Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M403171200 on June 1, 2004

J. Biol. Chem., Vol. 279, Issue 31, 32979-32988, July 30, 2004
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
279/31/32979    most recent
M403171200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Araki, S.
Right arrow Articles by Machida, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Araki, S.
Right arrow Articles by Machida, Y.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Mitotic Cyclins Stimulate the Activity of c-Myb-like Factors for Transactivation of G2/M Phase-specific Genes in Tobacco*

Satoshi Araki{ddagger}§, Masaki Ito¶||, Takashi Soyano{ddagger}, Ryuichi Nishihama{ddagger}, and Yasunori Machida{ddagger}

From the {ddagger}Division of Biological Science, Graduate School of Science, Nagoya University, Furo-cho, Chikusa-ku, Nagoya 464-8602, Japan and the Department of Biological Sciences, Graduate School of Science, University of Tokyo, Hongo 7-3-1, Tokyo 113-0033, Japan

Received for publication, March 22, 2004 , and in revised form, May 26, 2004.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Myb transcription factors, which contain three imperfect repeats in the Myb domain, are evolutionarily conserved members of the Myb superfamily. Vertebrate Myb proteins with three repeats, c-Myb, A-Myb, and BMyb, play important roles at the G1/S transition in the cell cycle. In plants, this type of Myb protein controls the G2/M phase by activating or repressing the transcription of cyclin B genes and a variety of other G2/M phase-specific genes. In tobacco, two genes for Myb activators, NtmybA1 and NtmybA2, are transcriptionally controlled and are expressed specifically at the G2/M phase. As we showed here, in addition to the control at the transcriptional level, activity of NtmybA2 is also controlled at the post-translational level. We found that the transactivation potential of NtmybA2 is repressed by a regulatory domain located at its carboxyl terminus and that specific classes of cyclins A and B enhanced NtmybA2 activity possibly by relieving this inhibitory effect. Mutations at the 20 potential sites of phosphorylation by cyclin-dependent kinase (CDK) in NtmybA2 blocked the enhancing effects of the cyclins on NtmybA2 activity. Recombinant NtmybA2 was phosphorylated in vitro by a CDK fraction prepared from tobacco BY2 cells. The kinase activity for NtmybA2 in the CDK fraction was cell cycle-regulated in BY2 cells, peaking at the G2/M phase when the level of transcripts of cyclin B is maximal. Taken together, our data suggest that NtmybA2 is phosphorylated by a specific cyclin/CDK complex(es) at G2/M and that this phosphorylation removes the inhibitory effect of its C-terminal region, thereby activating NtmybA2 specifically at G2/M.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
In the eukaryotic cell cycle, molecular events occur in a well-defined and reproducible sequence. The periodic activation at the transcriptional level of genes that regulate the cell cycle is fundamental to this process. In animals, transcription of several genes induced at the G1/S transition is mainly controlled by the E2F/DP heterodimeric transcription factors (for review, see Ref. 1). E2F-binding sequences are found in promoters from many genes that are transcribed at around the time of G1/S transition. Both E2F and DP factors have recently been identified in plants (for review, see Ref. 2), and some reports indicate that plant E2F/DP factors play a role at the G1/S transition (3, 4). By contrast, different mechanisms for G2/M phase-specific transcription have been proposed in plants and animals. In animal cells, G2/M phase-specific transcription is mainly regulated by two repressor elements known as cell cycle-dependent elements (CDE) and cell cycle gene homology region (CHR) (for review, see Ref. 5). These elements are found in the promoters of various G2/M phase-specific genes, which include cdc25C (6), polo-like kinase (7), aurora A (8), and cyclin B2 (9). Mutation of the CDE and CHR elements allows elevated transcription during G1 and consequent loss of cell cycle-regulated expression. In plants, G2/M phase-specific genes do not contain these repressor elements; instead, they contain a common cis element called the M phase-specific activator sequence (MSA),1 which is necessary and sufficient for the G2/M phase-specific activation of promoters (10, 11). We showed previously that members of a group of Myb transcription factors bind to MSA elements and regulate transcription by activating or repressing promoter activity (12).

The Myb family of proteins is characterized by a consecutively repeated and conserved domain of ~50 amino acids, which is known as the Myb domain. Vertebrates have three Myb genes, c-Myb, A-Myb, and B-Myb; all three of them encode three repeats of the Myb domain (for review, see in Ref. 13). These repeats are often designated R1, R2, and R3. Each of the Myb repeats is more closely related to other member of Myb family proteins than to other repeats within the same protein (14). By contrast, plants have much larger numbers of Myb genes, for example, the Arabidopsis genome contains more than 130 Myb genes. However, most plant Myb proteins contain only two repeats, which correspond to vertebrate R2 and R3 (for review, see Ref. 15). Thus, such plant Myb proteins are often called R2R3-Myb. We recently identified three Myb proteins, NtmybA1, NtmybA2, and NtmybB, that bind to the MSA motif in tobacco (12). These Myb proteins contain three repeats (R1, R2, and R3), and each repeat is more closely related to the vertebrate Myb repeats than to the repeats from plant R2R3-Myb proteins. Thus, Myb proteins with three repeats from plants and animals constitute an evolutionarily conserved group in the Myb superfamily, and they are referred to collectively herein as three-repeat Myb (3Rmyb) proteins. Closely related 3Rmyb proteins are also found in Drosophila melanogaster and the slime mold Dictyostelium discoideum, but they are not found in the nematode Caenorhabditis elegans or in budding yeast (16). Animals do not have Myb proteins that are related to plant R2R3-Myb proteins.

In mammalian cells, all three known 3Rmyb proteins seem to play an important role in regulation of the cell cycle, acting specifically at the G1/S transition (for review, see Ref. 13). Unlike 3Rmyb proteins in mammals, 3Rmyb proteins in plants control G2/M phase by regulating the transcription of G2/M phase-specific genes, such as cyclin B genes. A similar role at the G2/M phase was also reported for a 3Rmyb protein in D. melanogaster (17). In plants, a wide range of G2/M phase-specific genes seem to be regulated by 3Rmyb proteins. A recent analysis of the Arabidopsis transcriptome, using a DNA tip, revealed that 93 of 8,250 genes tested showed G2/M phase-specific expression, with kinetics of expression similar to those of cyclin B genes (18). Among these 93 genes, ~20% include MSA consensus sequence YCYAACGGYY (where Y indicates C or T) in the promoter region, defined as the 1-kb region upstream of the site of initiation of translation. The tobacco NACK1 gene is the best-characterized example in this group of plant genes. The G2/M phase-specific transcription of NACK1 is dependent on the two MSA motifs in its promoter region (12). NACK1 is an M phase-specific kinesin-like protein that has been identified as an activator of NPK1, a mitogen-activated protein kinase kinase kinase that is required for formation of the cell plate during cytokinesis in tobacco (19).

The two 3Rmyb proteins in tobacco, NtmybA1 and NtmybA2, are structurally related to each other and function as transcriptional activators, whereas NtmybB, with a less closely related structure, also binds to the MSA element but functions as a competitive repressor (12). We showed that both cyclin B and NACK1 promoters were activated by NtmybA1 and NtmybA2 and were repressed by NtmybB in cotransfection experiments. Levels of NtmybA1 and NtmybA2 transcripts oscillate during the cell cycle and are maximal at the G2/M phase, just before the level of transcripts of the cyclin B and NACK1 genes reach a maximum. By contrast, the level of the NtmybB transcript remains almost constant throughout the cell cycle (12). Thus, it seems plausible that transcription of G2/M phase-specific genes might be regulated by a balance between activation and repression by 3Rmyb proteins, which is further regulated by transcriptional control of NtmybA1 and NtmybA2 genes themselves. We report here that another level of regulation is operational for the cell cycle-regulated activities of NtmybA1 and NtmybA2. We show that the transactivation potential of NtmybA2 is repressed by the protein's own C-terminal region and that cyclin-dependent kinases (CDKs) seem able to relieve this inhibitory effect, most probably via the direct phosphorylation of NtmybA2. Our results indicate that the G2/M phase-specific activities of NtmybA2 and, possibly, NtmybA1 are controlled by multiple mechanisms.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Plant Material and Synchronization of Cells—Maintenance and synchronization of tobacco (Nicotiana tabacum) BY2 cells were performed as described previously (20, 21). In brief, BY2 cells were synchronized by treatment with aphidicolin (5 mg/liter; Wako, Osaka, Japan) for 24 h and subsequent washing with fresh medium to release the aphidicolin block. Mitotic indices were determined by examining cells that had been stained with a 1% solution of orcein in a mixture (1:1; v/v) of lactic acid and propionic acid.

Construction of Plasmids—The reporter plasmid containing the NACK1 promoter fused to a luciferase (LUC) reporter gene (NACK1p-LUC) was described previously (12). The 4xGAL4-LUC reporter plasmid contains four copies of a GAL4-responsive element upstream of a LUC reporter gene and has been described elsewhere (22). The expression plasmid for full-length NtmybA2 (pJIT-NtmybA2) was constructed by inserting NtmybA2 cDNA at a SalI site located downstream of the double Cauliflower mosaic virus (CaMV) 35 S promoter in pJIT60 (23). A series of C-terminally truncated versions of NtmybA2, namely {Delta}187, {Delta}242, {Delta}568, {Delta}630, and {Delta}704, was generated by PCR from pJIT-NtmybA2 using a sense primer that corresponded to the sequence TATCCTTCGCAAGACCCTTC in the pJIT-60 vector, and the following antisense primers, which include SalI sites and stop codons: CCGTCGACTACTTTTTGACGGAACTATTCC (for {Delta}187), CCGTCGACTAGCATTCTGAAGCTTCCTCC (for {Delta}242), CCGTCGACTATATGCTCGAATTTTCGTTCAC (for {Delta}568), CCGTCGACTACCACAGCCTAAATGGAGTA (for {Delta}630), and CCGTCGACTATGCAGCCTCGTCAAACATAA (for {Delta}704). For construction of expression plasmids for each truncated protein, amplified fragments were digested with SalI and cloned at the SalI site that is located downstream of the CaMV 35S promoter in pJIT60. The expression plasmid for another C-terminally truncated protein, {Delta}412, was constructed by cloning the EcoRI/SalI fragment of pJIT-NtmybA2 at the EcoRI/SalI sites of pJIT60.

Plasmid pGAL4/1xVP16 encodes the DNA binding domain of yeast GAL4 (GAL4DBD) fused to the activation domain of viral protein 16 (VP16) from herpes simplex virus downstream of the double CaMV35S promoter (22). This plasmid was used as the expression plasmid for the GAL4-VP16 fusion protein. A variant of NtmybA2 lacking the N-terminally located Myb domain (NtmybA2{Delta}MD) and the C-terminally truncated version (NtmybA2{Delta}MD{Delta}C) of this variant were generated by PCR from pJIT-NtmybA2 using the sense primer CCGGATCCTAGTTCCGTCAAAAAGAAATTGGACTC, which contains a BamHI site, and the following antisense primers, which include SalI sites and stop codons: CCGTCGACAAGTTCTACCTTGAAAGGACTTGC (for NtmybA2{Delta}MD) and CCGTCGACCTAGACGGCATCTGTACTTCCATC (for NtmybA2{Delta}-MD{Delta}C). For construction of expression plasmids for two GAL4 fusion proteins, GAL4-NtmybA2{Delta}MD and GAL4-NtmybA2{Delta}MD{Delta}C, amplified fragments were digested with BamHI and SalI and cloned at the BamHI/SalI sites of pGAL4/1xVP16, replacing the fragment that encoded the VP16 activation domain.

Mutations in NtmybA2 at putative sites of phosphorylation by CDK were introduced by PCR using pJIT-NtmybA2 or its mutant derivatives as template. Primers were designed to encode changes from serine to alanine or threonine to alanine. A DNA fragment containing mutations T973A and S1032A was generated by PCR using the sense primer CGGGATCCCTACCTGCAACCTTTCAATAGGTAGGAGGAAGGAGCTGAAAAG and the antisense primer GACTGCAGGGGCATTTGCAGACGCACAGGAGGTCTTGGGAGGTGAAGCTCCAG. The amplified fragment, incorporating the mutations, was digested with PstI and BamHI and cloned at the PstI/BamHI sites of pJIT-NtmybA2, replacing the original PstI/BamHI fragment of pJIT-NtmybA2. To introduce mutations S906A and S912A, a sense primer, ATGAACCATGGAGCTTTCCAAGCTGAAGGAGCTTC, and an antisense primer, ATTTGCGCTCCTCGTATACGTG, were used for PCR, and the amplified fragment was digested with AccI and NcoI and cloned at the AccI/NcoI sites of pJITNtmybA2, replacing the original AccI/NcoI fragment. For mutagenesis of S849A, the sense primer GTCTTTCTTTCCACGTATACGAGGAGCGCA and the antisense primer CCATCTAGAGATGGAAGTAC were used for PCR. The amplified fragment was digested with AccI and XbaI and then cloned at the AccI/XbaI sites of NtmybA2, replacing the original AccI/XbaI fragment. To introduce mutations T518A and S551A, two different DNA fragments were generated by separate PCRs with different sets of primers, namely CCCTTTGAATCTGGTGCTCCTTGTGACAAC and AGTATTTGAAGGAGCTGTGCGAAAATCATT for one reaction and ATATAGAAAACCATCAGAGTTACTTGT and ATTCAAACATGTCCATTGGTGAACGAA for the other reaction. These reactions generated DNA fragments that encoded different regions of NtmybA2 that are adjacent to each other. These fragments were connected to each other by ligation. The product was digested with BamHI and XbaI and was then cloned at the BamHI/XbaI sites of pJIT-NtmybA2 or its mutant derivatives. The DNA fragment containing mutations T293A and S343A was obtained similarly by connecting two DNA fragments that had been generated by separate PCRs with the primer set, CATGCTCTGAATACTATGCCCCAGCCTTTGAAGAT and CATCAACTCCAGCGGAGCAATATTAGGTATGTCATCT for one reaction and the primer set GTGCTGAACTGGAGCTTGGGTCCTTCCTAT and CAGGATTCTTCAGGGCTCTTCATGCAGTGT for the other reaction. These fragments were connected by ligation. The product was digested by BamHI and XbaI and then cloned at the BamHI/XbaI sites of pJIT-N-tmybA2 or its derivatives. For mutagenesis of S922A and S939A, two oligonucleotides, CCTGCAGTCTGCTCACTCAATTGCTTCATCAATCCAATAGCATCATAGCTTCTGTCACCTGGAGCCATAAACAGTGCAAGATC and CCATGGTTCATCAACTCTCTTCTGTCAGCCCCAAGACTTGATAATGAACTTAATTTTGAGGATCTTGCACTGTTTATGGCTC, were annealed and extended by the Klenow fragment of the DNA polymerase. The resultant double-stranded DNA was digested with PstI and NcoI and cloned at the PstI/NcoI sites of pJIT-NtmybA2, replacing the original PstI/NcoI fragment. To introduce mutations T653A and S666A, PCR was performed with the sense primer GCGACACCGTGATTTGGTGGCACCTTTGTC and the antisense primer TTCTTTAATATAGAAGGTGCGCTGGTGAAA, with pJIT-NtmybA2 as template. The amplified fragment, containing the entire vector sequence, was circularized by end-to-end ligation, thereby creating a new plasmid with the mutations of interest. Introduction of mutations T8A, S609A, T625A, S632A, S799A, T898A, and S1013A was achieved with a QuikChange site-direct mutagenesis kit, in accordance with the instructions from the manufacturer (Stratagene, La Jolla, CA). The sense primers were GTGATAGAATAAGCACTGCTTCAGATGGCACTAGC for T8A, GCACAGCAAGAGTACGCCCCTCTTGGCATCC for S609A, CTTCTGTGAACTGTCTTGCTCCATTTAGGCTGTGG for T625A, TTAGGCTGTGGGATGCACCATCTAGAGATG for S632A, GTGACCTGTTCTTCGCTCCTGATCGTTTTG for S799A, GCATATCTGGAGAAGCGCCTTATAAAAGG for T898A, and CAGTGAATGTGGAGCACCTGGAAAGGG for S1013A. The antisense primers were complementary to the respective sense primers.

cDNA fragments encoding A1-, A3-, B1-, and D3-type cyclins from tobacco were amplified by PCR from plasmids that included cDNA for Ntcyc25 (24), NtCYS (20), NtCYM (20), and NtcycD1 (25), respectively. PCR was conducted with the following pairs of sense primers, each of which included a BamHI site, and antisense primers, each of which included NotI site: ACGGATCCATGGCGACGACCCAGAAT and ATGCGGCCGCTTAGCAGCTTATGTTCTGGA for Ntcyc25; ACGGATCCATGGCGAACGAAGAAAATAAG and ATGCGGCCGCTCAAGCATCATCAAAAAAACAAG for NtCYS; ACGGATCCATGGCTTCAAGAAACGTTCT and ATGCGGCCGCTATTCATATGAAGAAGCAGC for NtCYM; and ACGGATCCATGGGAATACAACACAATGAG and ATGCGGCCGCGAGGGCTGCCAACAG for NtcycD1. The amplified fragments were digested with NotI, filled in by Klenow fragment, and then digested with BamHI. These fragments were cloned at the BamHI/SmaI sites of pJIT60 to obtain the expression plasmid for each tobacco cyclin. The cDNA fragment encoding A2-type cyclin was obtained by digesting a plasmid that included Ntcyc27 cDNA (24) with SalI and SmaI. This fragment was subcloned at the SalI/SmaI sites of pJIT-60 to create the expression plasmid for the A2-type cyclin. The cDNA fragment for A-type CDK (CDKA) of tobacco was amplified by PCR from the cdc2Nt1 cDNA clone (26) with a sense primer that included a SalI site, GAGTCGACATGGACCAGTATGAAAAAGTT, and an antisense primer that included a NotI site, TGGCGGCCGCTCACGGAACATACCCAATAT. The amplified fragments were digested with NotI and SalI and cloned at the NotI/SalI sites located downstream of the CaMV 35 S promoter in pTH-2 (27), replacing a sequence that encoded green fluorescent protein. The resultant plasmid, pTH2-CDKA, was used for in vitro mutagenesis to obtain a dominant-negative form of CDKA in which the codon GAC (Asp-146) was changed to AAC (Asn-146). Mutagenesis was performed with the QuikChange site-directed mutagenesis kit as described above, with the sense primer TGCTTTAAAGCTTGCAAACTTTGGATTGGCTA and the antisense primer TAGCCAATCCAAAGTTTGCAAGCTTTAAAGCA. The cDNA clones for Ntcyc25, Ntcyc27, NtcycD1, and cdc2Nt1 were generous gifts from Dr. Masami Sekine (Nara Institute of Science and Technology). All amplified fragments were sequenced to confirm that no errors had been introduced during PCR. The expression plasmid for the protein that consisted of the Myb domain of NtmybA2 fused to the VP16 activation domain (MD-VP16) was described previously (12).

Transient Expression Assays with BY2 Protoplasts—Tobacco BY2 protoplasts were prepared from 3-day-old cells as described previously (28). Protoplasts were transfected by polyethylene glycol-mediated direct gene transfer (29), and transfected protoplasts were cultured for 24 h at 27 °C. For each construct, five independent transfections were performed. A dual-luciferase reporter assay was performed according to the instructions form the manufacturer (Promega, Madison, WI). For each transfection, we used 10 µg of expression plasmid and 20 µg of reporter plasmid, unless otherwise indicated. Cotransfection with the 35 S-Rluc construct, in which the reporter gene for Renilla reniformis luciferase is located downstream of the CaMV 35 S promoter, was performed to provide an internal control for the efficiency of transfection.

Particle Bombardment—BY2 cells from an 8-day-old culture were diluted 10-fold with fresh medium, spread in a thin layer over filter paper, and then subjected to particle bombardment, which was performed as described previously (12). After bombardment, cells were suspended in fresh medium with or without aphidicolin (20 µg/l) and cultured at 27 °C. Cells were harvested 24 h after bombardment, and the activities of firefly luciferase and R. reniformis luciferase were determined as noted above.

Assays of Kinase Activities in Vitro—For bacterial expression of recombinant protein, cDNA fragments that encoded the C-terminal region of NtmybA2 (amino acids 441-1042) with or without mutations were cloned at the BamHI/SalI sites of the pET28a vector (Novagen, Darmstadt, Germany). The NtmybA2 recombinant protein tagged with His-T7 was produced in Escherichia coli (DE3) pLysS. After lysis of cells, the insoluble fraction was denatured and solubilized in 8 M urea and then the His-tagged recombinant protein was purified on a HiTrap chelating column (Amersham Biosciences). The eluate was dialyzed and concentrated with an Ultrafree Biomax NMWL membrane unit (Millipore, Billerica, MA), and was used as a substrate for kinase reactions in vitro.

Purification of a CDK fraction from BY2 cells and kinase reactions in vitro were performed as described previously (30). In brief, BY2 cells were homogenized with HG150 buffer (25 mM Tris-HCl, pH 7.5, 10 mM EDTA, 10 mM EGTA, 150 mM NaCl, 10% glycerol, 1 mM dithiothreitol, 20 mM {beta}-glycerophosphate, 1 mM sodium o-vanadate, 1 mM NaF, 1 mM phenylmethylsulfonyl fluoride, 1% Triton X-100, and 1% Nonidet P-40 plus 5 µg/ml leupeptin, 5 µg/ml chymostatin, 5 µg/ml pepstatin A, and 5 µg/ml antipain), and centrifuged. Extracts of BY2 cells were rotated gently with 20 µl of p13SUC1-agarose beads (50% slurry; Upstate Biotechnology, Lake Placid, NY) at 4 °C for 2 h. Beads were washed four times with 1 ml of HG150 buffer and twice with 1 ml of kinase buffer that contained 50 mM HEPES-KOH, pH 7.5, 20 mM MgCl2,5mM EGTA, 1 mM dithiothreitol, 20 mM {beta}-glycerophosphate, and 1 mM sodium o-vanadate. The beads were resuspended in a reaction mixture (10 µl) that included 50 µM ATP, and 10 µCi of [{gamma}-32P]ATP in kinase buffer and incubated at 25 °C for 30 min. As protein substrate, NtmybA2 recombinant protein (4 µg) or histone H1 (2 µg; Sigma-Aldrich) was added to the reaction mixture. Each reaction contained 100-120 µg of protein of p13SUC1 bead-purified fraction. For termination of the reaction, 2x sample buffer for SDS-PAGE was added, and the mixture was heated at 95 °C for 5 min. The proteins were separated by SDS-PAGE (10-12% polyacrylamide) and stained with Coomassie brilliant blue. Incorporated radioactivity was visualized with a bioimaging analyzer (BAS1800; Fuji Film, Tokyo, Japan).

For analysis of recombinant NtmybA2 protein that included mutations at potential sites of phosphorylation by CDK, mutant and wild-type recombinant proteins were produced in E. coli and purified as described above. CDK fractions were prepared as described above from BY2 cells that had been arrested at prometaphase for enrichment of mitotic protein kinases. For induction of prometaphase arrest, BY2 cells were first synchronized by treatment with aphidicolin for 24 h. After release from the aphidicolin block, cells were cultured for 4 h in fresh medium without the drug, and then they were treated with propyzamide (Sumitomo Chemical, Osaka, Japan) at a final concentration of 6 µM. Cells were cultured in the presence of propyzamide for a further 6 h and then collected for preparation of the CDK fraction.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
Cell Cycle-regulated Activity of NtmybA2—We showed previously, in cotransfection experiments, that the MSA-containing promoters of the cyclin B and NACK1 genes are significantly activated upon expression of NtmybA1 or NtmybA2 (12). To determine whether the transactivation activity of NtmybA2 is dependent on the stage of the cell cycle, we performed cotransfection experiments with asynchronously dividing tobacco BY2 cells and with aphidicolin-treated BY2 cells that were arrested at the S phase. We introduced a reporter plasmid that contained the NACK1 promoter fused to a luciferase (LUC) gene (NACK1p-LUC) into BY2 cells by particle bombardment. We tested two different expression plasmids. One encoded the full-length NtmybA2 protein and one encoded a chimeric protein in which the Myb domain of NtmybA2 was fused to the VP16 activation domain (MD-VP16; Fig. 1A). NtmybA2 activated the NACK1p-LUC reporter construct in aphidicolin-treated BY2 cells, but the extent of activation was significantly lower than that observed in untreated cells. By contrast, the MD-VP16 fusion protein activated the NACK1 promoter to a similar extent in aphidicolin-treated cells and untreated cells (Fig. 1B). Our results indicated that the transactivation potential of NtmybA2 is regulated during the cell cycle and that the C-terminal region of NtmybA2 might possibly be a target of the regulation.



View larger version (18K):
[in this window]
[in a new window]
  		FIG. 1.
Activity of NtmybA2 is regulated during the cell cycle. A, schematic representations of the expression plasmids used in transient expression assays. In the NtmybA2 expression plasmid, full-length cDNA encoding NtmybA2 was placed downstream of a double CaMV 35 S promoter (2 x P35S). The MD-VP16 expression plasmid contained the Myb domain from NtmybA2 fused to the VP16 activation domain. T35S indicates the terminator signal of the CaMV 35 S gene. The R1, R2, and R3 motifs in the Myb domains are shown as black boxes. B, expression plasmids and the NACK1p-LUC reporter plasmid were introduced into BY2 cells by particle bombardment. The bombarded cells were cultured in the presence and in the absence of aphidicolin for 24 h, and then LUC activity was determined. As a control, cells were bombarded with the reporter plasmid alone (Control). Treatment of cells with aphidicolin decreased the transactivation activity of NtmybA2 but did not significantly affect the transactivation activity of MD-VP16. All LUC activities are expressed relative to the control (taken as 1.0). Error bars indicate S.D. Black bars, cells cultured with aphidicolin (APC); open bars, cells cultured without aphidicolin.

 
The Activity of NtmybA2 Is Repressed by Its C-terminal Region—The domain structure of NtmybA2 is shown in Fig. 2A. The Myb domain, localized at the amino terminus, consists of three repeats and is responsible for DNA binding. In the Myb domain, NtmybA2 shows striking similarity to the vertebrate 3Rmyb proteins c-Myb, A-Myb, and B-Myb and to D. melanogaster Myb (12). Outside the Myb domain, however, NtmybA2 does not exhibt significant similarity to animal Myb proteins or to plant R2R3-Myb proteins, but it does exhibit some similarity to plant 3Rmyb proteins. The C-terminal region of NtmybA2 includes a region of ~100 amino acids that shows sequence similarity to the 3Rmyb proteins MYB3R-1 (31) and MYB3R-4 (GenBank accession number AF371975 [GenBank] ) of Arabidopsis. This similarity suggests that these 3Rmyb proteins might play similar biological roles that might be associated with the function of this conserved domain. To examine the role of the C-terminal region of NtmybA2, we generated a series of C-terminally truncated forms of NtmybA2 and analyzed their transactivation activities in cotransfection experiments (Fig. 2B). Both full-length NtmybA2 and truncated forms activated the NACK1p-LUC reporter when BY2 protoplasts were cotransfected with the respective plasmids. However, transactivation activity increased greatly upon deletion of the C-terminal region that corresponded to amino acids 1042 to 568 (Fig. 2C). The results indicated that the C-terminal region of NtmybA2 contains sequences that negatively regulate its potential for transcriptional activation. The presence of such a negative regulatory domain has been reported for mammalian 3Rmyb proteins c-Myb, A-Myb, and B-Myb (32-34). Additional deletion of amino acids 568 through 187 resulted in a decrease in activity for transactivation, suggesting the presence of a transcriptional activation domain.



View larger version (15K):
[in this window]
[in a new window]
  		FIG. 2.
Negative regulation of NtmybA2 activity by its C-terminal region. A, schematic representation of NtmybA2. The R1, R2, and R3 motifs in the Myb domains are shown as black boxes. The conserved domain (see text) is shown as a hatched box. The positions of potential sites of phosphorylation by CDKs are indicated by vertical lines under the box. B, schematic representation of full-length (NtmybA2-wt) and C-terminally deleted forms of NtmybA2. Each number indicates the amino acid position of the C-terminal end of the respective deletion construct. C, BY2 protoplasts were transfected with the NACK1p-LUC reporter plasmid together with expression plasmids for full-length or C-terminally truncated NtmybA2. The results indicate that the transactivation activity of NtmybA2 increased upon deletion of its C-terminal region. All LUC activities are expressed relative to that obtained with the reporter construct alone (taken as 1.0). Error bars indicate S.D.

 
NtmybA2 Is Activated by Cyclins through Its C-terminal Region—The negative regulatory domain that we identified in the C-terminal region of NtmybA2 contained multiple potential sites of phosphorylation by CDKs (Fig. 2A), raising the possibility that this region might act as an inhibitory domain that is regulated by phosphorylation during the cell cycle. To examine whether the activity of NtmybA2 might be controlled by cyclins, we cotransfected BY2 protoplasts with expression plasmids for full-length NtmybA2 and expression plasmids for various tobacco cyclins. In plants, cyclins A, B, and D are encoded by multigene families, each of which is further subdivided into three to seven subfamilies on the basis of amino acid sequences and expression profiles during the cell cycle (35, 36). It is believed that plants do not have cyclin E, because the Arabidopsis genome does not contain genes that are homologous to animal cyclin E. In this study, we examined the effects of cyclins from the B1-, A1-, A2-, A3-, and D3-type subfamilies from tobacco, which are herein designated CycB1, CycA1, CycA2, CycA3, and CycD3, respectively (Fig. 3A). We examined effects of the cyclins on the activity of NtmybA2 by monitoring the activity of the NACK1p-LUC reporter. NtmybA2 alone enhanced the activity of the NACK1 promoter, increasing it to four to five times that in the control. However, when both NtmybA2 and some of the individual cyclins were expressed in combination, we observed even higher levels of NACK1 promoter activity. This superactivation of the NACK1 promoter was not caused only by the stimulatory effects of the cyclins on the cell cycle, because the expression plasmids for the individual cyclins, by themselves, had no significant effects on the activity of the NACK1 promoter (Fig. 3A). The superactivation depended upon the type of cyclin. Thus, CycB1, CycA1, and CycA2 mediated superactivation, whereas CycA3 and CycD3 did not. We obtained similar results when we used the expression plasmid for NtmybA1 (data not shown). The observed differences in the capacity for superactivation among the cyclins were not caused by differences in levels of expression of the cyclins in the protoplasts, because all the cyclins tested significantly increased kinase activity for histone H1, and the levels of activity were not correlated with the superactivation capacity of each cyclin (Fig. 3B). The cyclin-induced superactivation of the NACK1 promoter was reversed by coexpression of a dominant-negative form of a CDKA, a member of a group of plant CDKs that is structurally most closely related to mammalian CDC2 (26) (Fig. 3C). Thus, the effects of cyclins on the NACK1 promoter seemed to be mediated by the kinase activity of a CDK that bound to individual cyclins, and the targets of phsophorylation by the CDK were most probably NtmybA1 and NtmybA2. The cyclin-induced superactivation was not specific to the NACK1 promoter; we obtained essentially the same results with a reporter plasmid fused to a cyclin B promoter (data not shown).



View larger version (23K):
[in this window]
[in a new window]
  		FIG. 3.
Specific cyclins activate the transactivation capacity of NtmybA2. A, BY2 protoplasts were transfected with expression plasmids for full-length NtmybA2 and for various cyclins, alone or in combination, together with the NACK1p-LUC reporter plasmid. All LUC activities are expressed relative to that obtained with the reporter construct alone (taken as 1.0). Error bars indicate S.D. B, phosphorylation of histone H1 by a p13SUC1-associated fraction prepared from the transfected BY2 protoplasts. Protein extracts were prepared from BY2 protoplasts that had been transfected with expression plasmids for the respective cyclins, and phosphorylation of histone H1 was examined in the presence of [{gamma}-32P]ATP. As a control, BY2 protoplasts were transfected with a plasmid expressing green fluorescent protein. Phosphorylated histone H1 was detected by autoradiography (top). The same gel, stained with Coomassie Brilliant Blue (CBB), is also shown to confirm loading of equal amounts of substrate in all lanes (bottom). C, BY2 protoplasts were cotransfected with the expression plasmid for CDKA or a dominant-negative variant (DN-CDKA), together with the expression plasmid for NtmybA2 and the NACK1p-LUC reporter plasmid. D, effects of CycB1 on the transactivation potential of full-length and truncated versions of NtmybA2. BY2 protoplasts were cotransfected with the expression plamids for full-length or truncated versions of NtmybA2 plus the NACK1p-LUC reporter plasmid, with and without the expression plasmid for CycB1. For each truncated version of NtmybA2, the effect of the cyclin is defined as the ratio of LUC activities with and without the CycB1 expression plasmid. As a control, we used a plasmid that expressed {beta}-glucuronidase instead of NtmybA2.

 
We attempted next to identify the region of NtmybA2 that was responsible for the cyclin-induced superactivation of the NACK1 promoter. We cotransfected BY2 protoplasts with expression plasmids for full-length or C-terminally truncated versions of NtmybA2 and the NACK1p-LUC reporter plasmid, with and without an expression plasmid for CycB1. For each form of NtmybA2, we determined the effects of the cyclin by comparing the NACK1p-LUC reporter activity with and without coexpression of the cyclin. As shown in Fig. 3D, full-length NtmybA2 was able to mediate cyclin-induced superactivation, inducing 2-fold higher reporter activity when CycB1 was coexpressed. However, the C-terminally truncated version of NtmybA2, {Delta}704, had lost the ability to mediate cyclin-induced superactivation. Further deletion of NtmybA2 did not alter the capacity for mediating superactivation. The results were consistent with the hypothesis that specific cyclins counteract the inhibitory effect of the C-terminal domain of NtmybA2.

Cyclin-induced Activation of NtmybA2 Does Not Require the DNA-binding Domain—To confirm the function of the C-terminal domain of NtmybA2, we fused the C-terminal region of NtmybA2 that lacked the Myb domain (NtmybA2{Delta}MD) to the yeast GAL4 DNA binding domain (GAL4DBD). In addition, we fused GAL4DBD to a C-terminally truncated version of NtmybA2{Delta}MD (NtmybA2{Delta}MD{Delta}C) and to the VP16 activation domain (VP16AD) (Fig. 4A). We introduced the expression plasmids for these GAL4 fusions into BY2 protoplasts together with a GAL4-responsive reporter plasmid that included the LUC reporter gene downstream from four copies of the GAL4-responsive element (4xGAL4-LUC). All the GAL4 fusions examined significantly activated the 4xGAL4-LUC reporter (Fig. 4B, open bars). However, the transactivational activity of the GAL4-NtmybA2{Delta}MD{Delta}C fusion was nearly 20 times higher than that of the GAL4-NtmybA2{Delta}MD fusion, suggesting again that the C-terminal region of NtmybA2 might negatively regulate the capacity for transcriptional activation. Then we tested the effect of cyclin on the transactivation potential of the GAL4 fusions. When the expression plasmid for CycB1 was introduced into BY2 protoplasts together with the expression plasmid for GAL4-NtmybA2{Delta}MD, superactivation of the GAL4-responsive reporter was observed (Fig. 4B, compare open and black bars). However, GAL4-NtmybA2{Delta}MD{Delta}C and GAL4-VP16AD failed to mediate the cyclin-induced superactivation of the GAL4-responsive reporter. Thus, the results show that the target of the cyclin-induced activation of NtmybA2 is located in the C-terminal region of NtmybA2. Because the DNA-binding domain of NtmybA2 was not included in the GAL4-NtmybA2{Delta}MD fusion used in this experiment, it is clear that cyclin-dependent activation of NtmybA2 does not rely simply on increased binding of NtmybA2 to its binding sites.



View larger version (23K):
[in this window]
[in a new window]
  		FIG. 4.
Cyclin-induced activation of NtmybA2 does not require the Myb domain. A, schematic representation of the fusion proteins encoded by expression plasmids used in transient expression assays. GAL4DBD was fused to NtmybA2 that lacked the N-terminally located Myb domain (NtmybA2{Delta}MD). NtmybA2{Delta}MD{Delta}C was constructed by C-terminal deletion of NtmybA2{Delta}MD and fused to GAL4DBD. A fusion between VP16AD and GAL4DBD was also used for transient expression assays. B, BY2 protoplasts were transfected with expression plasmids for the GAL4 fusion proteins, namely GAL4-NtmybA2{Delta}MD, GAL4-NtmybA2{Delta}MD{Delta}C, and GAL4-VP16, and the 4xGAL-LUC reporter plasmid with or without the expression plasmid for CycB1. All LUC activities are expressed relative to that obtained with the reporter construct alone (taken as 1.0). Error bars indicate S.D. Black bars, cells transfected with the expression plasmid for CycB1; open bars, cells transfected without the expression plasmid for CycB1.

 
Phosphorylation of NtmybA2 by CDK—To support the hypothesis that NtmybA2 is activated by CDK-mediated phosphorylation, we examined whether CDK can actually phosphorylate NtmybA2 in vitro (Fig. 5). We prepared a CDK fraction from BY2 cells using p13SUC1-agarose beads. p13SUC1 is a well-characterized docking protein that binds with high affinity to CDKs (37). As a substrate, an N-terminally deleted version of NtmybA2 (amino acids 441-1042) was produced in E. coli (NtmybA2{Delta}N). The p13SUC1-associated fraction from BY2 cells was able to phosphorylate the recombinant NtmybA2{Delta}N protein. The kinase activity for NtmybA2 was strongly inhibited by the CDK-specific inhibitor roscovitine. To examine the cell cycle-dependent changes in kinase activity for NtmybA2, we synchronized BY2 cells using aphidicolin. Fig. 6 shows that the mitotic index was highest 8 h after removal of aphidicolin. We prepared a set of p13SUC1-associated fractions from cells at different times, as indicated, and then examined the kinase activity with histone H1 and NtmybA2{Delta}N as substrates. The kinase activities of the p13SUC1-associated fractions did not change significantly during the cell cycle when histone H1 was the substrate. By contrast, there was a clear peak of kinase activity for NtmybA2{Delta}N 8 h after the removal of aphidicolin, coinciding with the highest mitotic index. These results provide strong evidence that NtmybA2 is a direct target of CDK. The timing of the peak of CDK activity for NtmybA2 was closely correlated with the timing of the function of NtmybA2 (that is, the activation of transcription of G2/M phase-specific genes, such as the cyclin B and NACK1 genes).



View larger version (30K):
[in this window]
[in a new window]
  		FIG. 5.
The C-terminal region of NtmybA2 was phosphorylated by a CDK fraction. A p13SUC1-associated CDK fraction was prepared from actively dividing BY2 cells and kinase assays were performed with and without roscovitine, a CDK-specific inhibitor, in the presence of [{gamma}-32P]ATP. The His-tagged NtmybA2 protein with an N-terminal deletion (NtmybA2{Delta}N) was expressed in E. coli, purified by affinity chromatography, and used as the substrate in the kinase assay. Phosphorylated NtmybA2{Delta}N was detected by autoradiography (top). The same gel, stained with Coomassie Brilliant Blue (CBB), is also shown to confirm loading of equal amounts of substrate in all lanes (bottom). Lane 1, control reaction without roscovitine; lanes 2, 3, 4, and 5, reactions in the presence of roscovitine at 10, 50, 100, and 200 µM, respectively.

 



View larger version (38K):
[in this window]
[in a new window]
  		FIG. 6.
The CDK activity for the C-terminal region of NtmybA2 is cell cycle-regulated. A, BY2 cells were synchronized with aphidicolin, and cells were sampled at the indicated times after removal of aphidicolin. A p13SUC1-associated fraction was prepared from each sample and kinase assays were performed with histone H1 and with N-terminally deleted NtmybA2 (NtmybA2{Delta}N) as substrates. B, changes in kinase activity for NtmybA2{Delta}N and in the mitotic index in synchronized cells. The intensities of bands of phosphorylated NtmybA2{Delta}N, shown in A, are indicated as a percentage of the maximum intensity at 8 h (which was taken as 100%).

 
Cyclin-induced Activation of NtmybA2 Requires Potential Sites of Phosphorylation by CDK—NtmybA2 contains 20 possible sites (S/T-P motifs) of phosphorylation by CDK. To determine which sites among these S/T-P motifs might be relevant to the cyclin/CDK-mediated regulation, we examined the effects of mutations of NtmybA2 at these potential sites of phosphorylation by CDK. The S/T-P motifs are located at amino acid positions 8, 293, 343, 518, 551, 598, 609, 625, 632, 653, 666, 799, 849, 906, 912, 922, 939, 973, 1013, and 1032 (Fig. 7A). We numbered these motifs 1 to 20; the motif closest to the amino terminus was designated motif 1. As shown in Fig. 7A, we constructed expression plasmids for mutated NtmybA2 proteins that lacked potential sites of phosphorylation in various combinations. Mutations were introduced such that the serine or threonine residue at individual potential sites of phosphorylation was changed to an alanine residue. When trasfected into BY2 protoplasts, all mutant forms tested enhanced the activity of the NACK1p-LUC reporter from 2- to 4-fold (Fig. 7B). We then tested the effect of coexpression of cyclin (CycB1) on the activities of wild-type and mutant forms of NtmybA2 (Fig. 7C). The ability of wild-type NtmbyA2 to transactivate the NACK1 promoter was increased ~2-fold by coexpression of CycB1. This enhancing effect of CycB1 on activation of the NACK1 promoter was completely lost when all 20 potential sites of phosphorylation were mutated simultaneously (Fig. 7C, NtmybA2 m1-20). This result is consistent with our hypothesis that cyclin-induced activation of NtmybA2 is caused by the direct phosphorylation of NtmybA2 by CDK. Mutation of motifs 4-20 similarly abolished cyclin-induced activation, suggesting that motifs 1-3 might not be important for cyclin-mediated regulation of NtmybA2 activity (Fig. 7C, NtmybA2 m4-20). Mutation of motifs 4-10 and 6-10 reduced cyclin-induced activation to a similar extent (Fig. 7C, NtmybA2 m4-10 and NtmybA2 m6-10). Thus, site(s) relevant to cyclin-mediated regulation might correspond to motifs 6-10 located in the conserved domain of NtmybA2. Mutations of motifs 8-10 reduced cyclin-induced activation to a lesser extent than mutation of motifs 6-10, suggesting that multiple sites within motifs 6-10 might be relevant to the cyclin-induced activation of NtmybA2. The mutant form of NtmybA2 that lacked motifs 11-20 (NtmybA2 m11-20) was activated by cyclin to a lesser extent than was wild-type NtmybA2, suggesting that the site(s) relevant to cyclin-mediated regulation might also be included within these motifs. All the results together indicate that the presence of potential sites of phosphorylation by CDK is essential for cyclin-induced activation of NtmybA2. However, no single site of potential phosphorylation is absolutely critical for cyclin-induced activation. Our data suggest that cyclin-induced activation of NtmybA2 requires many putative sites of phosphorylation and that each site makes a contribution to the cyclin-induced activation. At least two regions of NtmybA2 are important for cyclin-mediated regulation; one is located in the conserved domain that includes motifs 6-10, and the other, including motifs 11-20, is located at the carboxyl terminus.



View larger version (18K):
[in this window]
[in a new window]
  		FIG. 7.
Cyclin-induced activation of NtmybA2 is dependent on the presence of potential sites of phosphorylation by CDK. A, schematic representation of wild-type NtmybA2 (NtmybA2-wt) and mutant forms of NtmybA2 that lacked potential sites of phosphorylation in various combinations. The conserved domain (see text) is shown as a hatched box. The positions of potential sites of phosphorylation by CDK are indicated by open circles under the bars as follows: residue position 8 (motif 1), 293 (motif 2), 343 (motif 3), 518 (motif 4), 551 (motif 5), 598 (motif 6), 609 (motif 7), 625 (motif 8), 632 (motif 9), 653 (motif 10), 666 (motif 11), 799 (motif 12), 849 (motif 13), 906 (motif 14), 912 (motif 15), 922 (motif 16), 939 (motif 17), 973 (motif 18), 1013 (motif 19), and 1032 (motif 20). In mutant forms, serine or threonine residues at potential sites of phosphorylation were changed to alanine, and these mutations are shown by filled circles. B, transactivation of the NACK1 promoter by wild-type and mutant forms of NtmybA2. BY2 protoplasts were cotransfected with the expression plasmids for wild-type and mutant forms of NtmybA2 together with the NACK1p-LUC reporter plasmid. All LUC activities are expressed relative to that obtained with the reporter construct alone (taken as 1.0). Error bars indicate S.D. C, effects of CycB1 on the transactivation potential of wild-type and mutant forms of NtmybA2. BY2 protoplasts were cotransfected with the expression plasmids for wild-type and mutant forms of NtmybA2 plus the NACK1p-LUC reporter plasmid, with and without the expression plasmid for CycB1. For each mutant form of NtmybA2, the effect of the cyclin is defined as the ratio of LUC activities with and without the CycB1 expression plasmid. As a control, we used a plasmid that expressed {beta}-glucuronidase instead of NtmybA2. Error bars indicate S.D. D, effects of mutations in S/T-P motifs on phosphorylation of NtmybA2 by CDK in vitro. The N-terminally deleted version of NtmybA2 (NtmybA2{Delta}N) with or without mutations was expressed in E. coli and the resultant proteins were used as substrates for phosphorylation in vitro. The mutant forms of NtmybA2{Delta}N (m4-20, m11-20, and m4-10) had mutations in the indicated S/T-P motifs. The phosphorylation reaction was performed in the presence of [{gamma}32P]ATP and a p13SUC1-associated fraction prepared from propyzamide-treated BY2 cells. Phosphorylated proteins were detected by autoradiography (top). The same gel, stained with Coomassie Brilliant Blue (CBB), is also shown to confirm loading of equal amounts of substrate in all lanes (bottom).

 
We examined whether the mutations at potential sites of phosphorylation might affect the phosphorylation of NtmybA2 by CDK in vitro. The N-terminally deleted form of NtmybA2 (NtmybA2{Delta}N) was expressed in E. coli and used as a substrate for phosphorylation in vitro. This version lacks amino acids 1-440, and, thus, does not contain three potential sites of phosphorylation (motifs 1-3). We prepared a p13SUC1-associated fraction from BY2 cells that had been treated with propyzamide. Approximately 85% of cells were arrested at prometaphase during treatment with propyzamide. The recombinant NtmybA2{Delta}N protein was phosphorylated by the p13SUC1-associated fraction from these BY2 cells (Fig. 7D), as shown similarly in Fig. 5. When the mutant form of NtmybA2{Delta}N that lacked all S/T-P motifs was used as the substrate, the extent of phosphorylation was greatly reduced (Fig. 7D, NtmybA2{Delta}-Nm4-20). Thus, it seems that most, if not all, of the CDK activity in the p13SUC1-associated fraction phosphorylated NtmybA2 at S/T-P motifs. The extent of phosphorylation of NtmybA2{Delta}Nm4-20 was very low relative to that of Ntmyb-A2{Delta}N and might represent the activities of other kinases that were co-purified in our CDK fraction. When NtmybA2{Delta}N containing mutations in motifs 11-20 or 4-10 was used as substrate, intermediate levels of phosphorylation were observed in both cases (Fig. 7D). The levels of phosphorylation of wild-type and mutant NtmybA2{Delta}N proteins in vitro were roughly correlated with the extents of cyclin-induced activation in co-transfection experiments. Thus, the results presented here support our hypothesis that direct phosphorylation of multiple S/T-P motifs by cyclin/CDK might be required for full activation of NtmybA2.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
We showed previously that, in tobacco cells, 3Rmyb proteins control the transcription of various G2/M phase-specific genes, including cyclin B genes. The levels of transcripts for two tobacco 3Rmyb proteins, NtmybA1 and NtmybA2 are themselves regulated during the cell cycle and are highest just before the level of cyclin B transcripts reaches a maximum (12). In this report, we showed that, in addition to the regulation at the transcription of genes for NtmybA1 and NtmybA2, the activities of the two proteins themselves are controlled by cyclin/CDK. We showed first that the C-terminal region of NtmybA2 represses its transactivation potential. Deletion of this region dramatically increased the activity of NtmybA2. Next, we showed, in cotransfection experiments, that specific types of cyclin enhance the activity of NtmybA2 via the latter's C-terminal region. Finally, we showed, by kinase assays in vitro, that the C-terminal region of NtmybA2 is phosphorylated by CDK(s) and that the CDK activity for NtmybA2 is cell cycle-regulated, peaking at G2/M. Taken together, our data suggest that the C-terminal region of NtmybA2 is phosphorylated by a specific cyclin/CDK complex(es) at G2/M and that this phosphorylation removes the inhibitory effect of the C-terminal region, thereby activating NtmybA2 specifically at G2/M. In this study, we have not identified the substrate of CDK that is responsible for activation of NtmybA2. Our data do not exclude the possibility that CDK might phosphorylate some unidentified protein, which might then affect the activity of NtmybA2. However, it is likely that activation of NtmybA2 is caused by direct phosphorylation of NtmybA2 by CDK because CDK(s) phosphorylated NtmybA2 directly in vitro and the activity was detected at the time when NtmybA2 should be active in the cell cycle. In addition, the effects of cyclin on the capacity of NtmybA2 for transactivation depended on the presence of potential sites of phosphorylation by CDK in NtmybA2. The mutant form of NtmybA2 lacking all potential sites of phosphorylation by CDK failed to be activated by cyclin. The CDK activity for NtmybA2 seemed to be associated with specific classes of cyclins, because CycA1, CycA2, and CycB1, but not CycA3 and CycD3, were able to activate NtmybA2 in cotransfection experiments. The genes for cyclins with the potential for activation of NtmybA2 are expressed late in the cell cycle: CycA2 at G2 and CycA1 and CycB1 at G2/M (20, 24, 38). Thus, the timing of the expression of these cyclins is consistent with the timing in the cell cycle of the CDK activity for NtmybA2, suggesting that CDK activity for NtmybA2 might be associated with these cyclins. The genes for cyclins CycD3 and CycA3, which were inactive in the activation of NtmybA2, are expressed constitutively2 and S-phase-specifically (20), respectively.

By contrast to the function of 3Rmyb proteins at the G2/M phase in tobacco, mammalian 3Rmyb proteins (c-Myb, A-Myb, and B-Myb) seem to play an important role at the G1/S transition. c-Myb controls target genes that encode regulators required for the G1/S transition, such as CDC2 (39), c-Myc (40), and cyclin A (41), whereas the targets of tobacco 3Rmyb proteins are genes required at G2/M, including the cyclin B and NACK1 genes (12). Moreover, the timing of transcription differs between genes for mammalian 3Rmyb proteins and tobacco 3Rmyb proteins; the former are transcribed at G1/S and the latter at G2/M. The A-Myb and B-Myb genes are expressed at G1/S in vascular smooth muscle cells, fibroblasts, and hematopoietic cells (42, 43). The cell cycle-dependent expression of B-Myb is controlled via the E2F-binding sites in the B-Myb promoter region (44). In addition to transcriptional regulation, post-translational regulation also influences the cell cycle-dependent functions of 3Rmyb proteins in mouse and human cells. The c-Myb, A-Myb, and B-Myb proteins all contain a C-terminal conserved domain that represses their transactivation potential (32-34). As we have shown here for tobacco 3Rmyb proteins, the transactivation potential of A-Myb and B-Myb is derepressed by phosphorylation of their C-terminal regions by specific cyclin/CDK complexes. Although cyclin/CDK complexes similarly regulate the activities of 3Rmyb proteins from tobacco and mammals, the cyclins involved in such regulation are different. In mouse cells, the activity of B-Myb is stimulated by cyclin A and weakly by cyclin E, but not by cyclins B1 and B2 (32). Mouse A-Myb and human B-Myb are also activated by cyclins A and E (34, 45). Moreover, the cyclin E/CDK2 and cyclin A/CDK2 complexes play essential roles at the G1/S transition and during the S phase, respectively (46), and, consistent with these observation, phosphorylation of mouse B-Myb occurs specifically in cells at S phase (47). The different mechanisms for regulation of the activities of 3Rmyb proteins in plants and mammals should be derived from a common mechanism in a common ancestor. Thus, it is tempting to speculate that, during evolution, ancestors of plants and mammals developed the capacity to exploit different cyclins to control the activity of 3Rmyb proteins at different times during the cell cycle. In D. melanogaster, Myb is involved in the control of the G2/M transition via induction of cyclin B transcription (17), as we also demonstrated previously in tobacco (12). However, it remains to be determined whether cyclin in D. melanogaster regulates the activity of the Myb.

We identified NtmybA2 as a target of phosphorylation by CDK(s) in tobacco. A CDK fraction from BY2 cells phosphorylated the C-terminal region of NtmybA2 in vitro, suggesting that NtmybA2 might be a direct substrate for a CDK(s). Only a few potential substrates for CDKs have been identified in plants. They include a retinoblastoma-related protein (25), a heat-shock transcription factor (48), and an NPK1 mitogen-activated protein kinase kinase kinase.3 Thus, our findings add a new member to the list of target proteins of plant CDKs. The kinase activity for NtmybA2 in the CDK fraction oscillated during the cell cycle, whereas the kinase activity for histone H1 was higher and remained unchanged throughout the cell cycle. It is likely that histone H1 can be phosphorylated by various cyclin/CDK complexes in the CDK fraction, whereas the kinase activity for NtmybA2 is probably associated with certain specific combinations of cyclin and CDK, which most probably include CycA1, CycA2, or CycB1.

Because the gene for CycB1 is itself a target of transcriptional activation by NtmybA2, we can postulate the existence of a positive feedback loop, in which transcription of the cyclin B gene is activated by NtmybA2, which is, in turn, activated by a CDK in a complex with cyclin B. In fact, not only NACK1 promoter but also the cyclin B promoter was superactivated by CycB1, when CycB1 was coexpressed with NtmybA2. A similar feedback mechanism has been proposed for the G2/M phase-specific transcription of the mitotic cyclin genes, CLB1 and CLB2, in budding yeast. In this system, CDK activities associated with mitotic cyclins promote the transcription of genes that themselves encode mitotic cyclins (49). G2/M phase-specific transcription of CLB and other genes is mediated through assembly of a transcription factor complex at the target promoters. This complex consists of MADS-box transcription factor MCM1, the forkhead transcription factor FKH2, and the coactivator NDD1 (50). A recent report showed that NDD1 is recruited to target promoters though the C-terminal domain of FKH2 and that this recruitment requires phosphorylation of NDD1 by a CDK activity associated with mitotic cyclins (51). Thus, in yeast, NDD1 seems to be the target of phosphorylation for the positive feedback control of transcription of CLB genes. We have shown here that, in plants, 3Rmyb transcription factors are possible targets of phosphorylation for the feedback control of cyclin B transcription. Such a positive feedback circuit might facilitate the rapidly enhanced transcription of cyclin B during G2 and open the unusually small window of expression of cyclin B genes. The dependence on CDK activity associated with cyclin B, which disappears as a result of selective proteolysis at the end of mitosis (52, 53), also helps to explain the repression of cyclin B transcription as cells enter G1. Our goal now is to identify the molecular switch for entry into the feedback loop. Because transcription of the NtmybA2 gene is itself cell cycle-regulated and occurs just before that of cyclin B, induction of NtmybA2 transcription might be a trigger for entry into the feedback loop. We are currently dissecting the promoter of the NtmybA2 gene as part of our efforts to characterize the upstream control of G2/M phase-specific gene expression in plants.


   FOOTNOTES
 
* This work was supported in part by a grant from Program for Promotion of Basic Research Activities for Innovative Biosciences and by Grants-in-Aid 14036216 and 14036211 for Scientific Research on Priority Areas from the Ministry of Education, Science, Culture and Sports of Japan. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

§ Present address: Central Research Institute, Ishihara Sangyo Kaisha, Ltd., Kusatsu, Shiga 525-0025, Japan. Back

|| To whom correspondence should be addressed: Department of Regulation of Biological Signals, Graduate School of Bioagricultural Sciences, Nagoya University, Furo-cho, Chikusa-ku, Nagoya 464-8601, Japan. Tel.: 81-52-789-4168; Fax: 81-52-789-4165; E-mail: masakito{at}agr.nagoya-u.ac.jp.

1 The abbreviations used are: MSA, M phase-specific activator sequence; CDK, cyclin-dependent kinase; LUC, luciferase; CaMV, cauliflower mosaic virus; 3Rmyb, three-repeat Myb; GAL4DBD, DNA binding domain of yeast GAL4; VP16, viral protein 16; CDKA, tobacco A-type CDK; MD-VP16, Myb domain of NtmybA2 fused to the VP16 activation domain; VP16AD, VP16 activation domain. Back

2 M. Sekine, personal communication. Back

3 T. Soyano and Y. Machida, unpublished data. Back


   ACKNOWLEDGMENTS
 
We thank Dr. Masami Sekine (Nara Institute of Science and Technology) for providing cDNA clones for tobacco cyclins and Dr. Masaki Ishikawa for technical assistance and helpful advice.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Lavia, P., and Jansen-Dürr, P. (1999) Bioessays 21, 221-230[CrossRef][Medline] [Order article via Infotrieve]
  2. Gutierrez, C., Ramirez-Parra, E., Castellano, M. M., and del Pozo, J. C. (2002) Curr. Opin. Plant Biol. 5, 480-486[CrossRef][Medline] [Order article via Infotrieve]
  3. Kosugi, S., and Ohashi, Y. (2002) Plant J. 29, 45-59[CrossRef][Medline] [Order article via Infotrieve]
  4. Chabouté, M. E., Clément, B., and Philipps, G. (2002) J. Biol. Chem. 277, 17845-17851[Abstract/Free Full Text]
  5. Zwicker, J., and Müller, R. (1997) Trends Genet. 13, 3-6[CrossRef][Medline] [Order article via Infotrieve]
  6. Zwicker, J., Lucibello, F. C., Wolfraim, L. A., Gross, C., Truss, M., Engeland, K., and Müller, R. (1995) EMBO J. 14, 4514-4522[Medline] [Order article via Infotrieve]
  7. Uchiumi, T., Longo, D. L., and Ferris, D. K. (1997) J. Biol. Chem. 272, 9166-9174[Abstract/Free Full Text]
  8. Ishigatsubo, Y. (2002) J. Biol. Chem. 277, 10719-10726[Abstract/Free Full Text]
  9. Lange-zu Dohna, C., Brandeis, M., Berr, F., Mössner, J., and Engeland, K. (2000) FEBS Lett. 484, 77-81[CrossRef][Medline] [Order article via Infotrieve]
  10. Ito, M., Iwase, M., Kodama, H., Lavisse, P., Komamine, A., Nishihama, R., Machida, Y., and Watanabe, A. (1998) Plant Cell 10, 331-341[Abstract/Free Full Text]
  11. Ito, M. (2000) Plant Mol. Biol. 43, 677-690[CrossRef][Medline] [Order article via Infotrieve]
  12. Ito, M., Araki, S., Matsunaga, S., Itoh, T., Nishihama, R., Machida, Y., Doonan, J. H., and Watanabe, A. (2001) Plant Cell 13, 1891-1905[Abstract/Free Full Text]
  13. Weston, K. (1998) Curr. Opin. Genet. Dev. 8, 76-81[CrossRef][Medline] [Order article via Infotrieve]
  14. Rosinski, J. A., and Atchley, W. R. (1998) J. Mol. Evol. 46, 74-83[CrossRef][Medline] [Order article via Infotrieve]
  15. Stracke, R., Werber, M., and Weisshaar, B. (2001) Curr. Opin. Plant Biol. 4, 447-456[CrossRef][Medline] [Order article via Infotrieve]
  16. Ganter, B., and Lipsick, J. S. (1999) Adv. Cancer Res. 76, 21-60[Medline] [Order article via Infotrieve]
  17. Okada, M., Akimaru, H., Hou, D. X., Takahashi, T., and Ishii, S. (2002) EMBO J. 21, 675-684[CrossRef][Medline] [Order article via Infotrieve]
  18. Menges, M., Hennig, L., Gruissem, W., and Murray, J. A. (2002) J. Biol. Chem. 277, 41987-42002[Abstract/Free Full Text]
  19. Nishihama, R., Soyano, T., Ishikawa, M., Araki, S., Tanaka, H., Asada, T., Irie, K., Ito, M., Terada, M., Banno, H., Yamazaki, Y., and Machida, Y. (2002) Cell 109, 87-99[CrossRef][Medline] [Order article via Infotrieve]
  20. Ito, M., Criqui, M.-C., Sakabe, M., Ohno, T., Hata, S., Kouchi, H., Hashimoto, J., Fukuda, H., Komamine, A., and Watanabe, A. (1997) Plant J. 11, 983-992[CrossRef][Medline] [Order article via Infotrieve]
  21. Nagata, T., Nemoto, Y., and Hasezawa, S. (1992) Intl. Rev. Cytology 132, 1-30
  22. Schwechheimer, C., Smith, C., and Bevan, M. W. (1998) Plant Mol. Biol. 36, 195-204[CrossRef][Medline] [Order article via Infotrieve]
  23. Guerineau, F., and Mullineaux, P. (1993) in Plant Molecular Biology Labfax (Croy, R. R. D., ed) pp. 121-147, BIOS Scientific Publishers, Oxford, UK
  24. Setiady, Y. Y., Sekine, M., Hariguchi, N., Yamamoto, T., Kouchi, H., and Shinmyo, A. (1995) Plant J. 8, 949-957[CrossRef][Medline] [Order article via Infotrieve]
  25. Nakagami, H., Kawamura, K., Sugisaka, K., Sekine, M., and Shinmyo, A. (2002) Plant Cell 14, 1847-1857[Abstract/Free Full Text]
  26. Setiady, Y. Y., Sekine, M., Hariguchi, N., Kouchi, H., and Shinmyo, A. (1996) Plant Cell Physiol. 37, 369-376[Abstract/Free Full Text]
  27. Chiu, W., Niwa, Y., Zeng, W., Hirano, T., Kobayashi, H., and Sheen, J. (1996) Curr. Biol. 6, 325-330[CrossRef][Medline] [Order article via Infotrieve]
  28. Evans, D. A., and Bravo, J. E. (1983) Int. Rev. Cytol. Supplement 16, 33-53
  29. Bilang, R., Klöti, A., Schrott, M., and Potrykus, I. (1994) in Plant Molecular Biology Manual, (Gelvin, S. B., and Schilperoort, R. A., eds) A1 pp. 1-16, Kluwer Academic Publishers, Dordrecht, The Netherlands
  30. Soyano, T., Nishihama, R., Morikiyo, K., Ishikawa, M., and Machida, Y. (2003) Genes Dev. 17, 1055-1067[Abstract/Free Full Text]
  31. Kranz, H., Scholz, K., and Weisshaar, B. (2000) Plant J. 21, 231-235[CrossRef][Medline] [Order article via Infotrieve]
  32. Ziebold, U., Bartsch, O., Marais, R., Ferrari, S., and Klempnauer, K. H. (1997) Curr. Biol. 7, 253-260[CrossRef][Medline] [Order article via Infotrieve]
  33. Dubendorff, J. W., Whittaker, L. J., Eltman, J. T., and Lipsick, J. S. (1992) Genes Dev. 6, 2524-2535[Abstract/Free Full Text]
  34. Ziebold, U., and Klempnauer, K. H. (1997) Oncogene 15, 1011-1019[CrossRef][Medline] [Order article via Infotrieve]
  35. Vandepoele, K., Raes, J., De Veylder, L., Rouze, P., Rombauts, S., and Inzé, D. (2002) Plant Cell 14, 903-916[Abstract/Free Full Text]
  36. Renaudin, J. P., Doonan, J. H., Freeman, D., Hashimoto, J., Hirt, H., Inzé, D., Jacobs, T., Kouchi, H., Rouze, P., Sauter, M., Savoure, A., Sorrell, D. A., Sundaresan, V., and Murray, J. A. (1996) Plant Mol. Biol. 32, 1003-1018[CrossRef][Medline] [Order article via Infotrieve]
  37. Bourne, Y., Watson, M. H., Hickey, M. J., Holmes, W., Rocque, W., Reed, S. I., and Tainer, J. A. (1996) Cell 84, 863-874[CrossRef][Medline] [Order article via Infotrieve]
  38. Breyne, P., Dreesen, R., Vandepoele, K., De Veylder, L., Van Breusegem, F., Callewaert, L., Rombauts, S., Raes, J., Cannoot, B., Engler, G., Inzé, D., and Zabeau, M. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, 14825-14830[Abstract/Free Full Text]
  39. Ku, D. H., Wen, S. C., Engelhard, A., Nicolaides, N. C., Lipson, K. E., Marino, T. A., and Calabretta, B. (1993) J. Biol. Chem. 268, 2255-2259[Abstract/Free Full Text]
  40. Nakagoshi, H., Kanei-Ishii, C., Sawazaki, T., Mizuguchi, G., and Ishii, S. (1992) Oncogene 7, 1233-1240[Medline] [Order article via Infotrieve]
  41. Müller, C., Yang, R., Idos, G., Tidow, N., Diederichs, S., Koch, O. M., Verbeek, W., Bender, T. P., and Koeffler, H. P. (1999) Blood 94, 4255-4262[Abstract/Free Full Text]
  42. Reiss, K., Travali, S., Calabretta, B., and Baserga, R. (1991) J. Cell. Physiol. 148, 338-343[CrossRef][Medline] [Order article via Infotrieve]
  43. Marhamati, D. J., Bellas, R. E., Arsura, M., Kypreos, K. E., and Sonenshein, G. E. (1997) Mol. Cell. Biol. 17, 2448-2457[Abstract]
  44. Lam, E. W., and Watson, R. J. (1993) EMBO J. 12, 2705-2713[Medline] [Order article via Infotrieve]
  45. Sala, A., Kundu, M., Casella, I., Engelhard, A., Calabretta, B., Grasso, L., Paggi, M. G., Giordano, A., Watson, R. J., Khalili, K., and Peschle, C. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 532-536[Abstract/Free Full Text]
  46. Draetta, G. F. (1994) Curr. Opin. Cell Biol. 6, 842-846[CrossRef][Medline] [Order article via Infotrieve]
  47. Robinson, C., Light, Y., Groves, R., Mann, D., Marias, R., and Watson, R. (1996) Oncogene 12, 1855-1864[Medline] [Order article via Infotrieve]
  48. Reindl, A., Schoffl, F., Schell, J., Koncz, C., and Bako, L. (1997) Plant Physiol. 115, 93-100[Abstract]
  49. Amon, A., Tyers, M., Futcher, B., and Nasmyth, K. (1993) Cell 74, 993-1007[CrossRef][Medline] [Order article via Infotrieve]
  50. Breeden, L. L. (2000) Curr. Biol. 10, R586-R588[CrossRef][Medline] [Order article via Infotrieve]
  51. Reynolds, D., Shi, B. J., McLean, C., Katsis, F., Kemp, B., and Dalton, S. (2003) Genes Dev. 17, 1789-1802[Abstract/Free Full Text]
  52. Genschik, P., Criqui, M.-C., Parmentier, Y., Derevier, A., and Fleck, J. (1998) Plant Cell 10, 2063-2076[Abstract/Free Full Text]
  53. Murray, A. (1995) Cell 81, 149-152[CrossRef][Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 Plant Physiol.Home page
Q. Ma, X. Dai, Y. Xu, J. Guo, Y. Liu, N. Chen, J. Xiao, D. Zhang, Z. Xu, X. Zhang, et al.
Enhanced Tolerance to Chilling Stress in OsMYB3R-2 Transgenic Rice Is Mediated by Alteration in Cell Cycle and Ectopic Expression of Stress Genes
Plant Physiology, May 1, 2009; 150(1): 244 - 256.
[Abstract] [Full Text] [PDF]

Home page
 Plant Physiol.Home page
K. Kato, I. Galis, S. Suzuki, S. Araki, T. Demura, M.-C. Criqui, T. Potuschak, P. Genschik, H. Fukuda, K. Matsuoka, et al.
Preferential Up-Regulation of G2/M Phase-Specific Genes by Overexpression of the Hyperactive Form of NtmybA2 Lacking Its Negative Regulation Domain in Tobacco BY-2 Cells
Plant Physiology, April 1, 2009; 149(4): 1945 - 1957.
[Abstract] [Full Text] [PDF]

Home page
 Plant Physiol.Home page
R. C. Day, R. P. Herridge, B. A. Ambrose, and R. C. Macknight
Transcriptome Analysis of Proliferating Arabidopsis Endosperm Reveals Biological Implications for the Control of Syncytial Division, Cytokinin Signaling, and Gene Expression Regulation
Plant Physiology, December 1, 2008; 148(4): 1964 - 1984.
[Abstract] [Full Text] [PDF]

Home page
 DevelopmentHome page
N. Haga, K. Kato, M. Murase, S. Araki, M. Kubo, T. Demura, K. Suzuki, I. Muller, U. Voss, G. Jurgens, et al.
R1R2R3-Myb proteins positively regulate cytokinesis through activation of KNOLLE transcription in Arabidopsis thaliana
Development, March 15, 2007; 134(6): 1101 - 1110.
[Abstract] [Full Text] [PDF]

Home page
 Genes Dev.Home page
M. Sasabe, T. Soyano, Y. Takahashi, S. Sonobe, H. Igarashi, T. J. Itoh, M. Hidaka, and Y. Machida
Phosphorylation of NtMAP65-1 by a MAP kinase down-regulates its activity of microtubule bundling and stimulates progression of cytokinesis of tobacco cells
Genes & Dev., April 15, 2006; 20(8): 1004 - 1014.
[Abstract] [Full Text] [PDF]

Home page
 Plant CellHome page
M. Menges, A. K. Samland, S. Planchais, and J. A.H. Murray
The D-Type Cyclin CYCD3;1 Is Limiting for the G1-to-S-Phase Transition in Arabidopsis
PLANT CELL, April 1, 2006; 18(4): 893 - 906.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
279/31/32979    most recent
M403171200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Araki, S.
Right arrow Articles by Machida, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Araki, S.
Right arrow Articles by Machida, Y.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2004 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement