JBC Advanced Glycation Endproducts

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M401399200 on May 7, 2004 Originally published In Press as doi:10.1074/jbc.M401399200 on May 4, 2004

J. Biol. Chem., Vol. 279, Issue 29, 30498-30506, July 16, 2004
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
279/29/30498    most recent
M401399200v2
M401399200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sze, C.-I
Right arrow Articles by Chang, N.-S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sze, C.-I
Right arrow Articles by Chang, N.-S.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Down-regulation of WW Domain-containing Oxidoreductase Induces Tau Phosphorylation in Vitro

A POTENTIAL ROLE IN ALZHEIMER'S DISEASE*

Chun-I Sze{ddagger}, Meng Su{ddagger}, Subbiah Pugazhenthi§, Purevsuren Jambal§, Li-Jin Hsu¶||, John Heath¶, Lori Schultz¶, and Nan-Shan Chang¶**

From the Departments of {ddagger}Pathology and §Medicine, University of Colorado Health Sciences Center, Denver, Colorado 80262 and the Laboratory of Molecular Immunology, Guthrie Research Institute, Sayre, Pennsylvania 18840

Received for publication, February 9, 2004 , and in revised form, April 13, 2004.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Numerous enzymes hyperphosphorylate Tau in vivo, leading to the formation of neurofibrillary tangles (NFTs) in the neurons of Alzheimer's disease (AD). Compared with age-matched normal controls, we demonstrated here that the protein levels of WW domain-containing oxidoreductase WOX1 (also known as WWOX or FOR), its Tyr33-phosphorylated form, and WOX2 were significantly down-regulated in the neurons of AD hippocampi. Remarkably knock-down of WOX1 expression by small interfering RNA in neuroblastoma SK-N-SH cells spontaneously induced Tau phosphorylation at Thr212/Thr231 and Ser515/Ser516, enhanced phosphorylation of glycogen synthase kinase 3{beta} (GSK-3{beta}) and ERK, and enhanced NFT formation. Also an increased binding of phospho-GSK-3{beta} with phospho-Tau was observed in these WOX1 knock-down cells. In comparison, increased phosphorylation of Tau, GSK-3{beta}, and ERK, as well as NFT formation, was observed in the AD hippocampi. Activation of JNK1 by anisomycin further increased Tau phosphorylation, and SP600125 (a JNK inhibitor) and PD-98059 (an MEK1/2 inhibitor) blocked Tau phosphorylation and NFT formation in these WOX1 knock-down cells. Ectopic or endogenous WOX1 colocalized with Tau, JNK1, and GSK-3{beta} in neurons and cultured cells. 17{beta}-Estradiol, a neuronal protective hormone, increased the binding of WOX1 and GSK-3{beta} with Tau. Mapping analysis showed that WOX1 bound Tau via its COOH-terminal short-chain alcohol dehydrogenase/reductase domain. Together WOX1 binds Tau via its short-chain alcohol dehydrogenase/reductase domain and is likely to play a critical role in regulating Tau hyperphosphorylation and NFT formation in vivo.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Alzheimer's disease (AD)1 is a neurodegenerative disorder characterized by progressive cognitive impairment. AD is associated with cortical neuronal loss with gliosis, synaptic dysfunction, and widespread senile plaques consisting of amyloid {beta} and neurofibrillary tangles (NFTs). Substantial evidence has demonstrated that cortical neurons and glial cells undergo apoptotic cell death in AD (1–4), and activation of the apoptotic pathways may contribute to the pathogenesis of AD and other neurological diseases (5, 6).

WW domain-containing oxidoreductase WWOX/FOR/WOX1 is a proapoptotic protein (7–11). The wild type WOX1 (46 kDa) possesses two NH2-terminal WW domains (containing conserved tryptophan residues), a nuclear localization sequence, and a COOH-terminal short-chain alcohol dehydrogenase/reductase (ADH/SDR) domain. The WW domain sequence is conserved. A mitochondria-targeting region has been identified in the ADH/SDR domain of WOX1, and a portion of cytosolic WOX1 is present in the mitochondria (7). During apoptosis, mitochondrial WOX1, along with cytochrome c, is released and translocated to the nucleus (7). Stress stimuli such as anisomycin and UV light stimulate WOX1 phosphorylation at Tyr33, leading to the binding of WOX1 with p53 and JNK1 (c-Jun NH2-terminal kinase) (10). Overexpressed WOX1 induces apoptosis synergistically with p53 (7). p53 apoptosis is abolished by antisense WOX1 (7) or by a dominant negative WOX1 (10), indicating a functional cooperation between p53 and WOX1.

Human WWOX gene, encoding the WWOX/FOR/WOX1 family proteins, has been mapped to a fragile site on chromosome 16q23.2 (for reviews, see Refs. 8, 9, and 11). Approximately 50% of loss of heterozygosity of this gene is found in breast, prostate, lung, and esophageal squamous carcinomas. Additionally at least eight aberrant mRNA transcripts have been found in cancer cells (11). WOX1 is considered to be a candidate tumor suppressor (11–14). Nonetheless the protein level of WOX1 is significantly increased in several cancers, raising the question whether WOX1 can act as a tumor suppressor (15).

The role of WOX1 in regulating the development and function of neural cells is largely unknown. Our recent study demonstrated that WOX1 is likely to play a role in the developing nervous system (16). WOX1 is differentially expressed during various stages of brain development in mice. Most interestingly, high levels of WOX1 expression are observed in the neural crest-derived structures such as cranial and spinal ganglia, skin pigment cells, and mesenchyme in the head, indicating a potential role of WOX1 in promoting neuronal differentiation and maturation.

Compared with cognitive normal age-matched controls, we demonstrated here that the protein levels of WOX1, its isoform WOX2 (17), and Tyr33 phosphorylation in WOX1 (p-WOX1) (10) were significantly down-regulated in the hippocampi of AD patients. In contrast, phosphorylation of Tau, ERK, and GSK-3{beta} and NFT formation were significantly up-regulated in the AD hippocampi. Specifically we determined that Tau phosphorylation at Thr205/Thr212/Thr231 and Ser202/Ser422/Ser515/Ser516 was significantly increased. These phosphorylation sites are regulated by GSK-3{beta}, cdk5, and ERK (or mitogen-activated protein kinase) (18–24). In AD brains, activated GSK-3{beta}, cdk5, JNK, p38, ERK, and other kinases are known to hyperphosphorylate Tau, leading to the formation of NFTs in degenerative neurons (18–24).

To examine whether down-regulation of WOX1 is essential for Tau phosphorylation in AD, we determined that suppression of WOX1 expression by small interfering RNA (siRNA) spontaneously induced phosphorylation of Tau at Thr212/Thr231 and Ser515/Ser516, phosphorylation of GSK-3{beta} and ERK, and NFT formation in neuroblastoma SK-N-SH cells and L929 fibroblasts. Anisomycin, an activator of JNK1, also induced Tau phosphorylation at Thr212/Thr231 and Ser515/Ser516. SP600125 (a JNK inhibitor) and PD-98059 (an MEK1/2 inhibitor) blocked the Tau phosphorylation and NFT formation, indicating that JNK1 and ERK induce Tau phosphorylation and NFT formation in the WOX1 knock-down cells.

To further establish the underlying mechanism, we showed that WOX1 colocalized with JNK1, GSK-3{beta}, and Tau in the hippocampal neurons. 17{beta}-Estradiol (E2), an estrogen, enhanced the binding of WOX1 with phosphorylated Tau. Estrogen protects neuronal cells from apoptosis (25–28). As mapped by yeast two-hybrid analysis (7, 10), we determined that the ADH/SDR domain of WOX1 interacted with Tau. How WOX1 regulates Tau phosphorylation and the functional significance of WOX1 down-regulation in AD are discussed.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Cell Lines and Chemicals—Cell lines used in these studies were human neuroblastoma SK-N-SH cells, murine L929 fibroblasts, and monkey kidney COS7 fibroblasts. These cells have been routinely grown in our laboratories according to the instructions of ATCC. E2 and anisomycin, an activator of JNK1 (10), were from Sigma. SP600125, an inhibitor of JNK1 (29), was from Biomol. PD-98059, an inhibitor of MEK1/2, was from Calbiochem.

Antibodies—Generation of rabbit antibody against a synthetic peptide, corresponding to amino acids 89–107 of the NH2-terminal murine WOX1, was performed as described previously (7). It is a pan antibody that interacts with the wild type murine, rat, and human WOX1 and other WOX family proteins possessing an intact NH2-terminal WW domain. Antibodies were also generated against the unique COOH termini of human WOX1 (amino acids 397–414, NH2-LWALSERLIQERLGSQSG-COOH) and human WOX2 (also known as FOR1, amino acids 353–363, NH2-VSDCLVEGGHF-COOH). Additionally antibody production against a synthetic peptide, NH-CKDGWVYPYANHTEEKT-COOH (where PY is phosphotyrosine), was performed as described previously (10).

Additional antibodies used were against the following: 1) human p53, JNK1, Tau, phosphorylated Tau (Ser515/Ser516), GSK-3{beta}, and phosphorylated GSK-3{beta} (Tyr216) (Santa Cruz Biotechnologies); 2) human PHF-Tau with Alzheimer-specific epitope of AT100 (Thr212/Ser214) (Pierce); 3) {beta}-tubulin (used in the Sze laboratory, Roche Applied Science); 4) {beta}-actin (used in the Pugazhenthi laboratory, Roche Applied Science); and 4) {alpha}-tubulin (used in the Chang laboratory, Accurate Chemicals). A sampler pack of antibodies against Tau was from BIOSOURCE that included a Tau pan antibody, an NFT antibody, and 11 antibodies for site-specific phosphorylation in the human Tau (Thr(P)181, Ser(P)202, Thr(P)205, Thr(P)212, Ser(P)214, Thr(P)231, Ser(P)262, Ser(P)396, Ser(P)404, Ser(P)409, and Ser(P)422).

Autopsy Brain Samples—Eight frozen hippocampi of postmortem brains were from clinically and pathologically confirmed AD patients (mean age, 79 years; postmortem delay: range, 6–16 h; mean, 11 h). Control samples were eight age-matched subjects (mean age, 74 years; postmortem delay: range, 3–16 h; mean, 8 h) without evidence of clinical or brain pathology. These materials were from the Brain Bank at the Department of Pathology, University of Colorado Health Sciences Center. The diagnoses of AD were formulated based on the criteria from the Consortium to Establish a Registry for Alzheimer's Disease (30).

Immunohistochemistry—The above mentioned hippocampal tissues were formalin-fixed and paraffin-imbedded. The blocks were sectioned (5 µm) and mounted on plus slides. The tissues were deparaffinized and hydrated through serial ethanol solutions and finally in distilled water. The hydrated tissue sections were steamed in 10 mM sodium citrate buffer (pH 6.0) for 30 min for antigen retrieval followed by treatment with 1% hydrogen peroxide (10 min) and blocking with 5% horse serum (1 h) at room temperature. The tissue sections were incubated with aliquots of antibodies (1:200 final dilution) against WOX1, WOX2, and p-WOX1, respectively, in Tris-buffered saline (pH 7.4) at 4 °C overnight. Aliquots of biotinylated secondary antibodies were then added. Color development was performed using a labeled streptavidin biotin plus horseradish peroxidase kit (Dako). In negative controls, tissue sections were stained with aliquots of prebled rabbit sera. Where indicated, synthetic peptides (100 µM) were premixed with the above mentioned antisera (5 min at room temperature) prior to immunostaining.

Immunofluorescence Microscopy—In some experiments, the hippocampal tissues were stained with antibodies against JNK1 (rabbit antibody) and/or Tau (goat antibody) followed by addition of secondary fluorescein isothiocyanate-conjugated anti-rabbit IgG and Texas Red-conjugated anti-goat IgG (7). The nuclei were stained with 4',6-diamidino-2-phenylindole (DAPI, Calbiochem). The slides were examined by fluorescence microscopy as described previously (7). Where indicated, other antibodies were used in dual immunostaining.

Western Blotting—A 2- or 4-mm Acu-Punch (Acuderm) was used to obtain hippocampal tissues (100–200 mg) from frozen postmortem brain slabs. The tissues had been stored at -80 °C and then warmed to -20 °C overnight prior to sampling. These samples were Dounce-extracted in the presence of a mixture of protease inhibitors (Sigma) and then centrifuged at 10,000 rpm for 10 min to remove debris as described previously (31). The samples (50 µg/lane) were quantified by the Bradford method (Bio-Rad) and subjected to SDS-PAGE, electroblotting, and Western blotting as described previously (31). Scanning and quantification were performed using BioRad Fluor-STM MultiImager and Quantity One software. The extent of protein expression was expressed as relative OD as determined by comparing the density and area of an immunoreactive band in each lane with those of control lanes in the same blot. The data were assessed by Student's t test and Spearman correlation procedure.

Co-immunoprecipitation—Where indicated, L929 or other cells treated with or without E2 were extracted using a cytoplasmic and nuclear extraction kit (Pierce) (7, 10). These protein preparations (~1 mg of protein) were quantified and co-immunoprecipitated (7, 10) using specific antibodies against p-WOX1 or GSK-3{beta}.

Mammalian Expression Constructs—Murine GFP-WOX1 (in pEGFP-C1, Clontech) was made as described previously (7, 10). The coding sequence of the ADH/SDR domain in WOX1, designated GFP-WOX1adh, was also constructed in pEGFP-C1. COS7 or the indicated cells were electroporated with these cDNA constructs or the "empty" pEGFP-C1 vector as controls. Protein expression was examined by fluorescence microscopy and Western blotting (7, 10). Alternatively liposome-based Fu-GENE 6 (Roche Applied Science) or GeneFector (Venn Nova) was used for transferring cDNA constructs into cells (7, 10).

Cytoplasmic Yeast Two-hybrid Analysis—Ras rescue-based yeast two-hybrid analysis (CytoTrap, Stratagene) was performed as described previously (7, 10). Briefly binding of a cytosolic Sos-tagged bait protein to a cell membrane-anchored target protein (tagged with a myristoylation signal) activates the Ras signaling pathway in yeast. This activation allows mutant yeast cdc25H to grow in 37 °C using a selective agarose plate containing galactose. Without binding, yeast cells fail to grow at 37 °C. Constructs (in pSos vector) used as baits were as follows: 1) a murine full-length WOX1, 2) an NH2-terminal WW domain area of WOX1, 3) a COOH-terminal ADH/SDR domain area of WOX1, and 4) a Y33R mutant in the WW domain area (for the above constructs as baits) (7, 10). For target, a construct for human Tau, with three repeats of a microtubule-binding domain (GenBankTM accession number BC000558 [GenBank] ), was made in pMyr vector. Additional constructs for the binding experiments were human p53 (in pMyr) and MafB (in both pMyr and pSos) (7).

siRNA-targeting WOX1—A retroviral siRNA expression construct for targeting human WOX1 was made (in pSupressorRetro) using a Gene-Suppressor construction kit from Imgenex. The synthetic primers (MWG Biotech) for making the expression construct were as follows: 1) forward, 5'-TCGAGCCAAGTCCATGCAACAGGGGAGTACTGCCCTGTTGCATGGACTTT, and 2) reverse, 5'-CTAGAAAAACCAAGTCCATGCACAGGGCAGTACTCCCCTGTTGCATGGACTTGGC. The resulting siRNA targets a sequence at the 3' end of WOX1 mRNA. An empty vector was used as a control. Production of retrovirus and transfection to target cells were performed according to the manufacturer's instructions. A similar construct was made using a mammalian expression plasmid, pSuppressorNeo, from Imgenex. Also, a negative control vector with a scrambled sequence was from Imgenex.

In addition, we selected a conserved sequence region at the WW domain of WOX1 for siRNA targeting. This sequence is identical in human, mouse, and zebrafish. Synthetic primers for making the WOX1si construct (in pSuppressorNeo) were as follows: forward, 5'-TCGAGCCAAGTCCATGCACAGGGGAGTACTGCCCTGTTGCATGGACTTGGTTTTT, and reverse, 5'-CTAGAAAAACCAAGTCCATGCACAGGGCAGTACTCCCCTGTTGCATGGACTTGGC. Where indicated, L929 and SK-N-SH cells were transfected with these constructs by electroporation. Stable transfectants were selected using G418 (300 µg/ml) during 2–3 weeks in culture (7, 10).


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
Down-regulation of WOX1, p-WOX1, and WOX2 in the Hippocampal Neurons and Extracts of AD Brains—As determined by immunohistochemistry, WOX1 is present mainly in the perinuclear areas of both healthy and degenerative neurons from an AD hippocampus (Fig. 1A). Degenerative neurons possess cytoplasmic NFTs and/or granulovacuolar degeneration (Fig. 1A). Compared with healthy neurons, these degenerative neurons have reduced levels of WOX1. Similarly dystrophic neuritic plaques, an important diagnostic feature for AD, were weakly immunoreactive to WOX1 antibodies (Fig. 1A).



View larger version (75K):
[in this window]
[in a new window]
  		FIG. 1.
Down-regulation of WOX1, p-WOX1, and WOX2 expression in the hippocampal neurons of AD brains. A, in the healthy neuron (arrowhead), WOX1 is located mainly in the perinuclear area (left panel). Degenerative neurons possess cytoplasmic NFTs (open arrow) or granulovacuolar degeneration (solid arrow). WOX1 is weakly expressed in dystrophic neuritic plaque (open arrow) and is also present in small neuron (arrowhead) and astrocytic glial cell (solid arrow) (right panel). Immunostaining was performed using antibodies against a conserved segment in the NH2 terminus of WOX1 (7). B, WOX1 expression is down-regulated in the neurons of AD hippocampi compared with normal controls (a representative set from five immunostains; amplification, 200x). Antiserum against the unique COOH terminus of human WOX1 was used in the immunohistochemistry (see "Experimental Procedures"). This newly produced antiserum interacted with the full-length 46-kDa WOX1 in the extract (50 µg) of a normal human brain. C, our newly generated antibodies interacted with the 41-kDa WOX2 in the extract (50 µg) of a normal human brain. Reduced immunoreactivity of WOX2 was found in the neurons of AD brains compared with those cells in control brains (amplification, 200x). Ab, antibody.

 
Compared with normal controls, down-regulation of WOX1 was observed in the hippocampal neurons in AD (Fig. 1B). The results were observed using antibodies against the unique COOH terminus of human WOX1 (Fig. 1B). The full-length WOX1 (46 kDa) is the major species found in tissues and cultured cells compared with other members of the WWOX/FOR/WOX1 protein family (7, 11). Similar results were also obtained using our previously developed antibodies against the NH2 terminus of WOX1 (7) (see Supplemental Figs. 1–3).

In parallel with the above results, the level of a WOX1 isoform, WOX2 (41 kDa), was relatively higher in healthy neurons than that in the AD (Fig. 1C). The specificity of anti-WOX2 antibodies is shown in Western blotting using a control brain extract (Fig. 1C).

Although WOX1 is phosphorylated at Tyr33 during stress and apoptotic responses (10), a portion of endogenous WOX1 is indeed Tyr33-phosphorylated in numerous cultured cell lines, brains, and other organs.2 Significant reduction of Tyr33 phosphorylation in WOX1 was also observed in the hippocampal neurons of AD brains compared with normal controls (see Supplemental Figs. 1–3). In appropriate controls, tissue sections were stained with prebled rabbit sera or preblocked with specific synthetic peptides and shown to be negative for immunoreactivity (data not shown).

We confirmed the validity of the above observations by determining the expression of WOX1 and its isoforms in the extracts of AD and control hippocampi. Shown in Fig. 2 are representative immunoblots of WOX1, p-WOX1, WOX2, and {beta}-tubulin from the extracts of AD and control hippocampi. The results demonstrate significant down-regulation of WOX1, p-WOX1, and WOX2 in the AD brain extracts compared with age-matched controls (~32 ± 5% reduction, Fig. 2).



View larger version (32K):
[in this window]
[in a new window]
  		FIG. 2.
Down-regulation of WOX1, WOX2, and p-WOX1 in AD hippocampi compared with age-matched controls. A, representative immunoblots of WOX1 (46 kDa), WOX2 (41 kDa), p-WOX1 (46 kDa), and {beta}-tubulin (55 kDa) are shown using the extracts of AD and control hippocampi. B, a scatter plot of the tested samples is shown. Significant down-regulation of WOX1 (n = 8), WOX2 (n = 8), and p-WOX1 (n = 6) is shown in the AD hippocampi compared with age-matched normal controls (~32 ± 5% reduction). C, control.

 
Knock-down of WOX1 Expression Induces Tau Phosphorylation at Thr212/Thr231 and NFT Formation—To determine the potential functional significance regarding WOX1 down-regulation in the AD hippocampi, we knocked down WOX1 expression by siRNA (WOX1si, constructed in pSuppressorNeo plasmid) in human SK-N-SH neuroblastoma cells. The designed siRNA targeted the unique 3' end sequence of human WOX1 mRNA. Transient expression of WOXsi in SK-N-SH cells suppressed WOX1 protein expression by greater than 50% compared with control cells expressing a scrambled siRNA (Fig. 3A). In these WOX1si-expressing cells, phosphorylation of Tau at Thr231 (55 kDa but not 100 kDa) and Thr212 (120 kDa) was significantly increased (Fig. 3A). Phosphorylation of these sites is GSK-3{beta}-dependent. Also WOX1si increased NFT formation in SK-N-SH cells as determined by cell immunostaining and Western blotting (Fig. 3B). The soluble fraction of NFTs (55, 75, and 120 kDa) was shown in Western blotting. The Thr212-phosphorylated Tau (120 kDa) in SK-N-SH cells corresponds to the soluble 120-kDa NFTs, suggesting that Thr212 is phosphorylated when Tau is polymerized to this size.



View larger version (43K):
[in this window]
[in a new window]
  		FIG. 3.
Suppression of WOX1 expression by siRNA (WOX1si) induces Tau phosphorylation at Thr231 and Thr212 in SK-N-SH neuroblastoma cells. A, transient expression of WOXsi (in pSuppressorNeo) in SK-N-SH cells inhibited WOX1 protein expression (>50%) as compared with scrambled siRNA-expressing cells. WOX1si targeted the 3' end of the human WOX1 mRNA. Phosphorylation of Tau at Thr231 (55 kDa) and Thr212 (120 kDa) was increased in the WOXsi-expressing cells. Activation of JNK1 in these cells by anisomycin (100 µM, 1 h) further induced Tau phosphorylation at these sites. Percent increases in Tau phosphorylation are indicated. B, similarly SK-N-SH cells were transfected with the above siRNA constructs, cultured for 48 h, and stained with specific antibody against NFTs (red). Nuclei were stained with 4',6-diamidino-2-phenylindole (DAPI; blue). Increased NFT formation is shown in the WOXsi-expressing cells as determined by both cell immunostaining and Western blotting (soluble fractions of NFTs). C, phosphorylation of Thr231 (p-T231) and Thr212 (p-T212) were significantly increased in the AD hippocampi (n = 8) compared with age-matched controls (n = 8). Four representative data are shown in the Western blot. **, p < 0.05; ***, p < 0.01 (Student's t test). Cont, control.

 
In parallel, Tau phosphorylation at Thr231 and Thr212 was also significantly increased in the AD hippocampi (Fig. 3C). Activation of JNK1 by anisomycin further increased phosphorylation of Tau at Thr231 and Thr212 in scrambled siRNA- and WOX1si-expressing cells (Fig. 3A). These observations suggest that, under stress conditions, JNK1 is able to phosphorylate Tau at Thr231 and Thr212.

Conserved phosphorylation sites are found in Tau isoforms from 35 to 75 kDa. Tau possesses three repeats of a microtubule-binding domain (35-kDa Tau) or three to four repeats (>35-kDa Tau) (23, 32). Phosphorylation of these sites has been found in PHF-Tau or tangled Tau (33–35). Compared with age-matched controls, a panel of Tau phosphorylation at various threonine and serine sites in the AD hippocampi is shown in Supplemental Figs. 1–3.

Retroviral Expression of WOX1si—The above observations were further verified using retroviral expression of WOX1si (targeting the same 3' end region of WOX1 mRNA as indicated above). Cells were transfected with the WOX1si or an empty retrovirus and cultured for 48 h. Suppression of WOX1 expression in SK-N-SH cells was observed (Fig. 4A).



View larger version (57K):
[in this window]
[in a new window]
  		FIG. 4.
Retroviral expression of WOX1si induces phosphorylation of GSK-3{beta} and ERK and Tau phosphorylation at Ser515/Ser516 and Thr212/Ser214 in SK-N-SH cells. A, retroviral expression of WOX1si (in pSuppressorRetro) in SK-N-SH cells suppressed cytosolic WOX1 protein expression in 48 h (duplicate loadings). WOX1si targeted the 3' end of the human WOX1 mRNA (as indicated in Fig. 3). Suppression of WOX1 by siRNA induced phosphorylation of Tau at Ser515/Ser516 and Thr212/Ser214 (AT100 epitope in PHF-Tau). Enhanced phosphorylation of GSK-3{beta} and ERK was observed. E2 (40 nM) had no apparent effect on Tau phosphorylation after treatment of these cells for 30 min. B, as determined by co-immunoprecipitation, an increased binding of phospho-GSK-3{beta} with phospho-Tau in these WOX1 knock-down cells was observed. C, in comparison, ERK-dependent phosphorylation of Ser515/Ser516 was significantly increased in the AD hippocampi compared with age-matched controls. A representative result from eight samples is shown. IgH, IgG heavy chain; IP, immunoprecipitation.

 
Suppression of WOX1 by siRNA increased phosphorylation of Tau at Ser515/Ser516 and Thr212/Ser214 (by ~100%), and this positively correlates with enhanced phosphorylation of GSK-3{beta} and ERK (Fig. 4A). As determined by co-immunoprecipitation, there was an increased binding of phosphorylated GSK-3{beta} with phospho-Tau in these WOX1 knock-down cells (Fig. 4B). In comparison, Tau phosphorylation at Ser515/Ser516 in control and AD hippocampi is shown (Fig. 4C).

Phosphorylation of Ser515/Ser516, Thr212, and Ser214 in Tau is mediated by ERK, GSK-3{beta}, and protein kinase A, respectively. Phosphorylation of Thr212/Ser214 was determined using PHF-Tau antibodies (AT100). The Alzheimer-specific AT100 epitope in Tau is present only in its PHF conformation (32–35). Nonetheless little or no phosphorylation of Ser214 was observed in the hippocampi and SK-N-SH cells (data not shown) as determined using specific anti-Ser(P)214 antibodies. A recent study has shown that phosphorylation of Thr212 may affect the subsequent phosphorylation of Ser214 (36). Also Ser214 was not phosphorylated in a P301S Tau transgenic mouse model (37).

E2 protects SK-N-SH cells from apoptosis (25). The above SK-N-SH cells were treated with E2 for 30 min. E2 had no apparent effect on the phosphorylation of Tau in both control and WOX1si-expressing SK-N-SH cells during a short term treatment (Fig. 4A), although it can effectively activate WOX1 in various types of cancer cells.2

Inhibition of Tau Phosphorylation and NFT Formation by PD-98059 and SP600125 in WOX1si-expressing Cells—To further substantiate our observations, we selected a sequence in the WW domain area for siRNA targeting. We established stable transfectants of L929 and SK-N-SH cells expressing the constructed WOX1si (in pSuppressorNeo) or a scrambled siRNA. As expected, knock-down of WOX1 expression significantly induced NFT formation in L929 cells (Fig. 5A). The increased NFT formation was inhibited by exposure of these cells to an MEK1/2 inhibitor, PD-98059, and a JNK inhibitor, SP600125, for 1 h (Fig. 5A). These chemicals also reduced the phosphorylation of Tau at Ser515/Ser516 (Fig. 5B, data not shown for PD-98059). These observations suggest that both ERK and JNK1 participate in the formation of NFTs in these WOX1si-expressing cells. Similarly the above events were also observed in WOX1si-expressing SK-N-SH cells (data not shown).



View larger version (41K):
[in this window]
[in a new window]
  		FIG. 5.
PD-98059 and SP600125 inhibit NFT formation and Tau phosphorylation at Ser515/Ser516 in L929 cells. A, stable transfectants of murine L929 cells, expressing a WOX1si (targeting WW domain) and a scrambled siRNA (in pSuppressorNeo), were established. Knock-down of WOX1 expression induced NFT formation in these cells. The increased NFT formation was blocked by exposure of these cells to an MEK1/2 inhibitor, PD-98059 (40 µM), or a JNK inhibitor, SP600125 (40 µM), for 1 h. B, similarly SP600125 (40 µM, 1 h) blocked the increased Tau phosphorylation at Ser515/Ser516 (35 and 55 kDa, data not shown for the 55-kDa Tau).

 
Ectopic or Endogenous WOX1 Colocalizes with Tau, JNK1, and GSK-3{beta} in Neurons and Cultured Cells—By fluorescence microscopy, endogenous p-WOX1 was shown to colocalize with phospho-JNK1 (p-JNK1) and Ser(P)515/Ser(P)516-Tau in hippocampal neurons from either AD or age-matched control brains (Fig. 6A, top two panels). Similar results were observed by examining the colocalization of p-WOX1 with phospho-GSK-3{beta} or p-JNK1 with Ser(P)515/Ser(P)516-Tau (data not shown). Some neurons in the AD brains possessed colocalized p-WOX1 with Ser(P)515/Ser(P)516-Tau in the NFTs (Fig. 6A, bottom panel). Together these observations suggest that WOX1 physically interacts with both JNK1 and Tau in vivo.



View larger version (29K):
[in this window]
[in a new window]
  		FIG. 6.
Colocalization of endogenous or ectopic WOX1 with JNK1 and Tau in neurons and cultured cells. A, fluorescence microscopy shows colocalization of p-WOX1 with p-JNK1 (at Thr183/Tyr185) and p-Tau (at Ser515/Ser516) in healthy neurons (400x, top and middle panels). Colocalization of p-JNK1 with p-Tau was also observed (data not shown). At a higher magnification (1000x), p-WOX1 colocalized with Ser(P)515/Ser(P)516-Tau in the NFTs of degenerative neurons (bottom panel). B, ectopic GFP-WOX1 colocalized with Tau, p-Tau (at Ser515/Ser516), JNK1, and p-JNK1 (at Thr183/Tyr185) in COS7 cells. In controls, ectopic GFP alone could not colocalize with p-Tau.

 
JNK1 physically interacts with WOX1 and blocks WOX1-mediated apoptosis (10). GSK-3{beta}, cdk5, JNK, p38, ERK1/2, and other kinases phosphorylate Tau in AD (18–24). Ectopic GFP-WOX1 was shown to colocalize with endogenous p-JNK1 and Ser(P)515/Ser(P)516-Tau in COS7 fibroblasts (Fig. 6B). In controls, GFP alone could not colocalize with the endogenous JNK1 and Tau (Fig. 6B, data not shown for JNK1).

WOX1 Binds Phosphorylated Tau (at Thr212/Ser214 and Ser515/Ser516), and E2 Increases the Binding in L929 Cells— Next we determined whether WOX1 physically interacts with Tau in cultured cells. By co-immunoprecipitation using the lysates of L929 fibroblasts, endogenous p-WOX1 physically interacted with a 35-kDa phosphorylated Tau (at Ser515/Ser516 and Thr212/Ser214) in the cytoplasm, and E2 increased the binding interaction (Fig. 7A). WOX1 also bound Tau with phosphorylation at Thr231 (data not shown). Compared with SK-N-SH cells, L929 cells were more responsive to E2-mediated phosphorylation of WOX1 and Tau. E2 also increased the binding of WOX1 with 45- and 55-kDa Tau in SK-N-SH cells (data not shown). Our precipitating antibodies bound p-WOX1, and this protein was also recognized by the pan antibodies against the NH2 terminus of WOX1 (Fig. 7A). Similarly E2 increased the binding of GSK-3{beta} with Tau in L929 cells (Fig. 7B).



View larger version (40K):
[in this window]
[in a new window]
  		FIG. 7.
WOX1 physically interacts with Tau, and E2 increases the binding interaction in L929 cells. A, endogenous p-WOX1 physically interacted with a 35-kDa phospho-Tau (at Ser515/Ser516 and Thr212/Ser214) in the cytoplasm of L929 fibroblasts. E2 at 40 nM increased the binding interaction during 30-min treatment. Co-immunoprecipitation was performed using antibodies against p-WOX1. The precipitated p-WOX1 protein was also recognized by pan antibodies against the NH2 terminus of WOX1. One-tenth (~40 µg) of the total proteins was loaded for SDS-PAGE and Western blotting (see Pre-IP). B, similarly E2 increased the binding of GSK-3{beta} with Tau in L929 cells. IgH, IgG heavy chain; IP, immunoprecipitation.

 
The COOH-terminal ADH/SDR Domain of WOX1 Physically Interacts with Tau—We mapped the domain of WOX1 that interacts with Tau. As determined by a Ras rescue-based yeast two-hybrid analysis in the cytoplasm (7, 10), the full-length murine WOX1 interacted with Tau in yeast (Fig. 8). This human TAU clone (GenBankTM accession number BC000558 [GenBank] ) possesses three repeats of the microtubule-binding domain. However, the NH2-terminal WW domains alone could not interact with Tau (Fig. 8). Failure of the WW domains binding with Tau was not due to its Tyr33 phosphorylation. Alteration of Tyr33 to Arg33 could not induce binding of the WW domains with Tau. The ADH/SDR domain alone physically interacted with Tau. Thus, these observations indicate that the COOH-terminal ADH/SDR domain of WOX1 is responsible for interacting with Tau.



View larger version (49K):
[in this window]
[in a new window]
  		FIG. 8.
COOH-terminal ADH/SDR domain of WOX1 physically interacts with Tau. Mapping of the binding of WOX1 with Tau was performed by a Ras rescue-based yeast two-hybrid analysis (7, 10). In positive controls, there were binding interactions of p53/WOX1 (7) and MafB self-binding interaction as revealed by the growth of mutant cdc25H yeast at 37 °C using a selective galactose-agarose plate. In negative controls, no binding interactions were observed for empty vectors. The full-length murine WOX1 interacted with human Tau via its COOH-terminal ADH/SDR but not NH2-terminal WW domain in yeast. This human Tau clone possesses three repeats of the microtubule-binding domain (open ovals). Failure of the WW domains interacting with Tau was not due to its Tyr33 phosphorylation. Alteration of Tyr33 to Arg33 could not induce binding of the WW domains with Tau.

 
In positive controls, there were binding interactions of p53/WOX1 (7, 10) and MafB self-binding interaction (Fig. 8). In negative controls, no binding interactions were observed for empty vectors (Fig. 8).


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
In this study, we demonstrated that WOX1, p-WOX1, and WOX2 were down-regulated in the AD hippocampi. This down-regulation correlates negatively with significant increases in phosphorylation of Tau (at Thr212/Thr231, Ser515/Ser516, and other sites), enhanced GSK-3{beta} phosphorylation, and NFT formation in this brain area. Remarkably, in parallel with these clinical findings, we determined that suppression of WOX1 expression by siRNA in SK-N-SH cells spontaneously induced Tau phosphorylation at Thr212/Thr231 and Ser515/Ser516 and NFT formation, indicating that WOX1 participates in the regulation of Tau phosphorylation in vivo.

We generated specific antibodies against the COOH-terminal amino acid sequences of human WOX1 and WOX2 and the NH2 terminus of murine WOX1 (7). The antibodies recognized expected protein bands of 46-kDa WOX1 and 41-kDa WOX2 in the human brain extracts. The WOX1 antibodies are expected to interact with a truncated 26-kDa WWOXv4 (according to GenBankTM nomenclature; for a review, see Ref. 11). However, we could not identify this protein in the brains. The COOH-terminal amino acid sequence of WOX2 is unique, and the antibodies generated did not interact with other WWOX/FOR/WOX1 family proteins. By using these antibodies in Western blotting and immunohistochemistry, we convincingly showed the significant down-regulation of WOX1 and WOX2 expression in the AD hippocampi as compared with age-matched controls. In addition, we determined that p-WOX1 was significantly down-regulated in the AD hippocampi. Functional significance of this down-regulation is unknown. WOX1 activation involves Tyr33 phosphorylation and subsequent nuclear translocation (10, 11). Ectopic WOX1 induces apoptosis in the nuclear level (7, 10). Whether endogenously activated WOX1 initiates apoptosis in the nucleus is unknown. However, we believe that during neuronal degeneration, WOX1 undergoes Tyr33 phosphorylation and nuclear translocation and participates in the apoptosis of neuronal cells. The notion is supported by 1-methyl-4-phenylpyridium intoxication of striatum, which shows a rapid WOX1 activation via Tyr33 phosphorylation followed by nuclear translocation and colocalization with nuclear p53 in damaged neurons.3 Presumably, reduction of Tyr33 phosphorylation in WOX1 indicates a postactivation stage of WOX1 in degenerated neurons.

NFT and neuron numbers, but not amyloid load, are critical in predicting cognitive status in Alzheimer's disease (38). NFTs are present mostly in the CA1, entorhinal cortex, and area 9 (38–42). Neurons in CA4 and CA3 areas are less affected in AD patients, while neuronal loss, in association with NFTs and granulovacuolar degeneration, is found mostly in the CA2, CA1, and the entorhinal regions (38–42). The immunoreactivity of WOX1 and WOX2 appears to be maximally expressed in the neurons of CA4 and CA3 regions but is progressively reduced in the neurons of CA2, CA1, and entorhinal cortex of both control and AD hippocampi (see Supplemental Figs. 1–3). That is, an increased NFT formation in a specific hippocampal region correlates negatively with the levels of WOX1 and WOX2.

There are six isoforms of Tau in human brains, and the microtubule-binding repeat region plays an important role in Tau polymerization (for a review, see Ref. 17). However, regions outside the microtubule-binding repeat, such as exons 2 and 3 and the COOH-terminal tail, can greatly influence its polymerization. Recently the NH2 terminus of Tau has also been shown to regulate tangle formation (43). Abnormal polymerization of mutant Tau into insoluble filaments contributes to neurodegeneration in AD (44–46). Numerous enzymes are involved in Tau hyperphosphorylation, and cdk5 and GSK-3{beta} appear to play a dominant role in Tau pathology (18–24). Aberrant cdk5 activation by p25 induces neurodegeneration and tangle formation (47). Nonetheless brain levels of cdk5 activator p25 are not increased in Alzheimer's or other neurodegenerative diseases with neurofibrillary tangles (48).

We have exhaustively examined Tau phosphorylation in the AD hippocampi versus age-matched normal controls using a panel of specific antibodies against phospho-Tau (see Supplemental Figs. 1–3). GSK-3{beta}-dependent phosphorylation of Tau at Thr181/Thr212/Thr231 and Ser404, but not at Ser262/Ser396, was significantly increased. Also phosphorylation of GSK-3{beta}/cdk5-dependent Thr205/Ser202 and ERK-dependent Ser422/Ser515/Ser516 was significantly increased. In contrast, protein kinase A-dependent phosphorylation of Ser214/Ser409 was barely detectable in both controls and AD. The sizes of these phosphorylated Tau proteins are normally from 35 to 75 kDa or even larger, suggesting that polymerization of Tau up to certain sizes is needed for phosphorylation at certain residues. In parallel, NFT formation and phosphorylation of GSK-3{beta} were also increased in the AD hippocampi.

Remarkably, when WOX1 expression was knocked down by siRNA in SK-N-SH cells, endogenous Tau in these cells became phosphorylated selectively at Thr212/Thr231 and Ser202/Ser515/Ser516 along with enhanced phosphorylation of GSK-3{beta} and ERK and NFT formation (data not shown for Ser202 phosphorylation). These events are specific. We knocked down WOX1 expression using siRNA against both the 3' end and the WW domain area of WOX mRNA. Phosphorylation of these sites in Tau is also found in the AD hippocampi. SK-N-SH cells appear to express four isoforms of Tau (35, 55, 60, and 100 kDa). The 120-kDa Tau (with Thr212 phosphorylation) in the WOXsi and/or anisomycin-treated SK-N-SH cells corresponds to a soluble NFT form of the same size, suggesting that Thr212 is phosphorylated when Tau is polymerized to this size.

Thr231 phosphorylation was increased in a 55-kDa, but not a 100-kDa, Tau in the WOXsi-expressing cells. In addition, phosphorylation at Thr212/Ser202 was shown in a 120-kDa Tau. Nonetheless phosphorylation of Ser214, a site of the AT100 epitope (Thr212/Ser214) in Tau (32–35), was not observed both in the AD hippocampi and in the WOXsi-expressing SK-N-SH cells. These data suggest that, when Tau is in a specific conformation, certain sites can readily undergo phosphorylation, whereas other sites resist phosphorylation. It has been determined that phosphorylation of Thr212 may affect the subsequent phosphorylation of Ser214 (36). Indeed Ser214 was not phosphorylated in a P301S Tau transgenic model (37).

Stress-induced JNK activation is involved in the Tau hyperphosphorylation and pathology of AD (23, 49). Our data clearly demonstrate that Tau phosphorylation at Thr231 and Thr212 can be mediated by both GSK-3{beta} and JNK1. Thus, these enzymes and perhaps others could phosphorylate these sites in a nonspecific manner. Inhibition of JNK1 activity by SP600125 (a JNK inhibitor) abolished NFT formation and phosphorylation of Ser515/Ser516 and Thr212/Thr231 (data not shown for Thr212/Thr231). Similarly suppression of ERK activity by PD-98059 blocked NFT formation and ERK-dependent Ser515/Ser516 phosphorylation.

Heat shock also induces Tau hyperphosphorylation. It is of interest to note that molecular chaperones or heat shock proteins Hsp70, Hsp90, and Hsp27 reduce phosphorylation but promote solubility and binding of Tau to microtubules, thereby increasing cell survival (50, 51). Also CHIP (carboxyl terminus of the Hsc70-interacting protein) and Hsp70 regulate Tau ubiquitination, degradation, and aggregation and enhance cell survival (52, 53).

Phosphorylated ERK, p38, JNK1, and calmodulin kinase II are differentially expressed in Tau deposits in neurons and glial cells in tauopathies (18, 19). We determined that WOX1 physically interacted with Tau, JNK1, and GSK-3{beta} in the extracts of rat brains and cultured cells (data not shown for rat brains). Thus, WOX1 is likely to prevent phosphorylation of Tau by JNK1, GSK-3{beta}, and other enzymes in vivo. This notion is supported by the observation that WOX1 bound Tau via its COOH-terminal ADH/SDR domain. Our preliminary data show that ectopic expression of this domain suppressed E2-induced Tau phosphorylation at Thr212/Ser214 and Ser515/Ser516. The ADH/SDR domain possesses a conserved NSYK motif that may bind substrates such as E2 and other sex hormones (11). Estrogen is protective against neuronal death (25–28). E2 induces cytosolic Tau expression during 24-h treatment of human SH-SY5Y neuroblastoma cells (56), induces differentiation of a neuronal cell line (57), but cannot change Tau expression in rat brains (58). In this study, we determined that during a short term treatment for less than 1 h, E2 enhanced the binding of WOX1 with phosphorylated Tau at Thr212/Ser214 and Ser515/Ser516 and GSK-3{beta} with Tau and WOX1 in L929 cells. However, E2 may increase Tau phosphorylation during treatment for longer than 1 h (data not shown). Accordingly, WOX1 is likely to prevent further enzyme-mediated Tau phosphorylation. The functional role of WOX1 in preventing E2-increased Tau phosphorylation in vivo remains to be established.

Finally, both WOX1 and prolyl isomerase PIN1 interact with phosphorylated or activated p53 (on (Ser/Thr)-Pro motifs) during DNA damage (for a review, see Ref. 11). PIN1 possesses an NH2-terminal WW domain and a COOH-terminal isomerase domain. The WW domain in PIN1 binds to phosphorylated p53 on the (Ser/Thr)-Pro motifs and the polyproline region. This type of binding is similar to that of the WOX1 interaction with p53 (7, 11). PIN1 binds (via its WW domain) and colocalizes with Thr231-phosphorylated Tau in Alzheimer's disease and other tauopathies (42, 54, 59). In contrast, WOX1 binds Tau through its ADH/SDR domain. Like WOX1, PIN1 expression is inversely correlated with predicted neuronal vulnerability and actual neurofibrillary degeneration in Alzheimer's disease (55). A transgenic PIN1 mouse model shows that PIN1 is able to protect against age-dependent neurodegeneration (55). In summary, our study demonstrated that WOX1 binds Tau via its ADH/SDR domain and is likely to prevent E2- and enzyme-mediated Tau phosphorylation in vivo. Down-regulation of WOX1 in the AD neurons induces Tau hyperphosphorylation and subsequent NFT formation, indicating a protective role of WOX1 in neurodegeneration.


   FOOTNOTES
 
* This work was supported by the National Institutes of Health (to C.-I. S., co-principal investigator with Lynn Heasley) and by the American Heart Association and Department of Defense Grant DAMD17-03-1-0736 (to N.-S. C.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

The on-line version of this article (available at http://www.jbc.org) contains Supplemental Figs. 1-3. Back

|| Supported by Ministry of Education, Taiwan, Republic of China Grant 91-B-FA09-1-4. Visting scientist from the National Cheng Kung University Medical College, Tainam, Taiwan. Back

** To whom correspondence should be addressed. Fax: 570-882-4643; E-mail: chang_nanshan{at}guthrie.org.

1 The abbreviations used are: AD, Alzheimer's disease; WOX1, WW domain-containing oxidoreductase; JNK, c-Jun NH2-terminal kinase; GSK-3{beta}, glycogen synthase kinase 3{beta}; siRNA, small interfering RNA; NFT, neurofibrillary tangle; p-WOX1, Tyr33-phosphorylated WOX1; WOX1si, siRNA-targeting WOX1; ADH/SDR, short-chain alcohol dehydrogenase/reductase; E2, 17{beta}-estradiol; PHF-Tau, paired helical filaments of Tau; ERK, extracellular signal-regulated kinase; cdk5, cyclin-dependent kinase 5; MEK, mitogen-activated protein kinase/extracellular signal-regulated kinase kinase; p-, phospho-; GFP, green fluorescent protein. Back

2 N.-S. Chang, L. Schultz, and C.-I. Sze, unpublished. Back

3 S. T. Chen, J. I. Chuang, M. Y. Li, and N.-S. Chang, submitted. Back


   ACKNOWLEDGMENTS
 
We are indebted to the patients and families who donated the brains to the University of Colorado Health Sciences Center Brain Bank to make this study possible. We thank Lisa Lizenberger for kind assistance with photographs and figures preparation and Terri Zimmer for antibody production in rabbits. Development of specific antibodies against WOX1/FOR2 and WOX2/FOR1 was a joint effort of the laboratories of Nan-Shan Chang (Guthrie Research Institute) and Robert I. Richards (University of Adelaide, Adelaide, Australia).



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Kitamura, Y., Shimohama, S., Kamoshima, W., Matsuoka, Y., Nomura, Y., and Taniguchi, T. (1997) Biochem. Biophys. Res. Commun. 232, 418-421[CrossRef][Medline] [Order article via Infotrieve]
  2. De La Monte, S.M., Sohn, Y. K., and Wands, J. R. (1997) J. Neurol. Sci. 152, 73-83[CrossRef][Medline] [Order article via Infotrieve]
  3. Rohn, T. T., Head, E., Nesse, W. H., Cotman, C. W., and Cribbs, D. H. (2001) Neurobiol. Dis. 8, 1006-1016[CrossRef][Medline] [Order article via Infotrieve]
  4. Morishima, Y., Gotoh, Y., Zeig, J., Barret, T., Takano, H., Flavell, R., Davis, R. J., Shirasaki, Y., and Greenberg, M. E. (2001) J. Neurosci. 21, 7551-7560[Abstract/Free Full Text]
  5. Jellinger, K. A. (2001) J. Cell. Mol. Med. 5, 1-17[Medline] [Order article via Infotrieve]
  6. Mattson, M. P. (2000) Nat. Rev. Mol. Cell. Biol. 1, 120-129[CrossRef][Medline] [Order article via Infotrieve]
  7. Chang, N.-S., Pratt, N., Heath, J., Schultz, L., Sleve, D., Carey, G. B., and Zevotek, N. (2001) J. Biol. Chem. 276, 3361-3370[Abstract/Free Full Text]
  8. Richards, R. I. (2001) Trends Genet. 17, 339-345[CrossRef][Medline] [Order article via Infotrieve]
  9. Chang, N.-S. (2002) Int. J. Mol. Med. 9, 19-24[Medline] [Order article via Infotrieve]
  10. Chang, N.-S., Doherty, J., and Ensign, A. (2003) J. Biol. Chem. 278, 9195-9202[Abstract/Free Full Text]
  11. Chang, N.-S., Doherty, J., Ensign, A., Lewis, J., Heath, J., Schultz, L., Chen, S. T., and Oppermann, U. (2003)Biochem. Pharmacol. 66, 1347-1354[CrossRef][Medline] [Order article via Infotrieve]
  12. Driouch, K., Prydz, H., Monese, R., Johansen, H., Lidereau, R., and Frengen, E. (2002) Oncogene 21, 1832-1840[CrossRef][Medline] [Order article via Infotrieve]
  13. Bednarek, A. K., Keck-Waggoner, C. L., Daniel, R. L., Laflin, K. J., Bergsagel, P. L., Kiguchi, K., Brenner, A. J., and Aldaz, C. M. (2001) Cancer Res. 61, 8068-8073[Abstract/Free Full Text]
  14. Paige, A. J., Taylor, K. J., Taylor, C., Hillier, S. G., Farrington, S., Scott, D., Porteous, D. J., Smyth, J. F., Gabra, H., and Watson, J. E. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 11417-11422[Abstract/Free Full Text]
  15. Watanabe, A., Hippo, Y., Taniguchi, H., Iwanari, H., Yashiro, M., Hirakawa, K., Kodama, T., and Aburatani, H. (2003) Cancer Res. 63, 8629-8633[Abstract/Free Full Text]
  16. Chen, S. T., Chuang, J. I., Wang, J. P., Tsai, M. S., Li, H., and Chang, N.-S. (2004) Neuroscience 124, 831-839[CrossRef][Medline] [Order article via Infotrieve]
  17. Ried, K., Finnis, M., Hobson, L., Mangelsdorf, M., Dayan, S., Nancarrow, J. K., Woollatt, E., Kremmidiotis, G., Gardner, A., Venter, D., Baker, E., and Richards, R. I. (2000) Hum. Mol. Genet. 9, 1651-1663[Abstract/Free Full Text]
  18. Ferrer, I., Blanco, R., Carmona, M., and Puig, B. (2001) J. Neural Transm. 108, 1397-1415[CrossRef][Medline] [Order article via Infotrieve]
  19. Pei, J. J., Braak, E., Braak, H., Grundke-Iqbal, I., Iqbal, K., Winblad, B., and Cowburn, R. F. (2001) J. Alzheimer's Dis. 3, 41-48[Medline] [Order article via Infotrieve]
  20. Zhu, X., Raina, A. K., Rottkamp, C. A., Aliev, G., Perry, G., Boux, H., and Smith, M. A. (2001) J. Neurochem. 76, 435-441[CrossRef][Medline] [Order article via Infotrieve]
  21. Kaytor, M. D., and Orr, H. T. (2002) Curr. Opin. Neurobiol. 12, 275-278[CrossRef][Medline] [Order article via Infotrieve]
  22. Liu, F., Iqbal, K., Grundke-Iqbal, I., and Gong, C. X. (2002) FEBS Lett. 530, 209-214[CrossRef][Medline] [Order article via Infotrieve]
  23. Morishima-Kawashima, M., and Ihara, Y. (2002) J. Neurosci. Res. 70, 392-401[CrossRef][Medline] [Order article via Infotrieve]
  24. Noble, W., Olm, V., Takata, K., Casey, E., Mary, O., Meyerson, J., Gaynor, K., LaFrancois, J., Wang, L., Kondo, T., Davies, P., Burns, M., Veeranna., Nixon, R., Dickson, D., Matsuoka, Y., Ahlijanian, M., Lau, L. F., and Duff, K. (2003) Neuron 38, 555-565[CrossRef][Medline] [Order article via Infotrieve]
  25. Ba, F., Pang, P. K., Davidge, S. T., and Benishin, C. G. (2004) Neurochem. Int. 44, 401-411[CrossRef][Medline] [Order article via Infotrieve]
  26. Belcredito, S., Vegeto, E., Brusadelli, A., Ghisletti, S., Mussi, P., Ciana, P., and Maggi, A. (2001) Brain Res. Brain Res. Rev. 37, 335-342[CrossRef][Medline] [Order article via Infotrieve]
  27. Greenfield, J. P., Leung, L. W., Cai, D., Kaasik, K., Gross, R. S., Rodriguez-Boulan, E., Greengard, P., and Xu, H. (2002) J. Biol. Chem. 277, 12128-12136[Abstract/Free Full Text]
  28. Bonnefont, A. B., Munoz, F. J., and Inestrosa, N. C. (1998) FEBS Lett. 441, 220-224[CrossRef][Medline] [Order article via Infotrieve]
  29. Bennett, B. L., Sasaki, D. T., Murray, B. W., O'Leary, E. C., Sakata. S. T., Xu, W., Leisten, J. C., Motiwala, A., Pierce, S., Satoh, Y., Bhagwat, S. S., Manning, A. M., and Anderson, D. W. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 13681-13686[Abstract/Free Full Text]
  30. Mirra, S. S., Heyman, A., McKeel, D., Sumi, S. M., Brownlee, L. M., Vogel, F. S., Hughes, J. P., Van Belle, G., and Berg, L. (1991) Neurology 41, 479-486[Abstract/Free Full Text]
  31. Pugazhenthi, S., Nesterova, A., Sables, C., Heidenreich, K. A., Boxer, L. M., Heasley, L. E., and Reusch, J. E. B. (2000) J. Biol. Chem. 275, 10761-10766[Abstract/Free Full Text]
  32. Mailliot, C., Bussiere, T., Hamdane, M., Sergeant, N., Caillet, M. L., Delacourte, A., and Buee, L. (2000) Ann. N. Y. Acad. Sci. 920, 107-114[Abstract/Free Full Text]
  33. Zheng-Fischhofer, Q., Biernat, J., Mandelkow, E. M., Illenberger, S., Godemann, R., and Mandelkow, E. (1998) Eur. J. Biochem. 252, 542-552[Medline] [Order article via Infotrieve]
  34. Goedert, M., Jakes, R., Crowther, R. A., Cohen, P., Vanmechelen, E., Vandermeeren, M., and Cras, P. (1994) Biochem. J. 301, 871-877
  35. Paudel, H. K., Lew, J., Ali, Z., and Wang, J. H. (1993) J. Biol. Chem. 268, 23512-23518[Abstract/Free Full Text]
  36. Ksiezak-Reding, H., Pyo, H. K., Feinstein, B., and Pasinetti, G. M. (2003) Biochim. Biophys. Acta 1639, 159-168[Medline] [Order article via Infotrieve]
  37. Allen, B., Ingram, E., Takao, M., Smith, M. J., Jakes, R., Virdee, K., Yoshida, H., Holzer, M., Craxton, M., Emson, P. C., Atzori, C., Migheli, A., Crowther, R. A., Ghetti, B., Spillantini, M. G., and Goedert, M. (2002) J. Neurosci. 22, 9340-9351[Abstract/Free Full Text]
  38. Giannakopoulos, P., Herrmann, F. R., Bussiere, T., Bouras, C., Kovari, E., Perl, D. P., Morrison, J. H., Gold, G., and Hof, P. R. (2003) Neurology 60, 1495-1500[Abstract/Free Full Text]
  39. Takayama, N., Iseki, E., Yamamoto, T., and Kosaka, K. (2002) Neuropathology 22, 147-153[Medline] [Order article via Infotrieve]
  40. Fukutani, Y., Cairns, N. J., Shiozawa, M., Sasaki, K., Sudo, S., Isaki, K., and Lantos, P. L. (2000) Psychiatry Clin. Neurosci. 54, 523-529[Medline] [Order article via Infotrieve]
  41. Casanova, M. F., Carosella, N. W., Gold, J. M., Kleinman, J. E., Weinberger, D. R., and Powers, R. E. (1993) Psychiatry Res. 49, 41-62[CrossRef][Medline] [Order article via Infotrieve]
  42. Holzer, M., Gartner, U., Stobe, A., Hartig, W., Gruschka, H., Bruckner, M. K., and Arendt, T. (2002) Acta Neuropathol. 104, 471-481[Medline] [Order article via Infotrieve]
  43. Gamblin, T. C., Berry, R. W., and Binder, L. I. (2003) Biochemistry 42, 2252-2257[CrossRef][Medline] [Order article via Infotrieve]
  44. Tatebayashi, Y., Miyasaka, T., Chui, D. H., Akagi, T., Mishima, K., Iwasaki, K., Fujiwara, M., Tanemura, K., Murayama, M., Ishiguro, K., Planel, E., Sato, S., Hashikawa, T., and Takashima, A. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, 13896-13901[Abstract/Free Full Text]
  45. Tanemura, K., Akagi, T., Murayama, M., Kikuchi, N., Murayama, O., Hashikawa, T., Yoshiike, Y., Park, J. M., Matsuda, K., Nakao, S., Sun, X., Sato, S., Yamaguchi, H., and Takashima, A. (2001) Neurobiol. Dis. 8, 1036-1045[CrossRef][Medline] [Order article via Infotrieve]
  46. Lewis, J., Dickson, D. W., Lin, W. L., Chisholm, L., Corral, A., Jones, G., Yen, S. H., Sahara, N., Skipper, L., Yager, D., Eckman, C., Hardy, J., Hutton, M., and McGowan, E. (2001) Science 293, 1487-1491[Abstract/Free Full Text]
  47. Cruz, J. C., Tseng, H. C., Goldman, J. A., Shih, H., and Tsai, L. H. (2003) Neuron 40, 471-483[CrossRef][Medline] [Order article via Infotrieve]
  48. Tandon, A., Yu, H., Wang, L., Rogaeva, E., Sato, C., Chishti, M. A., Kawarai, T., Hasegawa, H., Chen, F.