Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M404700200 on May 25, 2004

J. Biol. Chem., Vol. 279, Issue 32, 33421-33429, August 6, 2004
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
279/32/33421    most recent
M404700200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Maertens, G.
Right arrow Articles by Engelman, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Maertens, G.
Right arrow Articles by Engelman, A.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Identification and Characterization of a Functional Nuclear Localization Signal in the HIV-1 Integrase Interactor LEDGF/p75*

Goedele Maertens{ddagger}§||, Peter Cherepanov{ddagger}**, Zeger Debyser¶, Yves Engelborghs§, and Alan Engelman{ddagger}**{ddagger}{ddagger}

From the {ddagger}Department of Cancer Immunology and AIDS, Dana-Farber Cancer Institute, Boston, Massachusetts 02115, §Laboratory of Biomolecular Dynamics, Katholieke Universiteit Leuven, Heverlee B-3001, Belgium, the **Department of Pathology, Harvard Medical School, Boston, Massachusetts 02115, and Rega Institute for Medical Research and KULAK, Katholieke Universiteit Leuven, Leuven B-3000, Belgium

Received for publication, April 28, 2004


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Human lens epithelium-derived growth factor (LEDGF)/p75 protein forms a specific nuclear complex with human immunodeficiency virus type 1 (HIV-1) integrase and is essential for nuclear localization and chromosomal association of the viral protein. We now studied nuclear import of LEDGF/p75 in live and semipermeabilized cells. We show that nuclear import of LEDGF/p75 is GTP-, Ran-, importin-{alpha}/{beta}-, and energy-dependent and that the protein competes with the canonical SV40 large T antigen nuclear localization signal (NLS) for nuclear import receptors. We identified the NLS of LEDGF/p75 through deletion analysis and site-directed mutagenesis. The LEDGF/p75 NLS, 148GRKRKAEKQ156, belongs to the canonical SV40-like family. Fusion of this short peptide to the amino terminus of Escherichia coli {beta}-galactosidase rendered the fusion protein nuclear, confirming that the LEDGF/p75 NLS is transferable. Moreover, a single amino acid change in the NLS was sufficient to exclude the mutant LEDGF/p75 protein from the nucleus and abolish nuclear import of HIV-1 integrase.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
The tight regulation of macromolecular transport through the nucleopore complexes (NPCs)1 of the nuclear envelope is vital in eukaryotic cells. The NPC has a 9-nm diffusion channel, which sets an upper limit for free diffusion to ~45-60 kDa, allowing metabolites, ions, and small macromolecules to pass through. However, NPCs allow active nuclear transport of particles larger than 25 nm in diameter (for a review, see Ref. 1). Proteins are directed in or out of the nucleus via nuclear localization signals (NLSs) or nuclear export signals, respectively. NLSs and nuclear export signals require binding of specific import/export-receptors (importins and exportins) that are necessary for the translocation of the cargo through NPCs. The NLSs are grouped into several categories. The most commonly known are the classical NLSs (cNLS), which are composed of a basic amino acid stretch (K/R)4-6 preceded by a Gly, Pro, or an acidic amino acid residue (2, 3) similar to the NLS of SV40 large T antigen. Bipartite NLSs as in Xenopus nucleoplasmin (4) are composed of two basic amino acid stretches interspersed by a nonconserved 10-12-amino acid spacer: (K/R)2X10-12(K/R)3. In addition, several nonclassical NLSs have been described, examples being the M9 fragment in the heterogeneous nuclear ribonucleoprotein A1 and A2 containing a 38-amino acid stretch enriched in aromatic residues and glycine (5-7) or the nuclear targeting signals of ribosomal proteins, such as L23a (8). Furthermore, in addition to linear NLSs, discontinuous epitopes that come together upon folding into tertiary structure contribute to the nuclear import of histone proteins (9, 10) (for a review, see Refs. 11 and 12).

Proteins containing a cNLS are imported into the nucleus by the importin-{alpha}/importin-{beta} (imp-{alpha}/{beta}) import receptors (13-15). imp-{alpha} functions as the adaptor molecule between the NLS-containing protein and imp-{beta}. The ternary complex is directed by imp-{beta} to the NPC, which passes through the nuclear pore by a so-called facilitated diffusion process (16). Although the exact mechanism of nuclear import per se has not been solved, it is thought that the direction of nuclear-cytoplasmic transport is dependent on the gradient of the small Ras-related GTPase Ran protein (RanGTP) across the nuclear envelope (17-20). Alternative nuclear import pathways have been described in which the NLS-containing proteins directly bind one of the nuclear import receptors of the importin-{beta} superfamily. Heterogeneous nuclear ribonucleoproteins A1 and A2, for example, are imported by transportin (5), and histone H1 is imported by the imp-{beta}/7 heterodimer (21). The core histones and ribosomal proteins can be imported by either imp-{beta}, imp-7, imp-5 or transportin (8, 10). Recently, examples of Ran and energy- or imp-{beta}-independent nuclear transport mechanisms have been reported (22, 23).

Integrase (IN) is the retroviral protein responsible for integration of the DNA replica of the viral genome into a cell chromosome. When expressed on their own in the absence of other viral proteins, retroviral INs locate to cell nuclei and are therefore karyophilic (24-27). It has been suggested that human immunodeficiency virus type 1 (HIV-1) IN, as an essential component of the viral preintegration complex (PIC), plays a role in its nuclear import (24, 27-29). The mechanism of HIV-1 IN nuclear import, however, has not been fully elucidated. Recently, lens epithelium-derived growth factor (LEDGF/p75) has been shown to associate with HIV-1 IN in human cells (30). Using transient knock-down of endogenous LEDGF/p75 via small interfering RNA, LEDGF/p75 was shown to be both necessary and sufficient for accumulation of HIV-1 IN into the nucleus (31). Although the alternative splice variant of LEDGF/p75, p52, is also karyophilic, its nuclear distribution is different from LEDGF/p75 (31, 32). p52 did not display affinity for HIV-1 IN in vitro and did not co-localize with fluorescently tagged IN in live cells (31).

The exact cellular function of LEDGF/p75 is unknown. LEDGF/p75 was originally isolated from HeLa cell extracts as an interactor of transcriptional co-activator PC4 and was therefore suggested to play a role in transcriptional regulation (33). Singh and co-workers (34-36) subsequently reported a role for LEDGF/p75 in cellular stress response and survival. LEDGF/p75 binds to heat shock and stress-related regulatory DNA elements, and cellular expression of LEDGF/p75 was increased upon heat, oxidative, or chemical stress.

Since LEDGF/p75 was shown to be essential for the nuclear accumulation of HIV-1 IN, we characterized the nuclear import pathway of LEDGF/p75 and identified its NLS. We show that a single point mutation is sufficient to confine LEDGF/p75 and relocate HIV-1 IN to the cytoplasm.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Enhanced Green Fluorescent Protein (EGFP) and EGFP-Glutathione S-Transferase (GST) (GG) Constructs—To create pEGFP-P75/{Delta}C and pEGFP-P75/Ct, the fragments were PCR-amplified from pCP6H75 (30) using Pfu Ultra (Stratagene, La Jolla, CA) and an appropriate set of primers. The primers used were as follows: p75/{Delta}Cs, 5'-CCGAAGATCTCAACTCGCGATTTCAAACC; p75/{Delta}Cas, 5'-CGGGAATTCCTACTCAGTTTCCATTTGTTCC; p75/Cts, 5'-CCGAAGATCTCACAGCAGAATAAAGATGAAGG; p75/Ctas, 5'-CGGGAATTCCTAGTTATCTAGTGTAGAATCC. The PCR fragments were digested with BglII and EcoRI and subcloned into pEGFP-C2 (Clontech, Palo Alto, CA). The construction of pEGFP-P75 was described previously (31). The design of the EGFPGST fusion vector pGG was based on the work of Woodward et al. (26) with some modifications. A linker was added upstream and downstream of the GST reading frame, coding for a flexible peptide of alternating Gly-Ala dimers. The following primers were used: GST1, 5'-GCAAGATCTTGGGCGCGGGTGCT; GST2, 5'-GGCGCGGGTGCTGGAGCAGGAGCA; GST3, 5'-GCAGGAGCAATGTCCCCTATACTAGGTTATTGG; GST4, 5'-CACCCGCGCCATCCGATTTTGGAGGATGG; GST5, 5'-CTCCTGCTCCAGCACCCGCGCCATCCG, GST6, 5'-TGCAAGCTTTGCTCCTGCTCCAGCACC. The first PCR product was created with GST3 and GST4 primers, using pGEX-4T1 (Amersham Biosciences) as a template. The following PCR was performed on the resulting amplicon using GST2 and GST5 primers, followed by a third PCR with GST1 and GST6. After digestion with BglII and HindIII, the PCR fragment was cloned into pEGFP-C2.

To obtain pGG-P75, the EagI/BamHI fragment from pEGFP-P75 carrying the LEDGF/p75 open reading frame was subcloned between HindIII/BamHI sites of pGG (the EagI and the HindIII termini were treated with mung bean nuclease prior to BamHI digestion).

To make pGG-P75/{Delta}C and pGG-P75/Ct, the plasmids pEGFP P75/{Delta}C and pEGFP-P75/Ct were digested with BglII and treated with T4 DNA polymerase followed by BamHI restriction. The LEDGF/p75 gene fragments were then cloned between the HindIII and BamHI sites of pGG.

Missense mutations were introduced via the QuikChange procedure (Stratagene) using pGG-P75 as a template. The following constructs were made: pGG-P75A146-147 (Arg146 and Arg147 both changed to alanine residues), pGG-P75A149-150/155 (residues Arg149-Lys150 and Lys155 replaced by alanine residues; the same designation is used in the other constructs), pGG-P75A150-152/155, pGG-P75A150-152, pGG-P75A150/155, pGG-P75A155, and pGG-P75A150. Construction of pHcRed1-IN was described previously (31).

LacZ Fusion Constructs—The plasmids pGM-SV40NLS-lacZ and pGM-lacZ were made using the following primers: SVs1, 5'-AAGAGGAAGGTCCTGCAGATGCTAGATCCCGTCGTTTTACAAC; SVas, 5'-CTACTCGAGCTATTTTTGACAGGAGACCAACTGG; SVs2, 5'-CTAAAGCTTGACACCATGGGATCCCCTAAGAAAAAGAGGAAGGTCCTGCAG; LacZs, 5'-CTAAAGCTTGACACCATGGGCATGCTAGATCCCGTCGTTTTACAAC. pHR'CMVlacZ (37) was used as the template to PCR-amplify the Escherichia coli {beta}-galactosidase sequences. To build pGM-lacZ, LacZs and SVas were used as primers. For the construction of pGM-SV40NLS-lacZ, a fragment amplified using SVs1 and SVas primers was used as template in a second round of PCR with primers SVs2 and SVas. Following HindIII and XhoI digestion, the resulting PCR products were subcloned into HindIII and XhoI restriction sites of pcDNA6/V5-HisB (Invitrogen). To construct pGM-P75NLS-LacZ, the SV40 NLS coding sequence was removed from pGM-SV40NLS-lacZ by BamHI and PstI restriction and replaced by a DNA duplex, formed by oligonucleotides 5'-GATCCGGGCGTAAGCGGAAGGCTGAAAAACAACTGCA and 5'-GTTGTTTTTCAGCCTTCCGCTTACGCCCG. All plasmid constructs were verified by sequence analysis to contain no unwanted mutations.

Purification and Fluorescent Labeling of Recombinant LEDGF/p75 and LEDGF/p75A150—The bacterial expression vector pCPNat75 for expression of native LEDGF/p75 has been described (31). To produce recombinant LEDGF/p75A150, pCPN75-A150 was engineered by QuikChange (Stratagene) using pCPNat75 as template. Wild type LEDGF/p75 and the NLS mutant LEDGF/p75A150 were expressed in E. coli BL21(DE3) pLysS cells and purified as previously described for the wild type protein (31). The point mutation did not significantly influence binding of the recombinant protein to heparin-Sepharose or cation exchange resins. Both proteins were labeled using Alexa Fluor 633 succinimidyl ester (Molecular Probes, Inc., Eugene, OR) in phosphate buffer according to the manufacturer's instructions. The stoichiometry of label/protein was maintained at ≤1 during labeling.

Cell Culture and Transfections—HeLa cells were grown in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum, 100 IU/ml of penicillin, and 100 µg/ml streptomycin (Invitrogen) at 37 °C in a 5% C02 humidified atmosphere. HeLa cells were seeded 1 day prior to transfection into 8-well LabTek chambered cover glass cuvettes. Transfection was performed at ~80% confluence with LipofectAMINE 2000 (Invitrogen) using 0.36 µg of plasmid DNA.

Staining with 5-bromo-4-chloro-3-indolyl-{beta}-galactopyranoside (X-gal; Invitrogen) was performed 24 h post-transfection. Cells were fixed in 1% formaldehyde, 0.2% glutaraldehyde in phosphate-buffered saline for 5 min, rinsed twice with phosphate-buffered saline, and stained with 0.4 mg/ml X-Gal in phosphate-buffered saline containing 4 mM potassium ferrocyanide, 4 mM potassium ferricyanide, and 2 mM MgCl2.

Western Blot—Cells were lysed 24 h post-transfection in 20 mM Tris-HCl, pH 7.5, 5 mM EDTA, 0.1% SDS, and the total protein concentration was determined using the BCA protein assay (Pierce). Samples containing 15 µg of total protein were separated by 11% SDS-PAGE and electroblotted onto polyvinylidene difluoride membranes. Monoclonal mouse anti-LEDGF p75/p52 antibody was purchased from BD Biosciences (San Jose, CA). Horseradish peroxidase-conjugated secondary goat anti-mouse antibody was from Dako (DakoCytomation California Inc., Carpenteria, CA). Detection was carried out using ECL+ chemiluminescent horseradish peroxidase substrate (Amersham Biosciences).

Semipermeabilized Cells—Rabbit reticulocyte lysate was purchased from Promega (Madison, WI). After ultracentrifugation at 100,000 x g, the lysate was extensively dialyzed against transport buffer (TB, 20 mM Hepes, pH 7.3, 110 mM potassium acetate, 2 mM magnesium acetate, 1 mM EGTA, 2 mM dithiotreitol, 1 µg/ml each aprotinin, leupeptin, and pepstatin, and 1 mM phenylmethylsulfonyl fluoride) in a Pierce dialysis cassette with a 10-kDa molecular weight cut-off. The in vitro import assay in semipermeabilized cells was based on methods described in Ref. 38. HeLa cells were seeded on LabTek coverslip cuvettes and used at ~50-60% confluence. Cells were washed twice in ice-cold TB and permeabilized in 40 µg/ml digitonin in TB on ice for 5 min. The endogenous cytosol was depleted by washing in ice-cold TB. Import reactions were incubated at 37 °C for 30 min and contained 50% rabbit reticulocyte lysate (v/v), an energy-regenerating system (1 mM ATP, 1 mM GTP, 10 mM creatine phosphate, 20 units/ml creatine phosphokinase (Sigma)), and an import substrate in TB. Sulforhodamine B-labeled bovine serum albumin-conjugated NLS (henceforth referred to as SV40-NLS substrate) carrying the SV40 large T antigen NLS was purchased from Sigma. The SV40-NLS substrate was added to the import mixture at a final concentration of 120 µg/ml. Alexa 633-labeled LEDGF/p75 and LEDGF/p75A150 were added at a final concentration of 100 µg/ml. To test GTP dependence, GTP was omitted, and 1 mM GTP{gamma}S (Sigma) was added. ATP dependence was tested by replacing ATP with 1 mM AMP-PNP (Sigma). Competition experiments were carried out adding a 5-fold excess of unlabeled substrate. Active nuclear import was inhibited using 50 µg/ml wheat germ agglutinin (WGA) (Biomeda, Foster City, CA) in TB. Cells were incubated for 30 min with WGA at 37 °C and rinsed once in TB prior to incubation with the import mixture. For reconstitution experiments, a Ran mixture containing 3 µM Ran (Jena Bioscience, Jena, Germany) and 0.5 µM nuclear transport factor 2 (Sigma) in TB was used, with or without 1 µM import receptors imp-{alpha} (human) and imp-{beta} (Drosophila melanogaster) (Jena Biosciences). The import was terminated by washing cells with ice-cold TB followed by fixation in 2% formaldehyde (in phosphate-buffered saline). Slides were mounted in 50% glycerol.

Laser-scanning Microscopy—Confocal microscopy was performed using the Bio-Rad MRC-1024 microscope, interfaced with the Zeiss Axiovert microscope. All single- and two-color images were acquired in 1024 x 1024 resolution mode, using a x 63 water immersion objective. EGFP was excited at 488 nm, rhodamine and HcRed1 at 568 nm, and Alexa 633 at 647 nm.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
Computer Analysis—LEDGF/p75 and its smaller splice variant p52 are karyophilic (30-32). LEDGF/p75 contains about 21% basic residues, which makes it difficult to reliably predict a NLS from the primary sequence. Thus, we turned to computer prediction programs, first using NUCDISC from the PSORT II server (available on the World Wide Web at psort.nibb.ac.jp) (39, 40), which looks for canonical NLSs using the patterns shown in Table I. PSORT II uses the k-nearest neighbor algorithm to score putative NLSs (41). Six putative NLSs within LEDGF/p75 were predicted (Table I). We also used the PredictNLS program provided by the Columbia University Bioinformatics Center (available on the World Wide Web at cubic.bioc.columbia.edu/cgi/var/nair/resonline.pl) (42), which searches for possible NLSs by comparing the protein sequence with a data base composed of experimentally determined NLSs expanded with "in silico mutagenesis"-created NLS motifs. Two overlapping NLSs were predicted by PredictNLS, both classified as SV40-like canonical NLSs (Table I).


View this table:
[in this window]
[in a new window]
  		TABLE I
Computer prediction of putative NLSs in LEDGF/p75

 
The NLS of LEDGF/p75 Is Contained within the 325 N-terminal Amino Acid Residues—The LEDGF gene encodes for two alternative splice products, p75 and p52, which contain the same sequence over their N-terminal 325 amino acids (33). Since both LEDGF/p75 and p52 are karyophilic (31, 32), we reasoned that the NLS must be confined within the first 325 residues. A pair of deletion mutants was constructed to test our prediction. pEGFP-P75/{Delta}C and pEGFP-P75/Ct encoded for amino acids 1-325 and 326-530 of LEDGF/p75, respectively, fused to the C terminus of EGFP. Confocal microscopy of transiently transfected HeLa cells illustrated that full-length LEDGF/p75 fused to EGFP, EGFP-p75, exhibited a typical heterogeneous distribution pattern in the nucleus and was excluded from the nucleoli (Fig. 1A), as was previously reported (31, 32). EGFP-p75/{Delta}C was also concentrated in the nucleus and had a distribution pattern indistinguishable from the full-length LEDGF/p75 protein (Fig. 1B). EGFP-p75/Ct, however, was dispersed throughout the whole cell with somewhat higher concentration in the nucleus, but the nuclear distribution did not reveal the heterogeneous pattern typical of the full-length protein and EGFP-p75/{Delta}C (Fig. 1C). Since these EGFP-fused proteins have molecular weights near the exclusion limit of the NPC (64 kDa for EGFP-p75/{Delta}C and 51 kDa for EGFP-p75/Ct), the deletion mutants and full-length LEDGF/p75 were incorporated into a larger protein, EGFP fused to GST (starting mass 54.6 kDa; abbreviated as GG). As can be seen in Fig. 1E, GG-p75/Ct was excluded from the nucleus, as was GG (data not shown), whereas both the full-length protein (GG-p75; Fig. 2A) and the GG-p75/{Delta}C (Fig. 1D) were nuclear localized. Therefore, a NLS resides within the amino-terminal 325 residues of LEDGF/p75. The NLS predicted by PSORT II at amino acid position 509 (KKKP; see Table I) therefore does not play a role in the nuclear localization of LEDGF/p75.



View larger version (20K):
[in this window]
[in a new window]
  		FIG. 1.
The C-terminal domain of LEDGF/p75 is dispensable for nuclear localization and does not carry a functional NLS. Cells expressing EGFP-p75 (A), EGFP-p75/{Delta}C (B), EGFP-p75/Ct (C), GG-p75/{Delta}C (D), and GG-p75/Ct (E). The deletion mutant lacking the C-terminal domain of LEDGF/p75 exhibits a nuclear distribution pattern equal to full-length LEDGF/p75. The C-terminal region however is not able to transfer the GG fusion protein to the nucleus and is thus dispensable for the nuclear localization of LEDGF/p75.

 



View larger version (33K):
[in this window]
[in a new window]
  		FIG. 2.
Identification of 148GRKRKAEKQ156 as the functional LEDGF/p75 NLS. Intracellular distribution of the GG-LEDGF/p75 fusion (A) or its mutants R146A/R147A (B), K150A/R151A/K152A/K155A (C), K150A/R151A/K152A (D), R149A/K150A/K155A (E), and K150A/K155A (F). Residues 146 and 147 are dispensable for nuclear localization of LEDGF/p75 (B). Lys and/or Arg to Ala mutations in the 148-156 amino acid stretch, however, rendered LEDGF/p75 cytoplasmic (C-F).

 
Site-directed Mutagenesis of the Putative LEDGF/p75 NLS—On the basis of our deletion analysis and the computer-predicted NLSs, six putative sequences remained to be analyzed. Since one putative NLS recurred in both prediction programs, we first analyzed site-directed mutants centered around Arg149 in the 146-156 amino acid stretch of LEDGF/p75 (Table I), in which Lys and/or Arg residues were changed to Ala (Figs. 2 and 3). The mutations were introduced in the pGG-P75 vector. GG-p75, with a predicted molecular mass of ~115 kDa, far exceeds the exclusion limit for free diffusion through the NPC. We first constructed pGG-P75A146-147 in which Arg146 and Arg147 were both changed to Ala. Transient expression in HeLa cells showed that altering these two arginines did not affect the nuclear localization of LEDGF/p75 (Fig. 2B). We then made the following set of mutants: pGG-P75A150-152/155 (Fig. 2C), pGG-P75A150-152 (Fig. 2D), pGG-P75A149-150/155 (Fig. 2E), and pGG-P75A150/155 (Fig. 2F). All of these LEDGF/p75/NLS mutants were excluded from the nucleus upon transient expression in HeLa cells (Fig. 2, C-F). From this, we deduced that Lys150 and/or Lys155 were critical for nuclear localization (Fig. 3A). We therefore introduced single point mutations K150A and K155A into the expression construct. Transient expression in HeLa cells of GG-p75A150 and GG-p75A155 revealed that Lys150 was essential for LEDGF/p75 nuclear localization under conditions wherein Lys155 was dispensable (Fig. 3B). All nuclear import-defective LEDGF/p75 mutants showed a diffuse cytoplasmic distribution with varying levels of aggregation (e.g. see Figs. 2F and 3B). Western blot analysis using monoclonal anti-LEDGF/p75 antibody showed that the NLS mutants were all efficiently expressed in HeLa cells and had apparent molecular masses close to the predicted 115 kDa (Fig. 3C).



View larger version (34K):
[in this window]
[in a new window]
  		FIG. 3.
Lys150 is essential for nuclear import of LEDGF/p75. A, summary of the changes (in boldface type) from Fig. 2 that inhibited nuclear localization of LEDGF/p75. Two residues, Lys150 and/or Lys155, might be essential for LEDGF/p75 import. B, the single K150A mutation rendered GG-p75 cytoplasmic, whereas the K155A mutation did not affect the intracellular distribution of LEDGF/p75. C, Western blot analysis of transiently expressed GG-LEDGF/p75 mutants in HeLa cells. Expression was analyzed 24 h post-transfection by Western blot using monoclonal anti-LEDGF/p75 antibody. 15 µg of total protein was loaded in each well. Shown are nontransfected cells (lane 1) and cells expressing GG-p75 (lane 2) or its mutant derivatives K150A/R151A/K152A (lane 3), R149A/K150A/K155A (lane 4), K150A/R151A/K152A/K155A (lane 5), K150A (lane 6), K150A/K155A (lane 7), R146A/R147A (lane 8), and K155A (lane 9). The migration positions of mass standards are indicated on the left. The positions of GG-p75 and endogenous LEDGF/p75 are on the right. The protein that migrated slightly slower than the 62-kDa marker is likely to represent a minor degradation product of GG-p75.

 
Co-expression of pGG-p75A150 Renders HIV-1 IN Cytoplasmic—As previously described (31), fusing EGFP and red fluorescent protein HcRed1 to LEDGF/p75 and HIV-1 IN, respectively, did not perturb their nuclear co-localization upon transient expression in HeLa cells. In addition, the cellular distribution of LEDGF/p75 was not changed when fused to the larger GG double fusion (Fig. 2A). As expected, upon co-expression with the HcRed1-tagged HIV-1 IN protein (HcRed1-IN), GG-p75 was co-localized with HcRed1-IN in nuclei of transfected cells (Fig. 4A). Strikingly, when HcRed1-IN was co-expressed with the NLS-defective mutant GG-p75A150, both proteins became confined to the cytoplasm, forming apparent co-aggregates (Fig. 4B). Similar patterns were observed when other GG-p75 NLS-defective mutants were co-expressed with HcRed1-IN (data not shown).



View larger version (23K):
[in this window]
[in a new window]
  		FIG. 4.
An NLS-defective LEDGF/p75 confines HIV-1 IN to the cytoplasm. A, GG-p75 and HcRed1-IN co-localize in the nuclei of transfected HeLa cells. Green, left panel, GG-p75; red, middle panel, HcRed1-IN; right panel, merged image. B, GG-p75A150 co-expressed with HcRed1-IN traps IN in the cytoplasm. Co-aggregates can be observed in both the green and red detection channels. Green, left panels, GG-p75A150; red, middle panels, HcRed1-IN; right panels, merged image.

 
The LEDGF/p75 NLS Is Transferable—We fused the LEDGF/p75 NLS, 148GRKRKAEKQ156, to the N terminus of the E. coli {beta}-galactosidase protein to test whether this sequence is sufficient to target a heterologous protein into the nucleus. Since the NLS of SV40 large T antigen is a canonical example of a transferable NLS (43), we also prepared a control construct that expressed the SV40 NLS fused to {beta}-galactosidase. Upon transient transfection of HeLa cells with both constructs and staining with X-gal, {beta}-galactosidase activity was clearly detected in the nuclei of transfected cells (Fig. 5, A and B). As expected, when wild type NLS-less protein was expressed from a control vector, {beta}-galactosidase activity was detected throughout the cells (Fig. 5C).



View larger version (42K):
[in this window]
[in a new window]
  		FIG. 5.
The NLS of LEDGF/p75 is transferable. The NLS of LEDGF/p75 (residues 148-156) or SV40 large T was fused to the N-terminus of {beta}-galactosidase, and the fusion proteins were expressed in HeLa cells. Twenty-four h post-transfection, cells were fixed and stained with X-gal. Both the LEDGF/p75 NLS (A) and the SV40 NLS (B) restricted {beta}-galactosidase activity to the nuclei of transfected cells. In contrast, cells transfected with a plasmid expressing wild type {beta}-galactosidase were stained uniformly (C).

 
Nuclear Import of LEDGF/p75 Is a Saturable and Temperature-dependent Process and Requires Ran—To characterize the nuclear import pathway of LEDGF/p75 in more detail, we used the semipermeabilized cell system (38). In this assay, the cytoplasmic membrane is first permeabilized with digitonin, and the soluble endogenous cytosolic factors are depleted. Nuclear import of a fluorescently labeled protein can then be studied in the presence of exogenous nuclear import factors. We initially used a rabbit reticulocyte lysate as the complete source for the import factors (38). In the presence of the reticulocyte lysate, ATP, GTP, and an energy regenerating system, both Alexa 633-labeled recombinant LEDGF/p75 and rhodamine-labeled SV40-NLS substrates were readily imported into nuclei (Fig. 6A). Import was not observed when the reticulocyte lysate was omitted from the mixture (Fig. 6A). This result demonstrates that import of LEDGF/p75 is dependent on soluble cellular factors. The lectin WGA inhibits many nuclear transport mechanisms without affecting passive diffusion through the NPC by binding to N-acetylglucosamine-modified nucleoporins (44, 45). When we pretreated digitonin-permeabilized HeLa cells with 50 µg/ml WGA prior to the addition of LEDGF/p75 or bovine serum albumin-SV40 NLS to the import mixture, no nuclear import was detected (Fig. 6A). In addition, nuclear import was not observed at 4 °C or when the ATP-regenerating system was absent and ATP was replaced by nonhydrolyzable AMP-PNP (Fig. 6A). Importantly, an excess of unlabeled recombinant LEDGF/p75 was able to compete with the fluorescent LEDGF/p75 conjugate for import, which proves that nuclear import of LEDGF/p75 is a saturable process (Fig. 6B).



View larger version (46K):
[in this window]
[in a new window]
  		FIG. 6.
Nuclear import of LEDGF/p75 is a saturable process that depends on cytosolic factors and occurs in a temperature-, Ran-, GTP-, and energy-dependent manner. Upon permeabilization of the plasma membrane and depletion of soluble cytosolic factors, cells were incubated with import mixtures containing 1 mM GTP, an energy-regenerating system, rabbit reticulocyte lysate, and fluorescently labeled import substrate in transport buffer. A, 100 µg/ml Alexa 633-labeled LEDGF/p75 (upper panels) or 120 µg/ml rhodamine-labeled SV40-NLS substrate (lower panels)(+). Import buffer, the rabbit reticulocyte lysate was omitted. WGA, cells were pretreated with WGA before the addition of the import mixture. 4 °C, nuclear import was performed at 4 °C. AMP-PNP, ATP and the energy-regenerating system was omitted and replaced by 1 mM AMP-PNP. After incubation, cells were washed once in transport buffer, fixed, and studied by confocal fluorescent microscopy. B, nuclear import of fluorescently labeled LEDGF/p75 was performed in the absence (+) or presence of a 5-fold molar excess of unlabeled LEDGF/p75 (+ LEDGF/p75). C, fluorescently labeled LEDGF/p75 was added to the permeabilized HeLa cells in the presence of the rabbit reticulocyte lysate, 1 mM GTP, and an energy-regenerating system (+). RanQ69L, 3 µM RanQ69L was included in the reaction mixture. GTP-{gamma}-S, GTP{gamma}S (1 mM) was substituted for GTP.

 
Nuclear import mediated by cNLSs is dependent on a gradient of RanGTP across the nuclear envelope. imp-{beta} can only bind cargo in the cytoplasm if it is released from RanGTP via GTP hydrolysis. At the same time, imp-{beta} can only release its cargo in the nucleus by binding to RanGTP. Therefore, imp-{beta}-mediated import pathways are inhibited by RanQ69L, a Ran mutant incapable of hydrolyzing GTP (46). Similarly, nonhydrolyzable analogues of GTP, like GTP{gamma}S, also inhibit cNLS-dependent import (47, 48). Fig. 6C demonstrates that nuclear accumulation of LEDGF/p75 was dependent on RanGTP, since import was not detected when RanQ69L was added to the import mixture or when GTP was replaced by GTP{gamma}S.

LEDGF/p75 Is Imported into the Nucleus through the imp- {alpha}/{beta} Pathway—Nuclear import of SV40 large T requires both imp-{alpha} and imp-{beta} nuclear transport receptors. The results described above showed that LEDGF/p75 contains a SV40-like NLS and is imported into the nucleus in a temperature- and energy-dependent, saturable manner. Its dependence on Ran and GTP suggested that nuclear import of LEDGF/p75 most likely occurs through the imp-{beta} transport receptor. To investigate whether nuclear import of LEDGF/p75 might occur via the same mechanism as SV40 large T, we performed the following competition experiments (Fig. 7B). A 5-fold molar excess of unlabeled LEDGF/p75 was allowed to interact with the import receptors prior to the addition of the rhodamine-conjugated SV40-NLS substrate. Fig. 7B shows that the SV40-NLS substrate was not imported under these conditions. As a control, we analyzed purified NLS mutant LEDGF/p75A150 protein. As predicted, Alexa 633-labeled mutant protein was exclusively cytoplasmic at conditions that supported the ready transport of wild-type LEDGF/p75 (Fig. 7A). Consistent with this observation, the mutant protein was unable to compete with the SV40-NLS substrate for its nuclear import (Fig. 7B).



View larger version (57K):
[in this window]
[in a new window]
  		FIG. 7.
LEDGF/p75 competes with the SV40-NLS substrate for nuclear import. A, digitonin-permeabilized HeLa cells were incubated for 30 min at 37 °C in the presence of rabbit reticulocyte lysate, 1 mM GTP, and an energy-regenerating system and Alexa 633-labeled LEDGF/p75 (left panel) or LEDGF/p75A150 (right panel) protein. B, a 5-fold molar excess of unlabeled wild type LEDGF/p75 or K150A mutant was preincubated with the rabbit reticulocyte lysate in the presence of 1 mM GTP and an energy-regenerating system during 30 min on ice, prior to the addition of rhodamine-labeled SV40-NLS substrate.

 
Proteins containing basic NLSs can be imported into the nucleus by imp-{beta} either with (13) or without (49) the adaptor molecule imp-{alpha}. Another imp-{beta}-like receptor, imp-7, has been implicated in the nuclear import of the highly positively charged linker histone H1. However, a heterodimer of imp-7 with imp-{beta} was required for H1 nuclear import (21). We used a reconstitution assay to determine whether both imp-{alpha} and imp-{beta} were required for LEDGF/p75. Ran GTPase alone or Ran and imp-{beta} (Fig. 8) were insufficient to import LEDGF/p75 into the nucleus. It was only upon the addition of both imp-{alpha} and imp-{beta} to the Ran mixture that nuclear import of LEDGF/ p75 was detected, as was the case for the SV40-NLS substrate (Fig. 8).



View larger version (28K):
[in this window]
[in a new window]
  		FIG. 8.
LEDGF/p75 is imported into the nucleus through the imp-{alpha}/{beta} pathway. Reconstitution experiments were performed in transport buffer (control), with Ran mixture (3 µM RanGDP and 0.5 µM nuclear transport factor 2) (Ran), plus the addition of 1 µM imp-{beta} ({beta}) or a 1 µM concentration of each imp-{alpha} and imp-{beta} ({alpha} + {beta}) with 100 µg/ml LEDGF/p75 (upper panels) or 120 µg/ml of the SV40-NLS substrate (lower panels) as a nuclear import substrate. Nuclear import of both LEDGF/p75 and SV40-NLS could only be detected when Ran, imp-{alpha}, and imp-{beta} were present.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
Identification and Characterization of the LEDGF/p75 NLS—LEDGF/p75 and its splice variant p52 are karyophilic proteins (30-32). Although both proteins are nuclear, they each have a markedly different spatial and temporal distribution in the nucleus (31, 32). LEDGF/p75 and p52 share 325 N-terminal residues (33). p52 has a unique 8-amino acid tail not present in LEDGF/p75, which does not contain an NLS-like pattern. Thus, at least one NLS was expected to reside within the N-terminal 325 residues of LEDGF/p75. Expression of GG-p75/{Delta}C and GG-p75/Ct deletion mutants in HeLa cells demonstrated that the C-terminal domain of LEDGF/p75 was not karyophilic and therefore does not contain a functional NLS (Fig. 2). Moreover, since the {Delta}C mutant of LEDGF/p75 had a nuclear distribution pattern indistinguishable from the full-length LEDGF/p75, we speculate that it is not the lack of this C-terminal domain in p52 but rather the presence of the extra 8 amino acid residues that determines the specific nuclear distribution of p52. The function of the C-terminal domain of LEDGF/p75 remains to be determined. It has recently been suggested that it might play a role in the interaction of LEDGF/p75 with HIV-1 IN (31).

Computer analysis of the amino acid sequence predicted several putative NLSs within LEDGF/p75 (Table I). Through site-directed mutagenesis, we identified a single functional NLS in LEDGF/p75, 148GRKRKAEKQ156. Remarkably, a single amino acid change, K150A, was sufficient to block LEDGF/p75 nuclear localization and, as a consequence, redistribute the mutant protein to the cytoplasm (Fig. 3). We therefore conclude that this single NLS of the eight predicted NLSs functions as a true NLS. We do note, however, that 24 h post-transfection, weak nuclear staining could be detected in about 2-5% of the cells expressing GG-p75A150 (or any other NLS mutant deficient in targeting GG-p75 to the nucleus) with a pattern similar to the nonmutated LEDGF/p75. We speculate that this low level of nuclear localization was a consequence of mitosis, wherein mutant proteins can bind to mitotic chromosomes following breakdown of the nuclear envelope and subsequently become captured in the nuclei. Compared with 100% nuclear import of wild type LEDGF/p75, this low level of mutant protein import does not affect our conclusions. LaCasse and Lefebvre (50) reported that in 67% of proteins that possess both DNA binding and NLS activities, the NLS overlaps with the DNA binding sequence. Cokol et al. (42) extended the data base search and expanded this number to 90%. Since NLS mutant LEDGF/p75 displayed the wild type distribution in the few cells that supported nuclear import, we speculate that the LEDGF/p75 NLS may not overlap with the protein's DNA binding region(s).

Since transference of the LEDGF/p75 NLS onto the otherwise cytoplasmic {beta}-galactosidase conferred nuclear localization to the E. coli protein (Fig. 5), we conclude that the LEDGF/p75 NLS is a linear epitope and is thus not composed of discontinuous epitopes coming together in the tertiary structure of the protein. Indeed, no specific secondary structure was predicted between residues 147 and 170 by various computer algorithms (data not shown).

LEDGF/p75 Makes Use of the imp-{alpha}/{beta} Nuclear Import Pathway—Using digitonin-permeabilized HeLa cells, we showed that LEDGF/p75 was transported into the nucleus in an active, energy-dependent fashion. Indeed, nuclear accumulation of LEDGF/p75 was efficiently blocked by WGA and did not occur at 4 °C or in the absence of ATP (Fig. 6). Moreover, the NLS-defective K150A mutant failed to be imported in the in vitro system, suggesting that import in semipermeabilized cells and live cells occurred through functionally similar pathways. Since the K150A and wild-type LEDGF/p75 proteins displayed similar purification profiles, our results exclude the possibility that a potential bacterial contaminant affected the observed in vitro nuclear localization profiles.

LEDGF/p75 nuclear import was inhibited when mutant RanQ69L was added to the import mixture or when GTP was replaced by GTP{gamma}S, which implies the function of an imp-{beta} like transport receptor (18, 19, 51). Using a nuclear import reconstitution assay, we demonstrated the dependence of LEDGF/p75 on both imp-{alpha} and imp-{beta} for its nuclear localization (Fig. 8).

Nuclear Import of HIV-1 IN—Lentiviruses, in contrast to oncoretroviruses, can infect nondividing cells (52-55). The obvious requirement for productive infection of a nondividing cell is the presence of a nuclear targeting signal within the PIC. It was reported that the PIC is imported into the nucleus in an active, energy-dependent manner (56). The mechanism of lentiviral PIC nuclear import, however, has not been established. Viral proteins Vpr, matrix, and IN as well as the central DNA flap structure have been implicated in HIV nuclear import (24, 28, 57-62). Subsequent research revealed that matrix lacks an NLS and is not strictly required for infection of macrophages (63, 64). Moreover, Vpr was shown not to be essential for PIC import and virus replication in nondividing cells (63, 65, 67). In addition, the central DNA flap appears to be host cell- and viral strain-dependent (68, 69). IN is an obligatory component of the PIC and must be associated with it throughout the translocation event. Several groups suggested that IN might be the important nuclear targeting factor of the PIC. Gallay et al. (28) described a bipartite NLS in HIV-1 IN. Site-directed mutagenesis in the region of this bipartite NLS, however, did not abolish the nuclear localization of EGFP-fused HIV-1 IN (29). Depienne et al. (59) supported these observations by showing that each part of the putative bipartite NLS did not function in a transferable fashion. It has been suggested that the Y143G mutation in IN might affect the nuclear transport function of the PIC, but no effect on the karyophilic properties of the protein itself was observed (29). Armon-Omer et al. (70) suggested that the 161-173 amino acid stretch in HIV-1 IN comprises a functional NLS, since it displayed some karyophilic properties when fused to bovine serum albumin. However, these data are at odds with previously reported results that this putative NLS was not transferable in live cells (68) and that mutations in this region of IN did not abolish nuclear import of the PIC (68, 71).

Devroe et al. (72) demonstrated that fusing IN to a nuclear export signal was not sufficient to abolish nuclear localization of the constitutively expressed HIV-1 protein. This result suggested that HIV-1 IN was trapped in the nucleus, possibly through association with chromatin or direct binding to DNA. Recently, it was reported that HIV-1 IN nuclear accumulation was dependent on the presence of endogenous LEDGF/p75 protein (31). It was suggested that LEDGF/p75 protein residing in the nucleus might capture HIV-1 IN upon its entrance and then tether the viral protein to chromatin (30, 31). Alternatively, active nuclear import of cytoplasmic LEDGF/p75-IN complexes was also hypothesized. In the present study, we confirmed that HIV-1 IN requires LEDGF/p75 for its nuclear localization. We showed that a single amino acid change in the NLS motif of LEDGF/p75 was able to relocate HIV-1 IN to the cytoplasm, corroborating the hypothesis that interaction between HIV-1 IN and LEDGF/p75 can occur in the cytoplasm. According to Görlich and co-workers (73), importins act both as import receptors and as chaperones shielding exposed positively charged domains of cargo proteins. Thus, it was not surprising that disrupting interactions with nuclear import receptors (by mutating the LEDGF/p75 NLS) led to cytoplasmic aggregation of LEDGF/p75-IN complexes.

Several groups have tried to identify the nuclear import pathway used by HIV-1 IN and PICs. The role of the imp-{alpha}/{beta} pathway in HIV-1 nuclear import was suggested by several groups (28, 60, 66, 74). Recently, Fassati et al. (74) reported that HIV-1 PICs were imported into the nuclei of HeLa cells and macrophages in the presence of imp-7 and Ran and that import was increased in the presence of imp-{beta}. They also reported that recombinant HIV-1 IN can be imported in semipermeabilized cells selectively by the imp-{alpha}/{beta} pathway; however, import could also be supported by the imp-{beta}/7 heterodimer (74). On the other hand, Depienne et al. (59) reported that HIV-1 IN was imported into the nuclei of semipermeabilized cells using an uncharacterized ATP-dependent but GTP- and Ran-independent mechanism. Strikingly, the addition of cytosolic factors was not required, suggesting that the necessary import receptors remained in those digitoninpermeabilized cells (59).

In our hands, fluorescently labeled recombinant HIV-1 IN readily accumulated in the nuclei of semipermeabilized cells in a temperature-, GTP-, and ATP-dependent fashion (data not shown). We wondered whether LEDGF/p75 would promote the nuclear import of IN in this in vitro system. When LEDGF/p75 was allowed to form complexes with IN prior to the addition to the import mixture, nuclear accumulation of IN was not enhanced. Although the exact stoechiometry of the IN·LEDGF/p75 complex was not reported, its size was estimated at around 300 kDa, probably containing a pair of IN tetramers (30). If a couple of imp-{alpha}/{beta} heterodimers (~150 kDa) were bound to the IN·LEDGF/p75 complex, the size of the cargo-importin complex would exceed 500 kDa. We speculate that import of large IN·LEDGF/p75 complexes might require specific isoforms of imp-{alpha} and/or imp-{beta} families, which were not functionally present in our in vitro assay. Alternatively, the structure of the NPC might be altered in the digitonin-permeabilized cell system, effectively precluding the efficient nuclear import of large protein complexes.

Multiple elements of the HIV-1 PIC have been proposed as essential for its nuclear localization, which could potentially work in an additive and/or interdependent fashion. It is not uncommon that proteins or complexes make use of several nuclear import pathways (8, 10). This would be beneficial for the virus, since one mutation abolishing an interaction with one nuclear import receptor would still allow the virus to gain the nuclear environment through an alternative pathway.

In conclusion, we mapped the nuclear targeting signal in the LEDGF/p75 protein to the short peptide (148GRKRKAEKQ156) and showed that it functioned similarly to the SV40 large T NLS in a RanGTP- and imp-{alpha}/{beta}-dependent manner. We demonstrated that one single amino acid change, K150A, in LEDGF/p75 was sufficient to abolish the nuclear localization of the mutant protein and co-expressed HIV-1 IN. However, the specific importin-{alpha}/{beta} isoforms involved in nuclear import of LEDGF/p75 and/or in its complex with HIV-1 IN are yet to be identified. Experiments are under way to establish the precise role of this cellular factor in retroviral replication.


   FOOTNOTES
 
* This work was funded by National Institutes of Health Grant AI52014 (to A. E.). Work at the KULeuven was financially supported by the SBO program from the IWT Flanders (Belgium). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

|| An Aspirant of the Fund for Scientific Research (Fonds voor Wetenschappelijk Onderzoek) Flanders. Back

{ddagger}{ddagger} To whom correspondence should be addressed. Tel.: 617-632-4361; Fax: 617-632-3113; E-mail: Alan_Engelman{at}dfci.harvard.edu.

1 The abbreviations used are: NPC, nucleopore complex; AMP-PNP, 5'-adenylimidodiphosphate; NLS, nuclear localization signal; cNLS, classical NLS; EGFP, enhanced green fluorescent protein; GG, EGFPGST fusion; GST, glutathione S-transferase; GTP{gamma}S, guanosine 5'-O-(3-thiotriphosphate); HcRed1-IN, HcRed1-tagged HIV-1 IN; HIV-1, human immunodeficiency virus type 1; imp-{alpha}, -{beta}, and -7, importin-{alpha}, -{beta}, and -7; IN, integrase; LEDGF, lens epithelium-derived growth factor; PIC, preintegration complex; WGA, wheat germ agglutinin; X-gal, 5-bromo-4-chloro-3-indolyl-{beta}-galactopyranoside; RanGTP, Ras-related GTPase Ran protein; TB, transport buffer. Back


   ACKNOWLEDGMENTS
 
Fluorescence microscopy was performed at the Confocal Microscopy Core Facility of the Brigham and Women's Hospital (Boston, MA). We thank Dr. Philip G. Allen for technical assistance and helpful discussions.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Mattaj, I. W., and Englmeier, L. (1998) Annu. Rev. Biochem. 67, 265-306[CrossRef][Medline] [Order article via Infotrieve]
  2. Kalderon, D., Richardson, W. D., Markham, A. F., and Smith, A. E. (1984) Nature 311, 33-38[CrossRef][Medline] [Order article via Infotrieve]
  3. Lanford, R. E., and Butel, J. S. (1984) Cell 37, 801-813[CrossRef][Medline] [Order article via Infotrieve]
  4. Dingwall, C., Robbins, J., Dilworth, S. M., Roberts, B., and Richardson, W. D. (1988) J. Cell Biol. 107, 841-849[Abstract/Free Full Text]
  5. Pollard, V. W., Michael, W. M., Nakielny, S., Siomi, M. C., Wang, F., and Dreyfuss, G. (1996) Cell 86, 985-994[CrossRef][Medline] [Order article via Infotrieve]
  6. Siomi, H., and Dreyfuss, G. (1995) J. Cell Biol. 129, 551-560[Abstract/Free Full Text]
  7. Weighardt, F., Biamonti, G., and Riva, S. (1995) J. Cell Sci. 108, 545-555[Abstract]
  8. Jakel, S., and Gorlich, D. (1998) EMBO J. 17, 4491-4502[CrossRef][Medline] [Order article via Infotrieve]
  9. Schwamborn, K., Albig, W., and Doenecke, D. (1998) Exp. Cell Res. 244, 206-217[CrossRef][Medline] [Order article via Infotrieve]
  10. Baake, M., Bauerle, M., Doenecke, D., and Albig, W. (2001) Eur. J. Cell Biol. 80, 669-677[CrossRef][Medline] [Order article via Infotrieve]
  11. Christophe, D., Christophe-Hobertus, C., and Pichon, B. (2000) Cell Signal. 12, 337-341[CrossRef][Medline] [Order article via Infotrieve]
  12. Hicks, G. R., and Raikhel, N. V. (1995) Annu. Rev. Cell Dev. Biol. 11, 155-188[CrossRef][Medline] [Order article via Infotrieve]
  13. Gorlich, D., Kostka, S., Kraft, R., Dingwall, C., Laskey, R. A., Hartmann, E., Prehn, S., Moroianu, J., Blobel, G., and Radu, A. (1995) Curr. Biol. 5, 383-392[CrossRef][Medline] [Order article via Infotrieve]
  14. Moroianu, J., Blobel, G., and Radu, A. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 2008-2011[Abstract/Free Full Text]
  15. Moroianu, J., Hijikata, M., Blobel, G., and Radu, A. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 6532-6536[Abstract/Free Full Text]
  16. Ribbeck, K., and Gorlich, D. (2001) EMBO J. 20, 1320-1330[CrossRef][Medline] [Order article via Infotrieve]
  17. Bischoff, F. R., and Ponstingl, H. (1995) Methods Enzymol. 257, 135-144[Medline] [Order article via Infotrieve]
  18. Bischoff, F. R., and Gorlich, D. (1997) FEBS Lett. 419, 249-254[CrossRef][Medline] [Order article via Infotrieve]
  19. Gorlich, D., Pante, N., Kutay, U., Aebi, U., and Bischoff, F. R. (1996) EMBO J. 15, 5584-5594[Medline] [Order article via Infotrieve]
  20. Ribbeck, K., Lipowsky, G., Kent, H. M., Stewart, M., Gorlich, D., and Bischoff, F. R. (1998) EMBO J. 17, 6587-6598[CrossRef][Medline] [Order article via Infotrieve]
  21. Jakel, S., Albig, W., Kutay, U., Bischoff, F. R., Schwamborn, K., Doenecke, D., and Gorlich, D. (1999) EMBO J. 18, 2411-2423[CrossRef][Medline] [Order article via Infotrieve]
  22. Miyamoto, Y., Hieda, M., Harreman, M. T., Fukumoto, M., Saiwaki, T., Hodel, A. E., Corbett, A. H., and Yoneda, Y. (2002) EMBO J. 21, 5833-5842[CrossRef][Medline] [Order article via Infotrieve]
  23. Huber, J., Dickmanns, A., and Luhrmann, R. (2002) J. Cell Biol. 156, 467-479[Abstract/Free Full Text]
  24. Depienne, C., Roques, P., Creminon, C., Fritsch, L., Casseron, R., Dormont, D., Dargemont, C., and Benichou, S. (2000) Exp. Cell Res. 260, 387-395[CrossRef][Medline] [Order article via Infotrieve]
  25. Kukolj, G., Jones, K. S., and Skalka, A. M. (1997) J. Virol. 71, 843-847[Abstract]
  26. Woodward, C. L., Wang, Y., Dixon, W. J., Htun, H., and Chow, S. A. (2003) J. Virol. 77, 4516-4527[Abstract/Free Full Text]
  27. Pluymers, W., Cherepanov, P., Schols, D., De Clercq, E., and Debyser, Z. (1999) Virology 258, 327-332[CrossRef][Medline] [Order article via Infotrieve]
  28. Gallay, P., Hope, T., Chin, D., and Trono, D. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 9825-9830[Abstract/Free Full Text]
  29. Tsurutani, N., Kubo, M., Maeda, Y., Ohashi, T., Yamamoto, N., Kannagi, M., and Masuda, T. (2000) J. Virol. 74, 4795-4806[Abstract/Free Full Text]
  30. Cherepanov, P., Maertens, G., Proost, P., Devreese, B., Van Beeumen, J., Engelborghs, Y., De Clercq, E., and Debyser, Z. (2003) J. Biol. Chem. 278, 372-381[Abstract/Free Full Text]
  31. Maertens, G., Cherepanov, P., Pluymers, W., Busschots, K., De Clercq, E., Debyser, Z., and Engelborghs, Y. (2003) J. Biol. Chem. 278, 33528-33539[Abstract/Free Full Text]
  32. Nishizawa, Y., Usukura, J., Singh, D. P., Chylack, L. T., Jr., and Shinohara, T. (2001) Cell Tissue Res. 305, 107-114[CrossRef][Medline] [Order article via Infotrieve]
  33. Ge, H., Si, Y., and Roeder, R. G. (1998) EMBO J. 17, 6723-6729[CrossRef][Medline] [Order article via Infotrieve]
  34. Singh, D. P., Fatma, N., Kimura, A., Chylack, L. T., Jr., and Shinohara, T. (2001) Biochem. Biophys. Res. Commun. 283, 943-955[CrossRef][Medline] [Order article via Infotrieve]
  35. Shinohara, T., Singh, D. P., and Fatma, N. (2002) Prog. Retin. Eye Res. 21, 341-358[CrossRef][Medline] [Order article via Infotrieve]
  36. Fatma, N., Singh, D. P., Shinohara, T., and Chylack, L. T., Jr. (2001) J. Biol. Chem. 276, 48899-48907[Abstract/Free Full Text]
  37. Naldini, L., Blomer, U., Gallay, P., Ory, D., Mulligan, R., Gage, F. H., Verma, I. M., and Trono, D. (1996) Science 272, 263-267[Abstract]
  38. Adam, S. A., Sterne-Marr, R., and Gerace, L. (1992) Methods Enzymol. 219, 97-110[CrossRef][Medline] [Order article via Infotrieve]
  39. Nakai, K., and Kanehisa, M. (1992) Genomics 14, 897-911[CrossRef][Medline] [Order article via Infotrieve]
  40. Nakai, K., and Horton, P. (1999) Trends Biochem. Sci. 24, 34-36[CrossRef][Medline] [Order article via Infotrieve]
  41. Horton, P., and Nakai, K. (1997) Proc. Int. Conf. Intell Syst. Mol. Biol. 5, 147-152[Medline] [Order article via Infotrieve]
  42. Cokol, M., Nair, R., and Rost, B. (2000) EMBO Rep. 1, 411-415[CrossRef][Medline] [Order article via Infotrieve]
  43. Yoneda, Y., Arioka, T., Imamoto-Sonobe, N., Sugawa, H., Shimonishi, Y., and Uchida, T. (1987) Exp. Cell Res. 170, 439-452[CrossRef][Medline] [Order article via Infotrieve]
  44. Wolff, B., Willingham, M. C., and Hanover, J. A. (1988) Exp. Cell Res. 178, 318-334[CrossRef][Medline] [Order article via Infotrieve]
  45. Yoneda, Y., Imamoto-Sonobe, N., Yamaizumi, M., and Uchida, T. (1987) Exp. Cell Res. 173, 586-595[CrossRef][Medline] [Order article via Infotrieve]
  46. Bischoff, F. R., Klebe, C., Kretschmer, J., Wittinghofer, A., and Ponstingl, H. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 2587-2591[Abstract/Free Full Text]
  47. Moore, M. S., and Blobel, G. (1993) Nature 365, 661-663[CrossRef][Medline] [Order article via Infotrieve]
  48. Melchior, F., Paschal, B., Evans, J., and Gerace, L. (1993) J. Cell Biol. 123, 1649-1659[Abstract/Free Full Text]
  49. Palmeri, D., and Malim, M. H. (1999) Mol. Cell. Biol. 19, 1218-1225[Abstract/Free Full Text]
  50. LaCasse, E. C., and Lefebvre, Y. A. (1995) Nucleic Acids Res. 23, 1647-1656[Free Full Text]
  51. Lounsbury, K. M., and Macara, I. G. (1997) J. Biol. Chem. 272, 551-555[Abstract/Free Full Text]
  52. Weinberg, J. B., Matthews, T. J., Cullen, B. R., and Malim, M. H. (1991) J. Exp. Med. 174, 1477-1482[Abstract/Free Full Text]
  53. Roe, T., Reynolds, T. C., Yu, G., and Brown, P. O. (1993) EMBO J. 12, 2099-2108[Medline] [Order article via Infotrieve]
  54. Lewis, P. F., and Emerman, M. (1994) J. Virol. 68, 510-516[Abstract/Free Full Text]
  55. Gartner, S., Markovits, P., Markovitz, D. M., Kaplan, M. H., Gallo, R. C., and Popovic, M. (1986) Science 233, 215-219[Abstract/Free Full Text]
  56. Bukrinsky, M. I., Sharova, N., Dempsey, M. P., Stanwick, T. L., Bukrinskaya, A. G., Haggerty, S., and Stevenson, M. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 6580-6584[Abstract/Free Full Text]
  57. Bukrinsky, M. I., Haggerty, S., Dempsey, M. P., Sharova, N., Adzhubel, A., Spitz, L., Lewis, P., Goldfarb, D., Emerman, M., and Stevenson, M. (1993) Nature 365, 666-669[CrossRef][Medline] [Order article via Infotrieve]
  58. Di Marzio, P., Choe, S., Ebright, M., Knoblauch, R., and Landau, N. R. (1995) J. Virol. 69, 7909-7916[Abstract]
  59. Depienne, C., Mousnier, A., Leh, H., Le Rouzic, E., Dormont, D., Benichou, S., and Dargemont, C. (2001) J. Biol. Chem. 276, 18102-18107[Abstract/Free Full Text]
  60. Gallay, P., Stitt, V., Mundy, C., Oettinger, M., and Trono, D. (1996) J. Virol. 70, 1027-1032[Abstract]
  61. Mahalingam, S., Collman, R. G., Patel, M., Monken, C. E., and Srinivasan, A. (1995) Virology 212, 331-339[CrossRef][Medline] [Order article via Infotrieve]
  62. Zennou, V., Petit, C., Guetard, D., Nerhbass, U., Montagnier, L., and Charneau, P. (2000) Cell 101, 173-185[CrossRef][Medline] [Order article via Infotrieve]
  63. Reil, H., Bukovsky, A. A., Gelderblom, H. R., and Gottlinger, H. G. (1998) EMBO J. 17, 2699-2708[CrossRef][Medline] [Order article via Infotrieve]
  64. Fouchier, R. A., Meyer, B. E., Simon, J. H., Fischer, U., and Malim, M. H. (1997) EMBO J. 16, 4531-4539[CrossRef][Medline] [Order article via Infotrieve]
  65. Zufferey, R., Nagy, D., Mandel, R. J., Naldini, L., and Trono, D. (1997) Nat. Biotechnol. 15, 871-875[CrossRef][Medline] [Order article via Infotrieve]
  66. Gulizia, J., Dempsey, M. P., Sharova, N., Bukrinsky, M. I., Spitz, L., Goldfarb, D., and Stevenson, M. (1994) J. Virol. 68, 2021-2025[Abstract/Free Full Text]
  67. Bouyac-Bertoia, M., Dvorin, J. D., Fouchier, R. A., Jenkins, Y., Meyer, B. E., Wu, L. I., Emerman, M., and Malim, M. H. (2001) Mol. Cell. 7, 1025-1035[CrossRef][Medline] [Order article via Infotrieve]
  68. Dvorin, J. D., Bell, P., Maul, G. G., Yamashita, M., Emerman, M., and Malim, M. H. (2002) J. Virol. 76, 12087-12096[Abstract/Free Full Text]
  69. Limon, A., Nakajima, N., Lu, R., Ghory, H. Z., and Engelman, A. (2002) J. Virol. 76, 12078-12086[Abstract/Free Full Text]
  70. Armon-Omer, A., Graessmann, A., and Loyter, A. (2004) J. Mol. Biol. 336, 1117-1128[CrossRef][Medline] [Order article via Infotrieve]
  71. Limon, A., Devroe, E., Lu, R., Ghory, H. Z., Silver, P. A., and Engelman, A. (2002) J. Virol. 76, 10598-10607[Abstract/Free Full Text]
  72. Devroe, E., Engelman, A., and Silver, P. A. (2003) J. Cell Sci. 116, 4401-4408[Abstract/Free Full Text]
  73. Jakel, S., Mingot, J. M., Schwarzmaier, P., Hartmann, E., and Görlich, D. (2002) EMBO J. 21, 377-386[CrossRef][Medline] [Order article via Infotrieve]
  74. Fassati, A., Gorlich, D., Harrison, I., Zaytseva, L., and Mingot, J. M. (2003) EMBO J. 22, 3675-3685[CrossRef][Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
K. Bartholomeeusen, F. Christ, J. Hendrix, J.-C. Rain, S. Emiliani, R. Benarous, Z. Debyser, R. Gijsbers, and J. De Rijck
Lens Epithelium-derived Growth Factor/p75 Interacts with the Transposase-derived DDE Domain of PogZ
J. Biol. Chem., April 24, 2009; 284(17): 11467 - 11477.
[Abstract] [Full Text] [PDF]

Home page
 J. Virol.Home page
M.-C. Shun, Y. Botbol, X. Li, F. Di Nunzio, J. E. Daigle, N. Yan, J. Lieberman, M. Lavigne, and A. Engelman
Identification and Characterization of PWWP Domain Residues Critical for LEDGF/p75 Chromatin Binding and Human Immunodeficiency Virus Type 1 Infectivity
J. Virol., December 1, 2008; 82(23): 11555 - 11567.
[Abstract] [Full Text] [PDF]

Home page
 Nucleic Acids ResHome page
L. M. McLane, K. F. Pulliam, S. E. Devine, and A. H. Corbett
The Ty1 integrase protein can exploit the classical nuclear protein import machinery for entry into the nucleus
Nucleic Acids Res., August 1, 2008; 36(13): 4317 - 4326.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
M. Theodore, Y. Kawai, J. Yang, Y. Kleshchenko, S. P. Reddy, F. Villalta, and I. J. Arinze
Multiple Nuclear Localization Signals Function in the Nuclear Import of the Transcription Factor Nrf2
J. Biol. Chem., April 4, 2008; 283(14): 8984 - 8994.
[Abstract] [Full Text] [PDF]

Home page
 J. Virol.Home page
E. Y. Chan, W.-J. Qian, D. L. Diamond, T. Liu, M. A. Gritsenko, M. E. Monroe, D. G. Camp II, R. D. Smith, and M. G. Katze
Quantitative Analysis of Human Immunodeficiency Virus Type 1-Infected CD4+ Cell Proteome: Dysregulated Cell Cycle Progression and Nuclear Transport Coincide with Robust Virus Production
J. Virol., July 15, 2007; 81(14): 7571 - 7583.
[Abstract] [Full Text] [PDF]

Home page
 J. Virol.Home page
K. K. Pandey, S. Sinha, and D. P. Grandgenett
Transcriptional Coactivator LEDGF/p75 Modulates Human Immunodeficiency Virus Type 1 Integrase-Mediated Concerted Integration
J. Virol., April 15, 2007; 81(8): 3969 - 3979.
[Abstract] [Full Text] [PDF]

Home page
 J. Virol.Home page
J. De Rijck, L. Vandekerckhove, R. Gijsbers, A. Hombrouck, J. Hendrix, J. Vercammen, Y. Engelborghs, F. Christ, and Z. Debyser
Overexpression of the Lens Epithelium-Derived Growth Factor/p75 Integrase Binding Domain Inhibits Human Immunodeficiency Virus Replication
J. Virol., December 1, 2006; 80(23): 11498 - 11509.
[Abstract] [Full Text] [PDF]

Home page
 J. Cell Sci.Home page
G. N. Maertens, P. Cherepanov, and A. Engelman
Transcriptional co-activator p75 binds and tethers the Myc-interacting protein JPO2 to chromatin
J. Cell Sci., June 15, 2006; 119(12): 2563 - 2571.
[Abstract] [Full Text] [PDF]

Home page
 J. Virol.Home page
S. Hamamoto, H. Nishitsuji, T. Amagasa, M. Kannagi, and T. Masuda
Identification of a Novel Human Immunodeficiency Virus Type 1 Integrase Interactor, Gemin2, That Facilitates Efficient Viral cDNA Synthesis In Vivo.
J. Virol., June 1, 2006; 80(12): 5670 - 5677.
[Abstract] [Full Text] [PDF]

Home page
 Nucleic Acids ResHome page
F. Turlure, G. Maertens, S. Rahman, P. Cherepanov, and A. Engelman
A tripartite DNA-binding element, comprised of the nuclear localization signal and two AT-hook motifs, mediates the association of LEDGF/p75 with chromatin in vivo
Nucleic Acids Res., March 20, 2006; 34(5): 1653 - 1665.
[Abstract] [Full Text] [PDF]

Home page
 J. Virol.Home page
L. Vandekerckhove, F. Christ, B. Van Maele, J. De Rijck, R. Gijsbers, C. Van den Haute, M. Witvrouw, and Z. Debyser
Transient and Stable Knockdown of the Integrase Cofactor LEDGF/p75 Reveals Its Role in the Replication Cycle of Human Immunodeficiency Virus
J. Virol., February 15, 2006; 80(4): 1886 - 1896.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
C. M. Bradley and R. Craigie
Seeing is believing: Structure of the catalytic domain of HIV-1 integrase in complex with human LEDGF/p75
PNAS, December 6, 2005; 102(49): 17543 - 17544.
[Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
P. Cherepanov, A. L. B. Ambrosio, S. Rahman, T. Ellenberger, and A. Engelman
From the Cover: Structural basis for the recognition between HIV-1 integrase and transcriptional coactivator p75
PNAS, November 29, 2005; 102(48): 17308 - 17313.
[Abstract] [Full Text] [PDF]

Home page
 J. Gen. Virol.Home page
J. Vera, V. Parissi, A. Garcia, R. Zuniga, M.-L. Andreola, A. Caumont-Sarcos, L. Tarrago-Litvak, and O. Leon
Yeast system as a model to study Moloney murine leukemia virus integrase: expression, mutagenesis and search for eukaryotic partners
J. Gen. Virol., September 1, 2005; 86(9): 2481 - 2488.
[Abstract] [Full Text] [PDF]

Home page
 J. Virol.Home page
R. Lu, H. Z. Ghory, and A. Engelman
Genetic Analyses of Conserved Residues in the Carboxyl-Terminal Domain of Human Immunodeficiency Virus Type 1 Integrase
J. Virol., August 15, 2005; 79(16): 10356 - 10368.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
S. Emiliani, A. Mousnier, K. Busschots, M. Maroun, B. Van Maele, D. Tempe, L. Vandekerckhove, F. Moisant, L. Ben-Slama, M. Witvrouw, et al.
Integrase Mutants Defective for Interaction with LEDGF/p75 Are Impaired in Chromosome Tethering and HIV-1 Replication
J. Biol. Chem., July 8, 2005; 280(27): 25517 - 25523.
[Abstract] [Full Text] [PDF]

Home page
 J. Virol.Home page
S. Sinha and D. P. Grandgenett
Recombinant Human Immunodeficiency Virus Type 1 Integrase Exhibits a Capacity for Full-Site Integration In Vitro That Is Comparable to That of Purified Preintegration Complexes from Virus-Infected Cells
J. Virol., July 1, 2005; 79(13): 8208 - 8216.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
K. Busschots, J. Vercammen, S. Emiliani, R. Benarous, Y. Engelborghs, F. Christ, and Z. Debyser
The Interaction of LEDGF/p75 with Integrase Is Lentivirus-specific and Promotes DNA Binding
J. Biol. Chem., May 6, 2005; 280(18): 17841 - 17847.
[Abstract] [Full Text] [PDF]

Home page
 J. Cell Sci.Home page
M. Vanegas, M. Llano, S. Delgado, D. Thompson, M. Peretz, and E. Poeschla
Identification of the LEDGF/p75 HIV-1 integrase-interaction domain and NLS reveals NLS-independent chromatin tethering
J. Cell Sci., April 15, 2005; 118(8): 1733 - 1743.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
Y. Sakakida, Y. Miyamoto, E. Nagoshi, M. Akashi, T. J. Nakamura, T. Mamine, M. Kasahara, Y. Minami, Y. Yoneda, and T. Takumi
Importin {alpha}/{beta} Mediates Nuclear Transport of a Mammalian Circadian Clock Component, mCRY2, Together with mPER2, through a Bipartite Nuclear Localization Signal
J. Biol. Chem., April 8, 2005; 280(14): 13272 - 13278.
[Abstract] [Full Text] [PDF]

Home page
 J. Virol.Home page
R. Lu, A. Limon, E. Devroe, P. A. Silver, P. Cherepanov, and A. Engelman
Class II Integrase Mutants with Changes in Putative Nuclear Localization Signals Are Primarily Blocked at a Postnuclear Entry Step of Human Immunodeficiency Virus Type 1 Replication
J. Virol., December 1, 2004; 78(23): 12735 - 12746.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
P. Cherepanov, E. Devroe, P. A. Silver, and A. Engelman
Identification of an Evolutionarily Conserved Domain in Human Lens Epithelium-derived Growth Factor/Transcriptional Co-activator p75 (LEDGF/p75) That Binds HIV-1 Integrase
J. Biol. Chem., November 19, 2004; 279(47): 48883 - 48892.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
279/32/33421    most recent
M404700200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Maertens, G.
Right arrow Articles by Engelman, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Maertens, G.
Right arrow Articles by Engelman, A.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2004 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement