to 37 °C for the indicated length of time. Arrows indicate the basal (U) and activated (A) HSF1 species. A cross-reacting band is indicated by * and is shown as a loading control. B, levels of HSP70, HSP40, HSP27, and tubulin were determined in cells treated as in A. C, cell extracts of MEF {Delta}OGT (described in Fig. 5) were probed for O-GlcNAc, HSP70, HSP40, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH). D, levels of O-GlcNAc, HSP70, and actin were determined in cells treated ± 20 µM DON (18 h). Densitometry of HSP70 levels normalized to actin (n = 6) are shown.

 
We next examined the levels of two other HSPs, HSP27 and HSP40, because overexpression of these proteins has been shown to protect cells against lethal forms of stress (78). Increased O-GlcNAc levels, a result of PUGNAc treatment prior to stress, had little effect on HSP27 levels. However, HSP40 like HSP70 was induced at a faster rate (Fig. 7B). Moreover, in cells where the levels of O-GlcNAc had been reduced by deletion of the OGT gene, expression of HSP40 and HSP70 was also reduced (Fig. 7C). Blocking the hexosamine biosynthetic pathway with DON, an inhibitor of glutamine fructose-6-amidotransferase, which results in a mild reduction in O-GlcNAc lowers HSP70 levels (Fig. 7D). These data suggest that the protective effects of O-GlcNAc are mediated in part by the modulation of HSP40 and HSP70 levels.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Stress, whether environmental, physiological, or chemical, induces signal transduction events that culminate in the activation/production of proteins/compounds that attenuate the effects of deleterious cellular conditions and counteract signals promoting apoptosis (and necrosis) (77, 78). Protein phosphorylation is typically the mechanism associated with these signal transduction pathways. In this study, we have shown that mammalian cells undergo a rapid, dynamic, and global increase in O-GlcNAc protein modification in response to noxious thermal, chemical, and biological stimuli and that this appears to modulate stress tolerance suggesting that O-GlcNAc is an additional mechanism by which cells sense and respond to stress.

Multiple forms of cellular stress induce higher levels of O-GlcNAc protein modification in diverse mammalian cell types, suggesting that increased O-GlcNAc is a general response to detrimental cellular conditions. Inhibition of protein synthesis and protein degradation does not inhibit this increase, suggesting that it is a dynamic post-translational event. Moreover, in response to thermal stress OGT, the enzyme that adds O-GlcNAc, is rapidly activated (Fig. 4D). Many cellular stresses result in a change in intracellular pH drop of as much as 0.5 pH units, from pH 7.2–7.4. OGT has a pH optima close to pH 6 (82), and a pH drop alone may result in increased intracellular OGT activity. However, unless this pH change results in a covalent modification of the enzyme, it is unlikely to be translated to the in vitro assay used in this study. Notably, OGT has been shown to be modified by tyrosine phosphorylation and O-GlcNAc modification (68), although the effects of these post-translational modifications on the activity and localization of OGT remain elusive. In response to some forms of cellular stress, namely osmotic (NaCl), ethanolic (ethanol), and oxidative (sodium arsenite) stress, levels of OGT increase at the protein level. These data suggest that multiple mechanisms targeting OGT result in increased O-GlcNAc protein modification in response to stress.

In response to stress, many cell types increase glucose uptake, and several studies have linked stress tolerance to elevated glucose flux (48). Two to five percent of the glucose transported into cells is converted to UDP-GlcNAc through the hexosamine biosynthetic pathway (83). Previously we have shown that OGT is directly regulated by the concentration of UDP-GlcNAc (38), with its activity increasing as UDP-GlcNAc levels increase. Thus, another mechanism by which cells increase O-GlcNAc in response to stress could be by increasing pools of UDP-GlcNAc, as a result of stress-induced glucose uptake (48). Notably, oxidative stress activates the hexosamine biosynthetic pathway (84), and inhibition of the hexosamine biosynthetic pathway has been shown to ablate glucose-mediated protection of cells in some models (59).

Modulation of O-GlcNAc levels alters thermotolerance in independent systems, increasing levels of O-GlcNAc increases thermotolerance (Fig. 6), and decreasing O-GlcNAc levels sensitizes cells to stress (Fig. 5). These data suggest that O-GlcNAc plays a positive role in cellular survival, in contrast to previous studies that indicated that reducing levels of O-GlcNAc correlate with reduced sensitivity to apoptotic stimuli (85). Most interesting, O-GlcNAcase is rapidly cleaved by caspase-3 after apoptosis and remains active, suggesting that that removal of O-GlcNAc is part of the apoptotic cascade (71).

Global increases in the O-GlcNAc post-translational modification could play many roles in regulating the response of a cell to stress, both to preserve protein structure and function and to regulate the activity of proteins in a coordinate manner appropriate to stress. It was reported recently that HSP70 is an O-GlcNAc lectin (65), suggesting that one mechanism through which O-GlcNAc may mediate protection is by increasing the association of HSP70 with target proteins at times of stress. Moreover, the O-GlcNAc modification may alter the regulation or localization of heat shock proteins, several of which are modified by O-GlcNAc including HSP70 (86), HSC70 (69), HSP90 (69), and HSP27 (87). Similar to HSP70 and HSP40, the synthesis of other stress-induced proteins may be regulated by O-GlcNAc. Spy, the Arabidopsis homolog of OGT, promotes transcription of abscisic acid promoters in the absence of abscisic acid, a plant stress hormone (88). O-GlcNAc may also mediate protection by stabilizing protein structure, such as seen for other carbohydrates (89), or alternatively by preventing the aggregation of denatured proteins. Several other pathways have been implicated in glucose-mediated stress tolerance, and these are attractive targets for further studying the role of O-GlcNAc in stress resistance (48, 59).

The mechanisms of O-GlcNAc-mediated stress tolerance suggested by our findings include the faster induction of HSP70 and HSP40 (Fig. 7, A and B), overexpression of which is known to increase stress tolerance. Decreasing O-GlcNAc levels by deletion of the OGT (Fig. 5 and Fig. 7C) or by reducing O-GlcNAc levels by blocking the hexosamine biosynthetic pathway with DON (Fig. 7D) resulted in lower HSP70 and HSP40 levels. These data suggest that O-GlcNAc/UDP-GlcNAc alters a pathway required for the induction of HSP70 and HSP40. O-GlcNAc may alter HSP synthesis at multiple steps (78). It is known that O-GlcNAc has positive and negative effects on transcription (30, 31), stabilizing protein translation (3) as well as signal transduction (1). Notably, this phenomenon is similar to that observed for protein tyrosine phosphorylation, where cells that have higher basal levels of tyrosine phosphorylation are more thermotolerant, and this appears to be linked to an earlier onset in protein synthesis, in particular heat shock proteins, post-stress (75).

Although there are many stress-, cell-, and organism-specific responses, the synthesis of heat shock proteins is ubiquitous. Overexpression of HSPs is sufficient to render cells more tolerant to most forms of cellular stress. The role of O-GlcNAc in the modulation of HSPs and stress-activated signaling networks may elucidate new roles for this ubiquitous post-translational modification in diverse clinical and cellular settings including cancer, ischemia/reperfusion injury, neurodegenerative diseases, and aging (77, 78).


    FOOTNOTES
 
* This work was supported in part by National Institutes of Health Grant CA42486 (to G. W. H.), NHLBI Grant N01-HV-28180 (to G. W. H.), National Institutes of Health Grant DK48247 (to J. D. M.), and the Howard Hughes Medical Institute (to J. D. M.). Under a licensing agreement between Covance Research Products and The Johns Hopkins University, Dr. Hart receives a share of royalties received by the university on sales of the CTD 110.6 antibody. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

Present address: Johnson & Johnson Pharmaceutical Research and Development, 3210 Merryfield Row, San Diego, CA 92121. Back

|| Recipient of support as an Investigator of the Howard Hughes Medical Institute. Back

** To whom correspondence should be addressed: Dept. of Biological Chemistry, The Johns Hopkins University School of Medicine, 725 N. Wolfe St., Baltimore, MD 21205-2185. Tel.: 410-614-1265; Fax: 410-614-8804; E-mail: gwhart{at}jhmi.edu.

1 The abbreviations used are: O-GlcNAc, monosaccharides of O-linked {beta}-N-acetylglucosamine; CHO, Chinese hamster ovary; Me2SO, dimethyl sulfoxide; DON, 6-diazo-5-oxonorleucine; HEK293, human embryonic kidney 293; FBS, fetal bovine serum; HCAEC, human coronary artery endothelial cells; HSF1, heat shock factor 1; HSP, heat shock protein; Neuro-2A, neuroblastoma 2A cells; MEFs, mouse embryonic fibroblasts; O-GlcNAcase, O-GlcNAc hexosaminidase (EC 3.2.1.52 [EC] ); OGT, UDP-GlcNAc, polypeptide O-{beta}-N-acetylglucosaminyltransferase (EC 2.4.1.94 [EC] ); PBS, phosphate-buffered saline; PUGNAc, O-(2-acetamido-2-deoxy-D-glucopyranosylidene) amino-N-phenylcarbamate; RNAi, RNA interference; DMEM, Dulbecco's modified Eagle's medium; HSP, heat shock protein; OGT, O-{beta}-N-acetylglucosaminyltransferase; ALLN, N-acetyl-L-leucyl-L-leucyl-L-norleucinal. Back


    ACKNOWLEDGMENTS
 
We thank the Hart laboratory for their critical reading of the manuscript.



    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Wells, L., Vosseller, K., and Hart, G. W. (2001) Science 291, 2376–2378[Abstract/Free Full Text]
  2. Chakraborty, A., Saha, D., Bose, A., Hileman, R. E., Chatterjee, M., and Gupta, N. K. (1994) Indian J. Biochem. Biophys. 31, 236–242[Medline] [Order article via Infotrieve]
  3. Datta, B., Ray, M. K., Chakrabarti, D., Wylie, D. E., and Gupta, N. K. (1989) J. Biol. Chem. 264, 20620–20624[Abstract/Free Full Text]
  4. Ray, M. K., Datta, B., Chakraborty, A., Chattopadhyay, A., Meza-Keuthen, S., and Gupta, N. K. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 539–543[Abstract/Free Full Text]
  5. Han, I., and Kudlow, J. E. (1997) Mol. Cell. Biol. 17, 2550–2558[Abstract]
  6. Han, I., Roos, M. D., and Kudlow, J. E. (1998) J. Cell. Biochem. 68, 50–61[CrossRef][Medline] [Order article via Infotrieve]
  7. Cheng, X., Cole, R. N., Zaia, J., and Hart, G. W. (2000) Biochemistry 39, 11609–11620[CrossRef][Medline] [Order article via Infotrieve]
  8. Duverger, E., Carpentier, V., Roche, A. C., and Monsigny, M. (1993) Exp. Cell Res. 207, 197–201[CrossRef][Medline] [Order article via Infotrieve]
  9. Duverger, E., Pellerin-Mendes, C., Mayer, R., Roche, A. C., and Monsigny, M. (1995) J. Cell Sci. 108, 1325–1332[Abstract]
  10. Duverger, E., Roche, A. C., and Monsigny, M. (1996) Glycobiology 6, 381–386[Abstract/Free Full Text]
  11. Monsigny, M., Midoux, P., Mayer, R., and Roche, A. C. (1999) Biosci. Rep. 19, 125–132[CrossRef][Medline] [Order article via Infotrieve]
  12. Soulard, M., Della Valle, V., Siomi, M. C., Pinol-Roma, S., Codogno, P., Bauvy, C., Bellini, M., Lacroix, J. C., Monod, G., Dreyfuss, G., and Larsen, C. J. (1993) Nucleic Acids Res. 21, 4210–4217[Abstract/Free Full Text]
  13. Bachmann, M., Pfeifer, K., Schroder, H. C., and Muller, W. E. (1989) Mol. Cell. Biochem. 85, 103–114[CrossRef][Medline] [Order article via Infotrieve]
  14. Juang, Y. T., Solomou, E. E., Rellahan, B., and Tsokos, G. C. (2002) J. Immunol. 168, 2865–2871[Abstract/Free Full Text]
  15. Roos, M. D., Su, K., Baker, J. R., and Kudlow, J. E. (1997) Mol. Cell. Biol. 17, 6472–6480[Abstract]
  16. Yang, X., Su, K., Roos, M. D., Chang, Q., Paterson, A. J., and Kudlow, J. E. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 6611–6616[Abstract/Free Full Text]
  17. Gao, Y., Miyazaki, J., and Hart, G. W. (2003) Arch. Biochem. Biophys. 415, 155–163[CrossRef][Medline] [Order article via Infotrieve]
  18. Du, X. L., Edelstein, D., Dimmeler, S., Ju, Q., Sui, C., and Brownlee, M. (2001) J. Clin. Investig. 108, 1341–1348[CrossRef][Medline] [Order article via Infotrieve]
  19. Federici, M., Menghini, R., Mauriello, A., Hribal, M. L., Ferrelli, F., Lauro, D., Sbraccia, P., Spagnoli, L. G., Sesti, G., and Lauro, R. (2002) Circulation 106, 466–472[Abstract/Free Full Text]
  20. Parker, G. J., Lund, K. C., Taylor, R. P., and McClain, D. A. (2003) J. Biol. Chem. 278, 10022–10027[Abstract/Free Full Text]
  21. Kelly, W. G., Dahmus, M. E., and Hart, G. W. (1993) J. Biol. Chem. 268, 10416–10424[Abstract/Free Full Text]
  22. Comer, F. I., and Hart, G. W. (2001) Biochemistry 40, 7845–7852[CrossRef][Medline] [Order article via Infotrieve]
  23. Chou, T. Y., Dang, C. V., and Hart, G. W. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 4417–4421[Abstract/Free Full Text]
  24. Chou, T. Y., Hart, G. W., and Dang, C. V. (1995) J. Biol. Chem. 270, 18961–18965[Abstract/Free Full Text]
  25. Kamemura, K., Hayes, B. K., Comer, F. I., and Hart, G. W. (2002) J. Biol. Chem. 277, 19229–19235[Abstract/Free Full Text]
  26. Medina, L., Grove, K., and Haltiwanger, R. S. (1998) Glycobiology 8, 383–391[Abstract/Free Full Text]
  27. Hart, G. W., Greis, K. D., Dong, L. Y., Blomberg, M. A., Chou, T. Y., Jiang, M. S., Roquemore, E. P., Snow, D. M., Kreppel, L. K., Cole, R. N., Comer, F. I., Arnold, S. I., and Hayes, B. K. (1995) Adv. Exp. Med. Biol. 376, 115–123[Medline] [Order article via Infotrieve]
  28. Hart, G. W., Kreppel, L. K., Comer, F. I., Arnold, C. S., Snow, D. M., Ye, Z., Cheng, X., DellaManna, D., Caine, D. S., Earles, B. J., Akimoto, Y., Cole, R. N., and Hayes, B. K. (1996) Glycobiology 6, 711–716[Free Full Text]
  29. Comer, F. I., and Hart, G. W. (2000) J. Biol. Chem. 275, 29179–29182[Free Full Text]
  30. Yang, X., Zhang, F., and Kudlow, J. E. (2002) Cell 110, 69–80[CrossRef][Medline] [Order article via Infotrieve]
  31. Hiromura, M., Choi, C. H., Sabourin, N. A., Jones, H., Bachvarov, D., and Usheva, A. (2003) J. Biol. Chem. 278, 14046–14052[Abstract/Free Full Text]
  32. Goldberg, H. J., Whiteside, C. I., and Fantus, I. G. (2002) J. Biol. Chem. 277, 33833–33841[Abstract/Free Full Text]
  33. Jackson, S. P., and Tjian, R. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 1781–1785[Abstract/Free Full Text]
  34. Jackson, S. P., and Tjian, R. (1988) Cell 55, 125–133[Medline] [Order article via Infotrieve]
  35. Lamarre-Vincent, N., and Hsieh-Wilson, L. C. (2003) J. Am. Chem. Soc. 125, 6612–6613[CrossRef][Medline] [Order article via Infotrieve]
  36. Sumegi, M., Hunyadi-Gulyas, E., Medzihradszky, K. F., and Udvardy, A. (2003) Biochem. Biophys. Res. Commun. 312, 1284–1289[CrossRef][Medline] [Order article via Infotrieve]
  37. Zhang, F., Su, K., Yang, X., Bowe, D. B., Paterson, A. J., and Kudlow, J. E. (2003) Cell 115, 715–725[CrossRef][Medline] [Order article via Infotrieve]
  38. Kreppel, L. K., and Hart, G. W. (1999) J. Biol. Chem. 274, 32015–32022[Abstract/Free Full Text]
  39. McClain, D. A., Lubas, W. A., Cooksey, R. C., Hazel, M., Parker, G. J., Love, D. C., and Hanover, J. A. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, 10695–10699[Abstract/Free Full Text]
  40. Vosseller, K., Wells, L., Lane, M. D., and Hart, G. W. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, 5313–5318[Abstract/Free Full Text]
  41. Buse, M. G., Robinson, K. A., Marshall, B. A., Hresko, R. C., and Mueckler, M. M. (2002) Am. J. Physiol. 283, E241–E250
  42. Pasternak, C. A., Aiyathurai, J. E., Makinde, V., Davies, A., Baldwin, S. A., Konieczko, E. M., and Widnell, C. C. (1991) J. Cell. Physiol. 149, 324–331[CrossRef][Medline] [Order article via Infotrieve]
  43. Sviderskaya, E. V., Jazrawi, E., Baldwin, S. A., Widnell, C. C., and Pasternak, C. A. (1996) J. Membr. Biol. 149, 133–140[CrossRef][Medline] [Order article via Infotrieve]
  44. Warren, A. P., James, M. H., Menzies, D. E., Widnell, C. C., Whitaker-Dowling, P. A., and Pasternak, C. A. (1986) J. Cell. Physiol. 128, 383–388[CrossRef][Medline] [Order article via Infotrieve]
  45. Widnell, C. C., Baldwin, S. A., Davies, A., Martin, S., and Pasternak, C. A. (1990) FASEB J. 4, 1634–1637[Abstract]
  46. Ikari, A., Nakano, M., Kawano, K., and Suketa, Y. (2002) J. Biol. Chem. 277, 33338–33343[Abstract/Free Full Text]
  47. Barnes, K., Ingram, J. C., Porras, O. H., Barros, L. F., Hudson, E. R., Fryer, L. G., Foufelle, F., Carling, D., Hardie, D. G., and Baldwin, S. A. (2002) J. Cell Sci. 115, 2433–2442[Abstract/Free Full Text]
  48. Moley, K. H., and Mueckler, M. M. (2000) Apoptosis 5, 99–105[CrossRef][Medline] [Order article via Infotrieve]
  49. Hall, J. L., Matter, C. M., Wang, X., and Gibbons, G. H. (2000) Circ. Res. 87, 574–580[Abstract/Free Full Text]
  50. Lin, Z., Weinberg, J. M., Malhotra, R., Merritt, S. E., Holzman, L. B., and Brosius, F. C., III (2000) Am. J. Physiol. 278, E958–E966
  51. Malhotra, R., and Brosius, F. C., III (1999) J. Biol. Chem. 274, 12567–12575[Abstract/Free Full Text]
  52. Dwyer, D. S., Liu, Y., and Bradley, R. J. (1999) J. Cell. Physiol. 178, 93–101[CrossRef][Medline] [Order article via Infotrieve]
  53. Fiorentini, D., Hakim, G., Bonsi, L., Bagnara, G. P., Maraldi, T., and Landi, L. (2001) Free Radic. Biol. Med. 31, 923–931[CrossRef][Medline] [Order article via Infotrieve]
  54. Kozlovsky, N., Rudich, A., Potashnik, R., Ebina, Y., Murakami, T., and Bashan, N. (1997) J. Biol. Chem. 272, 33367–33372[Abstract/Free Full Text]
  55. Barros, L. F., Barnes, K., Ingram, J. C., Castro, J., Porras, O. H., and Baldwin, S. A. (2001) Pfluegers Arch. 442, 614–621[CrossRef][Medline] [Order article via Infotrieve]
  56. Zhang, J. Z., Behrooz, A., and Ismail-Beigi, F. (1999) Am. J. Kidney Dis. 34, 189–202[Medline] [Order article via Infotrieve]
  57. Kan, O., Baldwin, S. A., and Whetton, A. D. (1994) J. Exp. Med. 180, 917–923[Abstract/Free Full Text]
  58. Liu, W., Schoenkerman, A., and Lowe, W. L., Jr. (2000) Am. J. Physiol. 279, E782–E790
  59. Pang, Y., Hunton, D. L., Bounelis, P., and Marchase, R. B. (2002) Diabetes 51, 3461–3467[Abstract/Free Full Text]
  60. Rivera, A. A., White, C. R., Guest, L. L., Elton, T. S., and Marchase, R. B. (1995) Am. J. Physiol. 269, C1482–C1488[Medline] [Order article via Infotrieve]
  61. Vemuri, S., and Marchase, R. B. (1999) J. Biol. Chem. 274, 20165–20170[Abstract/Free Full Text]
  62. Gual, P., Gonzalez, T., Gremeaux, T., Barres, R., Le Marchand-Brustel, Y., and Tanti, J. F. (2003) J. Biol. Chem. 278, 26550–26557[Abstract/Free Full Text]
  63. Holzenberger, M., Dupont, J., Ducos, B., Leneuve, P., Geloen, A., Even, P. C., Cervera, P., and Le Bouc, Y. (2003) Nature 421, 182–187[CrossRef][Medline] [Order article via Infotrieve]
  64. Pereira, C., Moreira, P., Seica, R., Santos, M. S., and Oliveira, C. R. (2000) Exp. Neurol. 161, 383–391[CrossRef][Medline] [Order article via Infotrieve]
  65. Lefebvre, T., Cieniewski, C., Lemoine, J., Guerardel, Y., Leroy, Y., Zanetta, J. P., and Michalski, J. C. (2001) Biochem. J. 360, 179–188[CrossRef][Medline] [Order article via Infotrieve]
  66. O'Donnell, N., Zachara, N. E., Hart, G. W., and Marth, J. D. (2004) Mol. Cell. Biol. 1680–1690
  67. Comer, F. I., Vosseller, K., Wells, L., Accavitti, M. A., and Hart, G. W. (2001) Anal. Biochem. 293, 169–177[CrossRef][Medline] [Order article via Infotrieve]
  68. Kreppel, L. K., Blomberg, M. A., and Hart, G. W. (1997) J. Biol. Chem. 272, 9308–9315[Abstract/Free Full Text]
  69. Wells, L., Vosseller, K., Cole, R. N., Cronshaw, J. M., Matunis, M. J., and Hart, G. W. (2002) Mol. Cell. Proteomics 1, 791–804[Abstract/Free Full Text]
  70. Gao, Y., Wells, L., Comer, F. I., Parker, G. J., and Hart, G. W. (2001) J. Biol. Chem. 276, 9838–9845[Abstract/Free Full Text]
  71. Wells, L., Gao, Y., Mahoney, J. A., Vosseller, K., Chen, C., Rosen, A., and Hart, G. W. (2002) J. Biol. Chem. 277, 1755–1761[Abstract/Free Full Text]
  72. Andreoni, G., Angeretti, N., Lucca, E., and Forloni, G. (1997) Exp. Neurol. 148, 281–287[CrossRef][Medline] [Order article via Infotrieve]
  73. Meriin, A. B., Gabai, V. L., Yaglom, J., Shifrin, V. I., and Sherman, M. Y. (1998) J. Biol. Chem. 273, 6373–6379[Abstract/Free Full Text]
  74. Luss, H., Schmitz, W., and Neumann, J. (2002) Cardiovasc. Res. 54, 140–151[CrossRef][Medline] [Order article via Infotrieve]
  75. Kim, H. J., Song, E. J., and Lee, K. J. (2002) J. Biol. Chem. 277, 23193–23207[Abstract/Free Full Text]
  76. Shafi, R., Iyer, S. P., Ellies, L. G., O'Donnell, N., Marek, K. W., Chui, D., Hart, G. W., and Marth, J. D. (2000) Proc. Natl. Acad. Sci. U. S. A. 97, 5735–5739[Abstract/Free Full Text]
  77. Kiang, J. G., and Tsokos, G. C. (1998) Pharmacol. Ther. 80, 183–201[CrossRef][Medline] [Order article via Infotrieve]
  78. Kregel, K. C. (2002) J. Appl. Physiol. 92, 2177–2186[Abstract/Free Full Text]
  79. Dong, D. L., and Hart, G. W. (1994) J. Biol. Chem. 269, 19321–19330[Abstract/Free Full Text]
  80. Haltiwanger, R. S., Grove, K.,