HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 279, Issue 33, 34277-34289, August 13, 2004

This Article Abstract Full Text (PDF) All Versions of this Article: 279/33/34277    most recent M404830200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Martin, C. C. Articles by O'Brien, R. M. Search for Related Content PubMed PubMed Citation Articles by Martin, C. C. Articles by O'Brien, R. M. Social Bookmarking                      What's this?

Differential Regulation of Islet-specific Glucose-6-phosphatase Catalytic Subunit-related Protein Gene Transcription by Pax-6 and Pdx-1^*

Cyrus C. Martin, James K. Oeser, and Richard M. O'Brien

From the Department of Molecular Physiology and Biophysics, Vanderbilt University Medical School, Nashville, Tennessee 37232

Received for publication, April 30, 2004

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
Islet-specific glucose-6-phosphatase catalytic subunit-related protein (IGRP) is selectively expressed in islet cells and is a major autoantigen in a mouse model of type I diabetes. The analysis of IGRP-chloramphenicol acetyltransferase (CAT) fusion gene expression through transient transfection of islet-derived TC-3 cells revealed that a promoter region, located between –273 and –254, is essential for high IGRP-CAT fusion gene expression. The sequence of this promoter region does not match that for any known islet-enriched transcription factor. However, data derived from gel retardation assays, a modified ligation-mediated polymerase chain reaction in situ footprinting technique and a SDS-polyacrylamide separation/renaturation procedure led to the hypothesis that this protein might be Pax-6, a conclusion that was confirmed by gel supershift assays. Additional experiments revealed a second non-consensus Pax-6 binding site in the –306/–274 IGRP promoter region. Pax-6 binding to these elements is unusual in that it appears to require both its homeo and paired domains. Interestingly, loss of Pax-6 binding to the –273/ –246 element is compensated by Pax-6 binding to the –306/–274 element and vice versa. Gel retardation assays revealed that another islet-enriched transcription factor, namely Pdx-1, binds four non-consensus elements in the IGRP promoter. However, mutation of these elements has little effect on IGRP fusion gene expression. Although chromatin immunoprecipitation assays show that both Pax-6 and Pdx-1 bind to the IGRP promoter within intact cells, in contrast to the critical role of these factors in cell-specific insulin gene expression, IGRP gene transcription appears to require Pax-6 but not Pdx-1.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
Islet-specific glucose-6-phosphatase catalytic-subunit-related protein (IGRP)¹ is a putative enzyme specifically expressed in the insulin producing cells of the Islets of Langerhans (1–4). As its name implies, this protein is a homologue of the catalytic subunit of glucose-6-phosphatase (G6Pase), an enzyme that catalyzes the conversion of glucose 6-phosphate to glucose and orthophosphate (5–8). This activity is restricted to a limited number of tissues, principally the liver and kidney (5–8). In the liver, G6Pase is positioned at the junction of the metabolic pathways that mediate glycogenolysis and gluconeogenesis and thereby catalyzes the final step in hepatic glucose production. The role of G6Pase has also been studied in the context of other tissues, notably the pancreatic cell (5–8). Interest in this cell type stems from the hypothesis that elevated G6Pase activity in certain settings, such as type II diabetes, could lead to the uncoupling of glucose-stimulated insulin secretion by reversing a required step in this process, the phosphorylation of glucose. Reports have varied, however, as to the level of and even existence of G6Pase activity/expression in islets (5–8). Interestingly, in studies that have been able to demonstrate islet G6Pase activity, different kinetic characteristics from those of the hepatic enzyme were observed, suggesting the presence of a unique islet G6Pase (1). The cloning of IGRP served to identify a candidate for this hypothetical enzyme (1, 2). Although initial studies failed to demonstrate any glucose 6-phosphate hydrolysis by IGRP (1), an independent study recently suggested that IGRP may possess low G6Pase activity (9).

Although the role of IGRP in cell function remains unclear, a recent report identified IGRP as an autoantigen in a mouse model of Type I diabetes (10). This form of diabetes is caused by an autoimmune reaction that leads to the destruction of the pancreatic cell (11–13). Current evidence suggests that autoreactive CD8-positive T cells play a key role in disease pathogenesis (14). In the NOD (non-obese diabetic) mouse, which spontaneously develops a disease similar to type I diabetes in humans, a substantial portion (40%) of the CD8 cells infiltrating the islet are IGRP-reactive (10). These results suggest that IGRP is a major autoantigen in this murine model. Whether these observations directly translate to humans is unknown, however, numerous similarities between disease etiology in NOD mice and Type I diabetics have been noted (15, 16).

Our work has focused on identifying the transcription factors that control IGRP gene expression (2, 3, 17, 18). Originally, this work was undertaken in an attempt to identify novel, islet-enriched transcription factors important for pancreatic development and/or function. We believe this approach is reasonable given that similar work, focused on other islet-specific genes, has led to the identification of such proteins (19–21). With data now implicating IGRP as an autoantigen in Type I diabetes, the possibility exists that this work could also be useful for the design of strategies aimed at preventing immune recognition through suppression of cell antigens. The viability of this approach has already been investigated using antisense RNA directed against glutamic acid decarboxylase (GAD), another protein identified as a type I diabetes autoantigen. In transgenic NOD mice expressing this antisense RNA, it was noted that suppression of GAD protein levels was associated with lower incidence of diabetes (22). Although controversial (23), the results of this study suggest that the manipulation of other autoantigens, such as IGRP, should be investigated as a potential means to slow or prevent cell destruction and type I diabetes.

Previous studies investigating the molecular mechanisms that determine the islet-specific expression of the IGRP gene established the boundaries of a functional promoter (2). This sequence, which consists of 306 bp upstream of the transcription start site, is sufficient to drive expression of reporter genes specifically in cell-derived cell lines in vitro and pancreatic islets in vivo (24). Further, the results of a 5' deletion analysis, coupled with in situ footprinting, indicated that multiple cis-acting elements within this 306-bp region contribute to IGRP promoter activity (17). A recent publication examining the importance of two conserved E-Box motifs extended these findings by demonstrating that the transcription factors NeuroD/BETA2 and Upstream Stimulatory Factor contribute to IGRP promoter activity (18). In this report we show that IGRP promoter activity in insulinoma cell lines is highly dependent on the binding of the transcription factor Pax-6 to two non-consensus binding sites. Interestingly, despite interacting directly with the IGRP promoter in situ, our data do not support a similar critical role for the transcription factor Pdx-1.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
Materials
[-³²P]dATP (>3000 Ci mmol^–1) and [³H]acetic acid, sodium salt (>10 Ci mmol^–1) were obtained from Amersham Biosciences and ICN, respectively. Specific antisera to Pdx-1 and Pax-6 were obtained from Dr. Christopher Wright (Vanderbilt (25)) and Covance Laboratories, respectively. Rabbit IgG (sc-2027) was obtained from Santa Cruz Biotechnology, Inc.

Fusion Gene Plasmid Construction
The construction of a rat insulin II-chloramphenicol acetyltransferase (CAT) fusion gene, containing promoter sequence from –238 to +2 has been previously described (26) as has a site-directed mutation of the A3 Pdx-1 binding site generated in the context of the –238 to +2 promoter region (27). The construction of mouse IGRP-CAT fusion genes, containing promoter sequence from –306 to +3, –273 to +3, and –254 to +3, has been previously described (2, 17).

The Pax-6 binding site located between –273 and –246 in the IGRP promoter was mutated by site-directed mutagenesis within the context of the –273 to +3 promoter fragment. Two constructs, designated –273 MUT 1 and –273 MUT 2 (Fig. 1), were generated using PCR and the following oligonucleotides as the 5' primers: 5'-GCGGATCCAAGCT(–273)TTAAGGGAAATcgcagtTATGAAAAATTGCAAG-3' (MUT 1) and 5'-GCGGATCCAAGCT(–273)TTAAGcactgaGAACTGTATGAAAAATTG-3' (MUT 2). BamHI cloning sites are underlined, and the mutated sequences are in lowercase letters. The 3' PCR primer (5'-CCGCTCGAGATCCAGATCCTC-3'; XhoI cloning site underlined) and the 5' PCR primers were designed to ensure that the 3' and 5' junctions of the IGRP promoter were the same as those in the wild-type –273 IGRP-CAT fusion gene construct.

View larger version (22K): [in this window] [in a new window]   FIG. 1. Two mutations within the –273 to –254 IGRP promoter region reduce basal fusion gene expression. TC-3 cells were transiently co-transfected, as described under "Experimental Procedures," using a LipofectAMINE solution containing various IGRP-CAT fusion genes (2 µg) and an expression vector encoding firefly luciferase (0.5 µg). The IGRP-CAT fusion genes incorporated either the wild-type promoter sequence, located between –273 and +3 (–273 WT) or between –254 and +3(–254 WT), or contained site-directed mutations of two promoter regions that are conserved between the mouse, rat, and human IGRP promoters (3). These mutations, designated –273 MUT 1 and –273 MUT 2, were generated within the context of the –273 to +3 promoter fragment. Following transfection, TC-3 cells were incubated for 18 –20 h in serum-containing medium. Cells were then harvested, and CAT and firefly luciferase activity were assayed as previously described (2, 30). Results are presented as the ratio of CAT:luciferase activity expressed as a percentage relative to the value obtained with the –273 WT fusion gene and represent the mean of three experiments ± S.E., each using an independent preparation of all fusion gene plasmids.

Similarly, the Pax-6 binding site located between –306 and –274 in the IGRP promoter was targeted by site-directed mutagenesis within the context of the –306 to +3 promoter fragment. The construct, designated –306 Pax MUT B (Fig. 10), was generated, with the wild-type –306 IGRP-CAT plasmid as the template, using PCR with the same 3' PCR primer as described above and the following oligonucleotide as the 5' primer: 5'-CGGGATCCAAGCT(–306)CTAGCCAAGCGTAGAtcggGCTAATGTCTGCC. A BamHI cloning site is underlined, and the mutated sequence is in lowercase letters. The 5' junction of the resulting IGRP promoter fragment was the same as that in the wild-type –306 IGRP-CAT fusion gene construct. The mutation selectively targets the Pax-6 paired domain binding site. In addition, the –306 Pax MUT A construct described above served as the template for a PCR reaction with the Pax MUT B primer that led to the creation of a construct designated –306 Pax MUT AB, which contains mutations in both Pax-6 paired domain binding sites in the IGRP promoter.

View larger version (26K): [in this window] [in a new window]   FIG. 10. Loss of Pax-6 binding to the –273/–246 element is compensated by Pax-6 binding to Site 1 and vice versa. A, increases () or decreases () in DMS methylation between in situ versus in vitro methylated mouse TC-3 cell DNA over the –306 to –273 IGRP promoter region are shown. This information was derived from Ref. 17. B, TC-3 cells were transiently co-transfected, as described under "Experimental Procedures," using a LipofectAMINE solution containing various IGRP-CAT fusion genes (2 µg) and an expression vector encoding firefly luciferase (0.5 µg). The IGRP-CAT fusion genes incorporated either the wild-type promoter sequence, located between –306 and +3(–306 WT), or contained mutations in the Pax-6 paired domain binding sites in the –273/–254 element (–306 Pax MUT A), Site 1 (–306 Pax MUT B), or both (–306 Pax MUT AB) all generated within the context of the –306 to +3 promoter fragment. Following transfection, TC-3 cells were incubated for 18 –20 h in serum-containing medium. Cells were then harvested, and CAT and firefly luciferase activity were assayed as previously described (2, 30). Results are presented as the ratio of CAT:luciferase activity, expressed as a percentage relative to the value obtained with the wild-type –306 IGRP-CAT fusion gene, and represent the mean of three experiments ± S.E., each using an independent preparation of all fusion gene plasmids.

View larger version (17K): [in this window] [in a new window]   FIG. 9. Mutation of the four TAAT-like motifs in the IGRP promoter causes a minimal reduction in basal fusion gene expression. TC-3 cells were transiently co-transfected, as described under "Experimental Procedures," using a LipofectAMINE solution containing various IGRP-CAT or Insulin-CAT fusion genes (2 µg) and an expression vector encoding firefly luciferase (0.5 µg). The IGRP-CAT fusion genes incorporated either the wild-type promoter sequence, located between –306 and +3 (–306 WT), or contained a quadruple mutation of all four TAAT-like motifs (IGRP –306 Quad MUT) within the context of the –306 to +3 promoter fragment. The Insulin-CAT fusion genes incorporated either the wild-type promoter sequence, located between –238 and +2 (Insulin –238 WT), or contained a site-directed mutation of the insulin A3 element (Insulin –238 A3 MUT), generated within the context of the –238 to +2 promoter fragment. Following transfection, TC-3 cells were incubated for 18 –20 h in serum-containing medium. Cells were then harvested, and CAT and firefly luciferase activity were assayed as previously described (2, 30). Results are presented as the ratio of CAT:luciferase activity, expressed as a percentage relative to the value obtained with the wild-type IGRP and Insulin fusion genes, and represent the mean of three experiments ± S.E., each using an independent preparation of all fusion gene plasmids.

CAT and Luciferase Assays
Transfected TC-3 cells were harvested by trypsin digestion and then solubilized in passive lysis buffer (Promega). After two cycles of freeze/thawing, firefly luciferase activity was assayed as described previously (30). The remaining TC-3 lysate was heated for 10 min at 65 °C, and cellular debris was removed by centrifugation. CAT assays were then performed on the supernatant as previously described (2). To correct for variations in transfection efficiency, the results are expressed as the ratio of CAT:firefly luciferase activity. In addition, three independent preparations of each IGRP-CAT plasmid construct were analyzed to obtain the data shown in each figure.

Gel Retardation Assay
Labeled Probes—Sense and antisense oligonucleotides representing various IGRP promoter sequences, as indicated in the figure legends, were synthesized with BamHI-compatible ends and subsequently gel-purified, annealed, and labeled with [-³²P]dATP using the Klenow fragment of Escherichia coli DNA polymerase I to a specific activity of 2.5 µCi/pmol (29).

High Salt Nuclear Extract Preparation—High salt TC-3 nuclear extract was prepared as described previously (31, 32), except that nuclei were lysed by resuspension in a buffer containing 800 mM NaCl, 20 mM Hepes, pH 7.9, 0.75 mM spermidine, 0.15 mM spermine, 0.2 mM EDTA, 2 mM EGTA, 2 mM dithiothreitol (DTT), 25% glycerol, and 1 mM phenylmethylsulfonyl fluoride. After incubation for 30 min at 4 °C to ensure complete lysis, samples were centrifuged at 100,000 rpm in a Beckman TLA 100.3 rotor for 40 min at 4 °C. The supernatant was dialyzed against buffer containing 100 mM KCl, 20 mM Hepes, pH 7.9, 0.2 mM EDTA, 0.2 mM EGTA, 2 mM DTT, 20% glycerol, and 1 mM phenylmethylsulfonyl fluoride. The protein concentration of the nuclear extracts was determined using the Bio-Rad assay and was typically 1 µg µl^–1.

Low Salt Nuclear Extract Preparation—Low salt TC-3, TC-6, Y1, HeLa, and H4IIE nuclear extracts were prepared as previously described (31, 32), except that the nuclear pellet was extracted with 20 mM HEPES, pH 7.8, 0.75 mM spermidine, 0.15 mM spermine, 0.2 mM EDTA, 2mM EGTA, 2 mM DTT, 25% glycerol containing 200 mM NaCl, instead of 0.4 M ammonium sulfate, and the supernatant was used directly in gel retardation assays. The protein concentration of the nuclear extracts was determined using the Bio-Rad assay and was typically 1 µg µl^–1.

Binding Assays—14 fmol of radiolabeled probe (50,000 cpm) was incubated with 1.5–3 µg of the indicated nuclear extract in a final 20-µl reaction volume. For experiments using high salt nuclear extract, these reactions contained 20 mM Hepes, pH 7.9, 0.1 mM EDTA, 0.1 mM EGTA, 10% glycerol (v/v), 1 mM DDT, 1 µg of poly(dI-dC)·poly(dI-dC), and 100 mM KCl. In experiments using low salt nuclear extract the final concentrations of EDTA, EGTA, and glycerol were 0.1 mM, 1 mM, and 12.5%, respectively. In addition, the binding reaction contained 0.375 mM spermidine, 0.075 mM spermine, and 100 mM NaCl instead of 100 mM KCl. After incubation at room temperature for 20 min, samples were loaded onto a 6% polyacrylamide gel containing 1x TGE (25 mM Tris base, 190 mM glycine, 1 mM EDTA) and 2.5% (v/v) glycerol. Samples were electrophoresed for 1.5 h at 150 V in 1x TGE buffer before the gel was dried and exposed to Kodak XB film with intensifying screens.

Competition Experiments and Gel Supershifts—For competition experiments, unlabeled competitor DNA was mixed with the radiolabeled oligomer at the indicated molar excess prior to addition of nuclear extract. For supershift experiments, specific antisera (1 µl) were preincubated with TC-3 nuclear extract for 10 min on ice prior to the addition of the labeled IGRP WT oligonucleotide probe. All subsequent steps were carried out as described above.

Fractionation of Cell Proteins by SDS-PAGE, Elution, and Renaturation
Nuclear extract proteins were boiled for 5 min in SDS-PAGE sample buffer (62.5 mM Tris, pH 6.8, 2% SDS, 10% glycerol, 5 mM EDTA, 100 mM DTT, 0.007% bromphenol blue) and fractionated on 1.5-mm thick 15% SDS-polyacrylamide gels using standard methods (29). For molecular weight standardization, samples containing high molecular weight markers (Rainbow Molecular Weight markers, Amersham Biosciences) were run in lanes adjacent to those containing experimental samples. Proteins were electrophoretically transferred from SDS-PAGE gel lanes to polyvinylidene fluoride (PVDF) membranes (Immobilon-P, Millipore) using the Bio-Rad Trans-Blot SD blotting apparatus according to the manufacturer's instructions. Proteins were eluted from 2-mm slices of PVDF membrane and renatured overnight in 100 µl of buffer containing 25 mM Hepes, pH 7.9, 100 mM KCl, 0.1 mM EDTA, 1 mM DTT, 10% glycerol, 1% Triton X-100 (Surfact-Amps X-100, Pierce), and 0.1 mg/ml bovine serum albumin. Elutions were carried out in microcentrifuge tubes at 4 °C with vigorous shaking. Samples were then flash-frozen on dry ice and later thawed for analysis in gel retardation experiments.

Genomic DNA Isolation, in Situ and in Vitro Methylation, and Piperidine Cleavage
To analyze protein binding to the IGRP promoter, promoter methylation by DMS in vitro and in situ was compared, with differences interpreted as being indicative of trans-acting factor binding in situ. Methylation of genomic DNA and strand cleavage by piperidine and heating was based on the Maxam and Gilbert method of DNA sequencing (33). The relative abundance of piperidine-cleaved DNA fragments, and hence the level of DNA methylation, was then assayed using the ligation-mediated polymerase chain reaction (LMPCR) footprinting technique (34).

Isolation and purification of TC-3 genomic DNA and its subsequent in vitro methylation was performed exactly as previously described (17). Similarly, methylation of TC-3 genomic DNA in situ and its subsequent isolation and purification were also performed exactly as previously described (17). DNA was isolated from single 55-cm² cell culture dishes with a typical yield of 200 µg per dish. After purification, DNA that had been methylated in situ or in vitro was treated using two separate methods for base displacement and strand scission as described by Maxam and Gilbert (33). In method A, DNA was resuspended in 180 µl of water and incubated with 20 µl of piperidine at 90 °C for 30 min, as previously reported (17). This method yields DNA products predominately cleaved at methylated guanine (G) residues with only very weak cleavage of methylated adenine (A) residues (33). Alternatively, in method B, DNA was resuspended in 180 µl of phosphate-buffered water (10 mM sodium phosphate, pH 7) and heated at 90 °C for 15 min. 20 µl of piperidine was then added, and the incubation was continued at 90 °C for 30 min. This method yields DNA products cleaved at both methylated guanine (G) and methylated adenine (A) residues, although cleavage at methylated guanine residues still predominates (33). In both methods, samples were then lyophilized to remove the piperidine. The DNA was resuspended in 100 µl of water and lyophilized another two times. The DNA was then resuspended in 100 µl of water, centrifuged briefly to pellet any debris, and ethanolprecipitated. Finally, the DNA was resuspended in 10 mM Tris-HCl (pH 8.0) and 1 mM EDTA to a final concentration of 1 µg/µl.

Ligation-mediated PCR
The ligation-mediated PCR (LMPCR) technique was used to analyze protein DNA interactions over the sense strand of the –273 to –246 region of the IGRP promoter in intact TC-3 cells by comparing the level of G and A residue methylation over this region in situ and in vitro (34). LMPCR was performed exactly as previously described (17). Briefly, three nested oligonucleotides (Primer Set A (17)) were used for each step of the LMPCR method, namely the first strand synthesis reaction, the amplification reaction, and the labeling reaction (17). The reaction products were separated by electrophoresis on 6% polyacrylamide/urea/TBE gels (29) and visualized by autoradiography.

Chromatin Immunoprecipitation Assays
Chromatin immunoprecipitation (ChIP) assays were performed exactly as previously described (18). Fragmented chromatin was immunoprecipitated using either Pax-6 antiserum (Covance), Pdx-1 antiserum (a generous gift from Dr. Chris Wright (25)), or rabbit IgG (sc-2027; Santa Cruz Biotechnology). Immunoprecipitated DNA was purified as previously described (18) and dissolved in nuclease free water (100 µl), and a sample (10 µl) was then used in a PCR reaction. PCR primers were designed to amplify the IGRP promoter (5' (–414) GTTTCCCTGAAAGACCCAGTAGAAGAGTCAG (–383) 3' and 5' (–119) CTCATCTGCTTATGACTTTAATGGGTGGAAAAGAGG (–154) 3') and PEPCK promoter (5' (–434) GAGTGACACCTCACAGCTGTGGTGTTTTG (–406) 3' and 5' (–96) GGCAGGCCTTTGGATCATAGCCATG (–120) 3'). The IGRP and PEPCK promoters were amplified using the Qiagen Master Mix and the following reaction conditions: 95 °C denaturation, 55 °C annealing, and 72 °C extension for 28 cycles. 6 µl of a 1:120 dilution of [-³²P]ATP (>3000 Ci mmol^–1; Amersham Biosciences) was included in the PCR reaction. The products were visualized by electrophoresis on 5% polyacrylamide gels containing 1x TGE (25 mM Tris base, 190 mM glycine, 1 mM EDTA). Samples were electrophoresed for 1.5 h at 150 V in 1x TGE buffer before the gel was dried and exposed to Kodak XB film with intensifying screens. A Packard Instant Imager was used to count ³²P associated with the amplified promoter fragments.

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
The –273/–254 IGRP Promoter Region Is Required for Maximal IGRP Fusion Gene Expression—In a previous study it was shown that the progressive 5' deletion of IGRP promoter sequence, starting at –306, leads to a stepwise drop in promoter activity as measured by the analysis of IGRP-CAT fusion gene expression (17). The most dramatic reduction in activity occurred when the sequence located between –273 and –254 was removed, an observation that pointed to this element as being particularly important for maintaining transcription of the IGRP gene (17). This region is highly conserved between the mouse, rat, and human IGRP promoters (3). Promoter-scanning software (35) identified a number of binding sites for previously characterized transcription factors in the –273/–254 promoter region, including binding sites for STAT (signal transducer and activator of transcription) and NFAT (nuclear factor activated in T cells). These candidates, however, were eliminated based on gel retardation competition studies using consensus binding sites for these factors (data not shown).

To define the boundaries of the putative novel element present in the –273/–254 promoter region, the functional effect of introducing two block mutations in the –273/–254 region of the IGRP promoter on fusion gene expression was investigated (Fig. 1). These mutations, designated –273 MUT 1 and –273 MUT 2, were generated in the context of the –273 to +3 IGRP promoter region, and the level of reporter gene expression directed by fusion genes containing these mutations was then analyzed by transient transfection of TC-3 cells (Fig. 1). For comparison, the CAT expression directed by the wild-type –273 IGRP-CAT and –254 IGRP-CAT fusion genes was also determined. The results of this analysis reveal that both block mutations lead to a large reduction in IGRP promoter activity (Fig. 1). Importantly, the level of basal CAT expression directed by these mutants is equivalent to that seen when the –273/–254 region was completely deleted, as is the case with the –254 5' deletion end-point construct (Fig. 1). This result suggests that sequences encompassed by both block mutations are required for the activity conferred by the –273/–254 promoter region. Almost identical results were obtained when these fusion genes were analyzed by transient transfection of hamster insulinoma tumor (HIT) cells (data not shown).

A modified LMPCR in Situ Footprinting Method Reveals Broad Protein Binding over the Endogenous –273/–246 IGRP Promoter Region in TC-3 Cells—To further define the boundaries of the putative novel element present in the –273/–254 promoter sequence, protein binding to this IGRP promoter region was analyzed using in situ footprinting. IGRP promoter methylation by dimethyl sulfate (DMS) in vitro and in TC-3 cells in situ was compared, with differences interpreted as being indicative of trans-acting factor binding in situ. DMS methylates DNA on adenine (A) and guanine (G) residues and freely permeates cell membranes (36). The binding of a transacting factor to a gene promoter can result in either an increase or decrease in the level of methylation (34, 36). A decrease in the level of methylation is interpreted to occur as a result of steric hindrance, whereas an increase is interpreted to occur if the trans-acting factor causes a change in DNA conformation leading to greater reactivity of a base with DMS (36, 37).

In vitro and in situ methylated genomic DNA was cleaved either using piperidine under conditions that yielded DNA products predominately cleaved at guanine (G) residues with only weak cleavage of adenine (A) residues (33), as previously described (17). Alternatively, methylated genomic DNA was cleaved using piperidine under conditions that yielded DNA products cleaved at both G and A residues (33). The relative abundance of these piperidine cleaved DNA fragments, and hence the level of DNA methylation, was then assayed using the LMPCR footprinting technique (17, 34). Differences in the frequency of methylation at a given G residue in situ result in the over or under representation of that piperidine-cleaved fragment in the subsequent PCR amplification in comparison to in vitro methylated DNA (Fig. 2) (17, 34).

View larger version (80K): [in this window] [in a new window]   FIG. 2. In situ footprinting of the –273/–246 IGRP promoter region. TC-3 genomic DNA was methylated in vitro (lane 1) or within intact cells in situ (lanes 2–4) using dimethyl sulfate (DMS) as described under "Experimental Procedures." Cells were incubated in the absence (lane 2) or presence of serum (lanes 3 and 4). Methylated DNA was cleaved using a modified (lanes 1–3) or standard (lane 4) protocol and an LMPCR reaction was then performed as described under "Experimental Procedures." The autoradiograph shown is representative of two experiments. Only increases () or decreases () in band intensity, comparing in situ to in vitro methylated DNA, that were consistent between both gels are indicated.

Specific Protein Binding to the –273/–254 IGRP Promoter Region in Vitro—The fusion gene analysis (Fig. 1) indicated that one or more transcription factors required for expression of the IGRP gene interacts with the –273/–254 region of the IGRP promoter and that two block mutations in this region (Fig. 1) disrupt binding of this factor or factors. To identify the factor(s) binding this element, a long oligonucleotide that includes sequence 3' of the –254 5' deletion end point was used as the labeled probe in a gel retardation assay. When this labeled oligonucleotide, representing the wild-type (WT) IGRP promoter sequence from –273 to –246, was incubated with nuclear extract prepared from TC-3 cells, four protein-DNA complexes were detected (Fig. 3A). Competition experiments, in which a 100-fold molar excess of unlabeled DNA was included with the labeled probe, were used to correlate protein binding with basal IGRP gene expression. The wild type (WT) –273/–246 oligonucleotide competed effectively for the formation of three of these protein-DNA complexes, designated 1, 2, and 3 (Fig. 3A), indicating that complex 4 must represent a nonspecific protein-DNA interaction. By contrast, oligonucleotides, designated –273/–246 MUT 1 and –273/–246 MUT 2, that contain mutations identical to those described in the –273 MUT 1 and MUT 2 constructs, respectively (Fig. 1), failed to compete with the labeled probe for formation of two complexes, designated 3 and 4 (Fig. 3A). This indicates that complex 3 (Fig. 3A; see arrow) represents a specific protein-DNA interaction and that its formation correlates with basal gene expression conferred by the –273/–254 IGRP promoter region. In contrast, complexes 1 and 2 must either represent nonspecific protein-DNA interactions or protein binding to sequences outside the regions spanning the MUT 1 and MUT 2 mutations. A comparison of protein binding to the –273/–246 WT oligonucleotide using nuclear extracts isolated from other cell lines suggests that the factor in complex 3 is restricted in its expression (Fig. 3B). Thus, of the cell lines analyzed, complex 3 was only detected using TC-3 and TC-6 nuclear extracts (Fig. 3B).

View larger version (22K): [in this window] [in a new window]   FIG. 3. A 45-kDa protein specifically binds the –273/–246 IGRP promoter sequence. A, a labeled oligonucleotide representing the wild-type (WT) –273/–246 IGRP promoter sequence was incubated in the absence (–) or presence of a 100-fold molar excess of the unlabeled competitor (comp.) DNAs shown, representing the WT or mutated (MUT 1 and MUT 2) –273/–246 IGRP sequence (Fig. 1). Low salt TC-3 nuclear extract was then added, and protein binding analyzed using the gel retardation assay as described under "Experimental Procedures." In the representative autoradiograph shown only the retarded complexes are visible and not the free probe, which was present in excess. The formation of a single complex, complex 3, indicated by the arrow, is selectively reduced by competition with the WT and not the MUT oligonucleotides. B, the labeled oligonucleotide representing the wild-type –273/–246 IGRP promoter sequence was incubated with either low salt TC-3, TC-6, Y1, HeLa, or H4IIE nuclear extract and protein binding was then analyzed using the gel retardation assay as described under "Experimental Procedures." The representative autoradiograph only shows the retarded complexes and not the free probe, which was present in excess. C, a fractionation and renaturation technique was used to analyze protein binding to the –273/–246 IGRP oligonucleotide as described under "Experimental Procedures." Crude low salt TC-3 nuclear extract (NE) and PVDF membrane slice eluates (lanes A–G) were screened for binding activity using the gel retardation assay in conjunction with the –273/–246 labeled probe. MW, approximate molecular mass (kilodaltons). A representative autoradiograph is shown. In panels B and C the specific protein-DNA complex, whose formation is selectively reduced by competition with the WT and not the MUT oligonucleotides, is indicated by the arrow.

Pax-6 Stimulates IGRP Fusion Gene Expression through the –273/–246 Promoter Region—Although computer analyses do not identify the –273/–246 promoter region as a Pax-6 binding site, the ability to recognize a broad DNA element (consistent with the in situ footprinting analysis (Fig. 2)), the expression in both TC-3 and TC-6 nuclear extracts (Fig. 3B), and the molecular mass of 45 kDa (Fig. 3C) are all characteristics of Pax-6 (38, 39). Therefore, a Pax-6 antiserum was tested for its ability to alter formation of the specific –273/–246 complex in gel retardation assays. Fig. 4 demonstrates that preincubating TC-3 nuclear extracts with antibodies raised against this protein results in the disappearance of the specific complex and the appearance of a lower mobility, or supershifted complex. As a control, antibodies raised to various other transcription factors known to be enriched in pancreatic islets were tested for their ability to alter the abundance or migration of the –273/–246 complex in gel retardation assays, but they were without effect (data not shown). This result suggests that the –273/–246 complex contained the transcription factor Pax-6. Pax-6 is able to bind DNA as a monomer (38), an observation that is consistent with the ability to retain DNA binding activity after fractionation/renaturation (Fig. 3C).

View larger version (84K): [in this window] [in a new window]   FIG. 4. Pax-6 binds the –273/–246 IGRP promoter sequence. High salt TC-3 cell nuclear extract was incubated in the absence (–) or presence of the indicated antisera for 10 min on ice prior to the addition of the labeled oligonucleotide representing the wild-type (WT) –273/–246 IGRP promoter sequence, and incubation was continued for an additional 20 min at room temperature. Protein binding was then analyzed as described under "Experimental Procedures." In the representative autoradiograph shown only the retarded complexes are visible and not the free probe, which was present in excess. The specific protein-DNA complex, whose formation is selectively reduced by competition with the WT and not the MUT –273/–246 IGRP oligonucleotides, is indicated by the arrow.

View larger version (23K): [in this window] [in a new window]   FIG. 5. Relative affinity of Pax-6 binding sites in the insulin, glucagon, and IGRP promoters. A, Pax-6 binding sites in the insulin, glucagon, and IGRP promoters and the consensus Pax-6 binding site are shown. This consensus was taken from Ref. 38. Increases () or decreases () in DMS methylation between in situ versus in vitro methylated mouse TC-3 cell DNA over the –273 to –244 IGRP promoter region are shown; this information was derived from Fig. 3. B, prior to the addition of high salt TC-3 cell nuclear extract, the labeled oligonucleotide representing the wild-type –273/–246 IGRP promoter sequence was incubated in the absence (–) or presence of the indicated molar excess of the unlabeled competitor (comp.) DNAs shown, representing the wild-type –270/–246 IGRP sequence, the insulin C2 element, and the glucagon G1 and G3 elements. The IGRP –273/–246 and –270/–246 oligonucleotides bind Pax-6 with the same affinities (data not shown). Protein binding was then analyzed as described under "Experimental Procedures." In the representative autoradiographs shown only the retarded complex is visible and not the free probe, which was present in excess. C, the protein binding shown in panel C was quantified by using a Packard Instant Imager to count 32P associated with the retarded complex. The data represent the mean ± S.E. of three experiments.

Pdx-1 Binds to Four Sites in the IGRP Promoter—The studies described above were driven by the initial observation that deletion of the –273/–254 IGRP promoter region resulted in a large drop in IGRP promoter activity. As an alternative approach aimed at identifying transcription factors relevant to IGRP expression, candidates were sought that had been well studied in the context of cell gene expression. The homeodomain transcription factor Pdx-1 fulfills this criterion based on the numerous reports investigating its role in the expression of cell-specific or enriched proteins such as insulin, GLUT2, IAPP, and even Pdx-1 itself (42). The function of this transcription factor has been most closely examined in the context of studies investigating the cell type-specific activity of the insulin promoter. Although not sufficient by itself to mediate transcriptional activation, Pdx-1 is critical for insulin promoter activity and most likely functions in a higher order complex containing other islet-enriched factors (43).

To determine if Pdx-1 interacts with the IGRP promoter, potential binding sites were first identified. Based on previously studied Pdx-1 binding sites, it appears that this transcription factor recognizes a core TAAT motif, which as mentioned above, is recognized by many different homeodomain proteins (44). A search of the IGRP promoter identified three such motifs, all of which are conserved across human, mouse, and rat species. The flanking sequences surrounding these TAAT motifs do not match those of consensus Pdx-1 binding sites, so promoter-scanning software (35) did not predict that these motifs would bind Pdx-1. Nevertheless, the potential of these sites to interact with Pdx-1 was examined using oligonucleotide probes representing all three sites in gel retardation experiments. These probes were designated Site 1, Site 3, and Site 4 and are depicted in Table I along with another probe labeled Site 2, which is discussed below. When the labeled Site 1 oligonucleotide was incubated with nuclear extract prepared from TC-3 cells a single, major protein-DNA complex was formed (Fig. 6A). As described above, the specificity of this protein-DNA interaction was investigated by including various cold competitors in the gel retardation assay. Fig. 6A shows that the wild-type (WT) unlabeled Site 1 oligonucleotide competed for formation of the major protein-DNA complex, whereas an unrelated (UNR) oligonucleotide was completely ineffective, demonstrating the specificity of this interaction. Further, an oligonucleotide containing a block mutation in the Site 1 TAAT motif (Table I) competed relatively weakly, suggesting that the formation of the specific complex was partially dependent on the TAAT motif.

View larger version (19K): [in this window] [in a new window]   FIG. 6. Specific protein binding to the Site 1, Site 3, and Site 4 IGRP promoter regions. Labeled oligonucleotides representing the wild-type (WT) –306/–271 (Site 1), –156/–119 (Site 3), and –61/–35 (Site 4) IGRP promoter regions were incubated in the absence (–) or presence of a 100-fold molar excess of the unlabeled competitor (comp.) DNAs shown, representing the WT or mutated (MUT) Sites 1, 3, and 4 IGRP promoter regions, respectively (Table I), or an unrelated (UNR) DNA sequence. High salt TC-3 nuclear extract was then added, and protein binding was analyzed using the gel retardation assay as described under "Experimental Procedures." In the representative autoradiograph shown only the retarded complexes are visible and not the free probe, which was present in excess. The formation of a single complex, indicated by the arrow, is selectively reduced by competition with the WT and not the UNR Site 1 oligonucleotides, whereas the formation of two complexes, designated X and Y, are selectively reduced by competition with the WT and not the MUT Site 3 and Site 4 oligonucleotides.

To assess the presence of Pdx-1 in these specific protein-DNA complexes, TC-3 nuclear extract was preincubated with antisera raised to the amino terminus of this transcription factor (25). As can be seen in Fig. 7 (lane 3), this had no appreciable effect on formation of the complex formed with the Site 1 probe. In contrast, preincubation with this antiserum resulted in the disappearance of the specific complex Y and the appearance of a lower mobility, or supershifted complex, with both the Site 3 and Site 4 probes.

View larger version (46K): [in this window] [in a new window]   FIG. 7. Pdx-1 and Pax-6 bind the Site 1, Site 2, Site 3, and Site 4 IGRP promoter regions. High or low salt TC-3 cell nuclear extract was incubated in the absence (–) or presence of the indicated antisera for 10 min on ice prior to the addition of a labeled oligonucleotide probe representing the indicated IGRP promoter regions, and the incubation was continued for an additional 20 min at room temperature. Protein binding was then analyzed as described under "Experimental Procedures." In the representative autoradiograph shown only the retarded complexes are visible and not the free probe, which was present in excess.

The identity of the specific complex that forms with the Site 1 probe and complex X that forms with the Site 2, 3, and 4 probes was next investigated. Based on the results of the competition analysis described above, it was apparent that the formation of these complexes was dependent on a TAAT motif (Fig. 6), or in the case of Site 2, an A/T-rich sequence (data not shown). These observations suggested the potential binding of another homeodomain protein. The molecular weight of the potential homeodomain protein present in the specific complex that forms with the Site 1 probe was estimated by utilizing the fractionation renaturation protocol described earlier. After fractionation of the TC-3 nuclear extract and renaturation, binding activity was detected using the eluate from a particular slice that co-migrates with the specific complex that forms with the Site 1 probe (data not shown). From comparison with molecular mass standards, it was apparent that proteins eluting from this slice were 45 kDa in size (data not shown). Because Pax-6 is also present in this slice (Fig. 3C) and because Pax-6 contains a homeodomain, antibodies to this factor were tested for their ability to alter the formation of the specific complex that forms with the Site 1 probe. Preincubation of TC-3 nuclear extracts with Pax-6 antiserum reduced the abundance of this complex and resulted in the appearance of a slower migrating complex (Fig. 7, lane 4, Site 1 panel), demonstrating the presence of Pax-6. Further, these antibodies also disrupted and/or supershifted complex X, which formed when the Site 2, 3, and 4 probes were used (Fig. 7, lane 4). These experiments thus identify the unknown homeodomain protein binding to Sites 1 through 4 as Pax-6.

In the course of these binding analyses it was found that the ability to detect Pax-6 using some of the indicated probes depended on the salt concentration used for nuclear extraction. Thus, as an example, under high salt (800 mM NaCl) extraction conditions, both Pdx-1 and Pax-6 are observed to interact with the Site 2, 3, and 4 probes (Fig. 7, lanes 1–4). In contrast, the Pax-6 interaction is almost undetectable using proteins extracted from nuclei under low salt (200 mM NaCl) conditions (Fig. 7, lanes 5–8). Similarly, Pax-6 binding to the –270/–246 IGRP promoter sequence is reduced using TC-3 nuclear extract prepared from nuclei under low salt nuclear conditions (Fig. 7). These observations most likely reflect differences in the extraction efficiency of Pax-6. We were able to take advantage of this to demonstrate Pdx-1 binding to the Site 1 probe by using TC-3 nuclear extract prepared from nuclei under low salt nuclear conditions (Fig. 7, lane 7, Site 1 panel). The inability to detect Pdx-1 binding to this probe using high salt extracts may be explained by a combination of both larger amounts of Pax-6 protein in these extracts and different affinities of Pdx-1 and Pax-6 for the Site 1 probe. In summary, these gel retardation experiments demonstrate that both Pdx-1 and Pax-6 can bind to four and five different sites, respectively, in the IGRP promoter. Importantly, we do not detect Pdx-1 binding to the –270/–246 IGRP promoter sequence under any condition tested (Fig. 7, –270/–246 panel).

Pax-6 and Pdx-1 Bind to the IGRP Promoter in Situ—Although the gel retardation experiments were able detect binding of Pax-6 and Pdx-1 to oligonucleotides representing IGRP promoter sequences in vitro, they do not address whether these interactions occur inside intact cells. This caveat was addressed by using chromatin immunoprecipitation (ChIP) assays (45). TC-3 cells were first subjected to formaldehyde-mediated cross-linking to preserve DNA-protein interactions. Once fragmented by sonication, the chromatin isolated from these cells was subjected to immunoprecipitation using antisera to Pax-6 and Pdx-1, or IgG as a control. To detect the IGRP promoter in the resulting immunoprecipitates, purified genomic DNA isolated from the pellets was used as a template for PCR using primers representing the IGRP promoter sequence between –414 and –119. Fig. 8 shows the results of this PCR analysis and demonstrates that the IGRP promoter is enriched in the Pdx-1 and Pax-6 immunoprecipitates compared with the IgG control. To test the specificity of the antibody-protein interactions, these immunoprecipitates were also analyzed for the presence of the PEPCK promoter, a target not predicted to associate with Pdx-1 or Pax-6, using PCR primers that amplify the PEPCK promoter sequence between –434 and –96. As expected little (Pdx-1) or no (Pax-6) enrichment of PEPCK promoter was detected in the Pdx-1 or Pax-6 immunoprecipitates compared with the IgG control (Fig. 8). The low level of enrichment of the PEPCK promoter in the Pdx-1 immunopellet compared with the IgG control probably reflects a nonspecific interaction of the Pdx-1 anti-serum with chromatin, because this level of enrichment is observed when other negative control targets are examined (data not shown). The results of these ChIP assays demonstrate that both Pdx-1 and Pax-6 interact specifically with the IGRP promoter inside intact cells.

View larger version (26K): [in this window] [in a new window]   FIG. 8. The IGRP promoter binds Pdx-1 and Pax-6 in situ. Pdx-1 and Pax-6 binding to the IGRP promoter were analyzed in situ using the chromatin immunoprecipitation (ChIP) assay. Chromatin from formaldehyde-treated TC-3 cells was immunoprecipitated using anti-Pdx-1 or anti-Pax-6 antibodies or, as a control, using IgG. The presence of the IGRP promoter and the PEPCK promoter in the chromatin preparation prior to immunoprecipitation (1:100 input) and in the immunoprecipitates was then assayed using PCR as described under "Experimental Procedures." Panel A shows a representative autoradiograph, whereas panel B shows the mean data ± S.E. of three experiments. A Packard Instant Imager was used to count 32P associated with the amplified promoter fragments. The IGRP and PEPCK promoter were amplified with similar efficiencies in the chromatin preparation (data not shown).

Loss of Pax-6 Binding to the –273/–246 Element Is Compensated by Pax-6 Binding to Site 1 and Vice Versa—The experiment described above shows that disruption of Pdx-1 and/or Pax-6 binding to Sites 1 through 4 has a minimal effect on IGRP promoter activity. In contrast, it was demonstrated that disruption of Pax-6 binding to the –273/–246 element leads to a large reduction in IGRP promoter activity (Fig. 1). Unlike the mutations in Sites 1 through 4, which were introduced into the full-length promoter extending from –306 to +3, the mutations in the –276/–246 element were originally introduced into an IGRP-CAT fusion gene, designated –273 IGRP-CAT, that is truncated at the 5' end. This truncated fusion gene therefore lacks the sequence that spans the –306 to –274 region, where Site 1 is located. This point became relevant when the effect of disrupting Pax-6 binding to the –273/–246 element in the context of the full-length promoter was assessed. Thus, a fusion gene, designated –306 Pax MUT A, was generated that contains the same mutation as present in the –273 MUT 1 fusion gene (Fig. 1), except that the mutation was introduced in the context of the full-length –306 IGRP-CAT fusion gene. As shown in Fig. 10, following transient transfection of TC-3 cells, the –306 Pax MUT A fusion gene directed a similar level of CAT expression as directed by the wild-type –306 IGRP-CAT fusion gene. This result suggested that Pax-6 binding to Site 1 may compensate for the loss of Pax-6 binding to the –273/–246 element. The observation that deletion (17) or mutation (Fig. 9) of the –306 to –274 IGRP promoter region has little effect on fusion gene expression suggests that the reverse also applies, namely that Pax-6 binding to the –273/–246 element may compensate for the loss of Pax-6 binding to Site 1.

Site 1 differs from Sites 2–4 in that sequence analysis suggests that it contains a very weak putative Pax-6 paired domain binding motif (Fig. 10A), thus explaining why the mutation introduced into the TAAT motif in Site 1 only partially reduces Pax-6 binding, whereas mutations introduced into the TAAT motif in Sites 2–4 completely abolish Pax-6 binding (Fig. 6 and data not shown for Site 2). In addition, when using low salt TC-3 nuclear extract Pax-6 binding to the Site 2, 3, and 4 elements is no longer detected (Fig. 7). This suggests that Pax-6 interacts with higher affinity to the Site 1 than Site 2, 3, and 4 elements. As with the –273/–246 Pax-6 binding site, promoter-scanning software (35) does not predict Pax-6 binding to Site 1.

To address the role of Pax-6 binding to Site 1 further, a mutation that targets the putative Pax-6 paired domain binding motif in Site 1 (Fig. 10A) was introduced in the context of the full-length, wild-type –306 IGRP-CAT and –306 Pax MUT A fusion genes, resulting in the generation of constructs designated –306 Pax MUT B and –306 Pax MUT AB, respectively (Fig. 10B). This paired domain binding motif mutation partially disrupts Pax-6 binding to Site 1 leaving Pdx-1 binding intact (data not shown). Consistent with the hypothesis that both Pax-6 binding elements in the IGRP promoter compensate for each other, this Site 1 mutation has no effect by itself as assessed by comparing the level of CAT expression directed by the wild-type –306 IGRP-CAT and –306 Pax MUT B fusion genes (Fig. 10). However, when coupled with the mutation of the –273/–254 Pax-6 binding motif, fusion gene expression was reduced by 50% (Fig. 10). Thus, loss of Pax-6 binding at either site individually is compensated for by Pax-6 interaction at the reciprocal site. This result explains why disruption of Pax-6 binding to the –273/–246 element has a significant impact on promoter activity in the context of a truncated IGRP promoter lacking Site 1, but not in the context of the full-length IGRP promoter. Site-directed mutagenesis of both Pax-6 paired domain binding motifs, as present in the –306 Pax MUT AB construct, reduces fusion gene expression to a lesser degree than deletion of both elements, as occurs in the –254 5' deletion construct (compare Figs. 1 and 10). We hypothesize that this difference is explained by residual Pax-6 homeodomain binding to the TAAT-like motif in Site 1, consistent with the observation that mutation of the Pax-6 paired domain binding motif in Site 1 only partially disrupts Pax-6 binding (data not shown).

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
The results of this study provide insight into the molecular mechanisms controlling IGRP gene transcription. A role for Pax-6 was demonstrated based on data derived from in vitro and in situ binding studies, coupled with functional studies utilizing promoter fusion genes. Although Pax-6 is capable of interacting with at least five separate elements in the IGRP promoter in vitro (Fig. 7), only two of these, located in the –306/–273 (Site 1) and –273/–246 regions, appear critical for promoter activity (Figs. 1, 9, and 10). In fact, it was the marked loss in promoter activity observed when the –273/–246 IGRP promoter region was removed in the original 5' deletion analysis (17) that directed our attention to this element and eventually led to the identification of Pax-6 as the factor binding this region. However, this reduction in promoter activity was not detected when this element is mutated using site-directed mutagenesis, because Pax-6 binding to Site 1 can compensate for the loss of Pax-6 binding to the –273/–246 element (Fig. 10B). A key result that led to the identification of Pax-6 as a candidate for the factor binding the –273/–246 element was the use of a modified in situ footprinting method, the results of which suggested that a single factor may make unusually broad contacts across this promoter region (Fig. 2). We have previously demonstrated the utility of this methodology by showing that multiple trans-acting factor binding sites identified in the IGRP promoter in TC-3 cells by in situ footprinting correlate with regions of the IGRP promoter identified as being important for basal IGRP-CAT fusion gene expression in TC-3 cells (17).

As an alternative method for identifying the factors controlling IGRP expression, we also took advantage of the accumulating literature regarding the transcription factors controlling the expression of other cell-specific or -enriched proteins, such as insulin, to identify candidate proteins. Our efforts here were focused on the transcription factor Pdx-1, which was shown to interact with the IGRP promoter at four separate elements in vitro together with Pax-6 (Fig. 7). Both of these proteins bind to TAAT or TAAT-like motifs within these elements (Fig. 6 and data not shown), presumably through their respective homeodomains. It is interesting that this dependence of binding on the presence of the TAAT sequence is not absolute, as reflected in the observation that Pdx-1 and Pax-6 were able to interact with the element designated Site 2, which contains the sequence TAAA (Table I). This observation suggests that the homeodomains in these proteins exhibit rather loose specificity in vitro. Because similar binding characteristics have been observed for other homeoproteins (44, 46, 47), the question arises: how do these proteins achieve target specificity in vivo? One route through which this could occur is by cooperative binding with other transcription factors. With regard to Pdx-1, such a model is consistent with work showing that this factor can interact with the transcription factor NeuroD/BETA2 to support cooperative binding to the A3 and E2 elements, respectively, in the rat insulin I promoter (48).

Based on data derived from site-directed mutagenesis (Fig. 9), it appears that Pdx-1 does not contribute significantly to IGRP promoter activity. Thus, it would seem that speculation about potential Pdx-1 interacting proteins with regard to IGRP promoter regulation is unwarranted. It is possible, however, that an interaction between Pdx-1 and another transcription factor could allow this protein to interact with the promoter in the absence of a binding site, thus masking the effects of site-directed mutagenesis. Consistent with this idea is the fact that Pdx-1 is associated with the IGRP promoter in situ, which suggests it plays a role in regulating IGRP expression (Fig. 8). Alternatively, the simpler explanation, that Pdx-1 is not critical for maximum IGRP expression, is consistent with studies on glucokinase gene expression. Thus, although Pdx-1 is able to interact with the glucokinase promoter in vitro (49), no alteration in glucokinase protein is observed in mice heterozygous for a Pdx-1 null allele or in animals whose cells completely lack Pdx-1 (50, 51). Measurements of IGRP expression levels in the absence of Pdx-1 may definitively answer this question.

In addition to its role in regulating basal gene transcription, Pdx-1 also appears to contribute to the modulation of gene expression by glucose in cells. Transcription of the insulin gene, for example, is induced when cells are exposed to elevated glucose concentrations, and studies aimed at identifying the transcription factors responsible for this effect have shown that disruption of Pdx-1 binding to the insulin promoter impairs the glucose response (52). Consistent with the idea that Pdx-1 is a glucose-responsive factor, it has been demonstrated that this transcription factor translocates from the cytoplasm, or nuclear periphery, to the nucleus in response to elevated glucose levels (53, 54). In light of these data, it seems reasonable to hypothesize that, although we are not able to ascribe a major role for Pdx-1 in the maintenance of basal IGRP promoter activity, this transcription factor may play a role in the regulation of the IGRP gene by metabolites such as glucose. Similarly, in addition to its role in regulating basal gene transcription, Pax-6 also appears to contribute to the regulation of glucagon expression by insulin in cells. Pax-6 binds the G3 element in the glucagon promoter (55), an element that is critical for the regulation of glucagon gene transcription by insulin (56). However, although this element is sufficient to confer insulin-regulated reporter gene expression in a heterologous context (56, 57), it is apparent that other promoter elements contribute to the regulation of glucagon gene transcription by insulin (57). Thus, although Pax-6 binds the promoters of several genes whose expressions are islet-enriched (58), it is possible that Pax-6 may only mediate an insulin response in specific promoter contexts. Future studies investigating the possible effects of glucose and insulin on IGRP promoter activity will address these issues.

Because IGRP is only one of a small group of proteins known to be highly enriched in pancreatic cells, it offers a relatively unique opportunity to study the molecular basis for selective gene expression within this cell type. Our future goals include identifying the additional transcription factors required for the expression of this gene with an emphasis on novel transcription factors, not previously implicated in cell-specific gene expression. The identification of such factors is important because of their potential relevance to both pancreatic/ cell development and efforts to produce cells from stem cells in situ (59). In addition, knowledge of these transcription factors may be useful to the design of future therapies that aim to suppress IGRP gene expression in the event that IGRP, as in the NOD mouse, is a major autoantigen in human type I diabetes.

	FOOTNOTES

 
^* This work was supported in part by National Institutes of Health (NIH) Grant DK61645 (to R. M. O.) and by NIH Grant P60-DK20593, which funds the Vanderbilt Diabetes Center Core Laboratory. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Supported by the Vanderbilt Viruses, Nucleic Acids, and Cancer Training Program (Grant 5T32-CA09385-17).

To whom correspondence should be addressed: Dept. of Molecular Physiology and Biophysics, 761 PRB (MRB II), Vanderbilt University Medical School, Nashville, TN 37232-0615. Tel.: 615-936-1503; Fax: 615-322-7236; E-mail: richard.obrien{at}vanderbilt.edu.

¹ The abbreviations used are: IGRP, islet-specific G6Pase catalytic subunit-related protein; G6Pase, glucose-6-phosphatase; CAT, chloramphenicol acetyltransferase; LMPCR, ligation-mediated polymerase chain reaction; GAD, glutamic acid decarboxylase; DMS, dimethyl sulfate; BSA, bovine serum albumin; NOD, non-obese diabetic; DTT, dithiothreitol; WT, wild type; PVDF, polyvinylidene fluoride; ChIP, chromatin immunoprecipitation.

	ACKNOWLEDGMENTS

 
We thank Roland Stein, Daryl Granner, and Shimon Efrat for providing the HeLa, H4IIE, TC-3, and TC-6 cell lines, respectively, and Roland Stein for useful discussions on this project.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 

1. Arden, S. D., Zahn, T., Steegers, S., Webb, S., Bergman, B., O'Brien, R. M., and Hutton, J. C. (1999) Diabetes 48, 531–542[Abstract]
2. Ebert, D. H., Bischof, L. J., Streeper, R. S., Chapman, S. C., Svitek, C. A., Goldman, J. K., Mathews, C. E., Leiter, E. H., Hutton, J. C., and O'Brien, R. M. (1999) Diabetes 48, 543–551[Abstract]
3. Martin, C. C., Bischof, L. J., Bergman, B., Hornbuckle, L. A., Hilliker, C., Frigeri, C., Wahl, D., Svitek, C. A., Wong, R., Goldman, J. K., Oeser, J. K., Lepretre, F., Froguel, P., O'Brien, R. M., and Hutton, J. C. (2001) J. Biol. Chem. 276, 25197–25207[Abstract/Free Full Text]
4. Hutton, J. C., and Eisenbarth, G. S. (2003) Proc. Natl. Acad. Sci. U. S. A. 100, 8626–8628[Free Full Text]
5. Foster, J. D., Pederson, B. A., and Nordlie, R. C. (1997) Proc. Soc. Exp. Biol. Med. 215, 314–332[CrossRef][Medline] [Order article via Infotrieve]
6. Mithieux, G. (1997) Eur. J. Endocrinol. 136, 137–145[Abstract/Free Full Text]
7. van de Werve, G., Lange, A., Newgard, C., Mechin, M. C., Li, Y., and Berteloot, A. (2000) Eur. J. Biochem. 267, 1533–1549[Medline] [Order article via Infotrieve]
8. Van Schaftingen, E., and Gerin, I. (2002) Biochem. J. 362, 513–532[CrossRef][Medline] [Order article via Infotrieve]
9. Petrolonis, A. J., Yang, Q., Tummino, P. J., Fish, S. M., Prack, A. E., Jain, S., Parsons, T. F., Li, P., Dales, N. A., Ge, L., Langston, S. P., Schuller, A. G., An, W. F., Tartaglia, L. A., Chen, H., and Hong, S. B. (2004) J. Biol. Chem. 279, 13976–13983[Abstract/Free Full Text]
10. Lieberman, S. M., Evans, A. M., Han, B., Takaki, T., Vinnitskaya, Y., Caldwell, J. A., Serreze, D. V., Shabanowitz, J., Hunt, D. F., Nathenson, S. G., Santamaria, P., and DiLorenzo, T. P. (2003) Proc. Natl. Acad. Sci. U. S. A. 100, 8384–8388[Abstract/Free Full Text]
11. Tisch, R., and McDevitt, H. (1996) Cell 85, 291–297[CrossRef][Medline] [Order article via Infotrieve]
12. Notkins, A. L. (2002) J. Biol. Chem. 277, 43545–43548[Free Full Text]
13. Winter, W. E., Harris, N., and Schatz, D. (2002) Diabetes Technol. Ther. 4, 817–839[CrossRef][Medline] [Order article via Infotrieve]
14. Liblau, R. S., Wong, F. S., Mars, L. T., and Santamaria, P. (2002) Immunity 17, 1–6[CrossRef][Medline] [Order article via Infotrieve]
15. Delovitch, T. L., and Singh, B. (1997) Immunity 7, 727–738[CrossRef][Medline] [Order article via Infotrieve]
16. Atkinson, M. A., and Leiter, E. H. (1999) Nat. Med. 5, 601–604[CrossRef][Medline] [Order article via Infotrieve]
17. Bischof, L. J., Martin, C. C., Svitek, C. A., Stadelmaier, B. T., Hornbuckle, L. A., Goldman, J. K., Oeser, J. K., Hutton, J. C., and O'Brien, R. M. (2001) Diabetes 50, 502–514[Abstract/Free Full Text]
18. Martin, C. C., Svitek, C. A., Oeser, J. K., Henderson, E., Stein, R., and O'Brien, R. M. (2003) Biochem. J. 371, 675–686[CrossRef][Medline] [Order article via Infotrieve]
19. Yamaoka, T., and Itakura, M. (1999) Int. J. Mol. Med. 3, 247–261[Medline] [Order article via Infotrieve]
20. Bonner-Weir, S. (2000) J. Mol. Endocrinol. 24, 297–302[CrossRef][Medline] [Order article via Infotrieve]
21. Bramblett, D. E., Huang, H. P., and Tsai, M. J. (2000) Adv. Pharmacol. 47, 255–315
22. Yoon, J. W., Yoon, C. S., Lim, H. W., Huang, Q. Q., Kang, Y., Pyun, K. H., Hirasawa, K., Sherwin, R. S., and Jun, H. S. (1999) Science 284, 1183–1187[Abstract/Free Full Text]
23. Jun, H. S., Khil, L. Y., and Yoon, J. W. (2002) Cell Mol. Life Sci. 59, 1892–1901[CrossRef][Medline] [Order article via Infotrieve]
24. Frigeri, C., Martin, C. C., Svitek, C. A., Oeser, J. K., Hutton, J. C., Gannon, M., and O'Brien, R. M. (2004) Diabetes 53, 1754–1764[Abstract/Free Full Text]
25. Gannon, M., Gamer, L. W., and Wright, C. V. (2001) Dev. Biol. 238, 185–201[CrossRef][Medline] [Order article via Infotrieve]
26. Robinson, G. L., Peshavaria, M., Henderson, E., Shieh, S. Y., Tsai, M. J., Teitelman, G., and Stein, R. (1994) J. Biol. Chem. 269, 2452–2460[Abstract/Free Full Text]
27. Peshavaria, M., Gamer, L., Henderson, E., Teitelman, G., Wright, C. V., and Stein, R. (1994) Mol. Endocrinol. 8, 806–816[Abstract/Free Full Text]
28. Higuchi, R., Krummel, B., and Saiki, R. K. (1988) Nucleic Acids Res. 16, 7351–7367[Abstract/Free Full Text]
29. Sambrook, J., Fritsch, E. F., and Maniatis, E. F. (1989) Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
30. Chapman, S. C., Ayala, J. E., Streeper, R. S., Culbert, A. A., Eaton, E. M., Svitek, C. A., Goldman, J. K., Tavare, J. M., and O'Brien, R. M. (1999) J. Biol. Chem. 274, 18625–18634[Abstract/Free Full Text]
31. Shapiro, D. J., Sharp, P. A., Wahli, W. W., and Keller, M. J. (1988) DNA (N. Y.) 7, 47–55[Medline] [Order article via Infotrieve]
32. O'Brien, R. M., Noisin, E. L., Suwanichkul, A., Yamasaki, T., Lucas, P. C., Wang, J. C., Powell, D. R., and Granner, D. K. (1995) Mol. Cell. Biol. 15, 1747–1758[Abstract]
33. Maxam, A. M., and Gilbert, W. (1980) Methods Enzymol. 65, 499–560[Medline] [Order article via Infotrieve]
34. Mueller, P. R., and Wold, B. (1989) Science 246, 780–786[Abstract/Free Full Text]
35. Quandt, K., Frech, K., Karas, H., Wingender, E., and Werner, T. (1995) Nucleic Acids Res. 23, 4878–4884[Abstract/Free Full Text]
36. Church, G. M., Ephrussi, A., Gilbert, W., and Tonegawa, S. (1985) Nature 313, 798–801[CrossRef][Medline] [Order article via Infotrieve]
37. Hornstra, I. K., and Yang, T. P. (1993) Anal. Biochem. 213, 179–193[CrossRef][Medline] [Order article via Infotrieve]
38. Epstein, J., Cai, J., Glaser, T., Jepeal, L., and Maas, R. (1994) J. Biol. Chem. 269, 8355–8361[Abstract/Free Full Text]
39. Sander, M., Neubuser, A., Kalamaras, J., Ee, H. C., Martin, G. R., and German, M. S. (1997) Genes Dev. 11, 1662–1673[Abstract/Free Full Text]
40. Ritz-Laser, B., Estreicher, A., Klages, N., Saule, S., and Philippe, J. (1999) J. Biol. Chem. 274, 4124–4132[Abstract/Free Full Text]
41. Jun, S., and Desplan, C. (1996) Development 122, 2639–2650[Abstract]
42. McKinnon, C. M., and Docherty, K. (2001) Diabetologia 44, 1203–1214[CrossRef][Medline] [Order article via Infotrieve]
43. Qiu, Y., Guo, M., Huang, S., and Stein, R. (2002) Mol. Cell. Biol. 22, 412–420[Abstract/Free Full Text]
44. Laughon, A. (1991) Biochemistry 30, 11357–11367[CrossRef][Medline] [Order article via Infotrieve]
45. Orlando, V. (2000) Trends Biochem. Sci. 25, 99–104[CrossRef][Medline] [Order article via Infotrieve]
46. Hoey, T., and Levine, M. (1988) Nature 332, 858–861[CrossRef][Medline] [Order article via Infotrieve]
47. Desplan, C., Theis, J., and O'Farrell, P. H. (1988) Cell 54, 1081–1090[CrossRef][Medline] [Order article via Infotrieve]
48. Ohneda, K., Mirmira, R. G., Wang, J., Johnson, J. D., and German, M. S. (2000) Mol. Cell. Biol. 20, 900–911[Abstract/Free Full Text]
49. Watada, H., Kajimoto, Y., Umayahara, Y., Matsuoka, T., Kaneto, H., Fujitani, Y., Kamada, T., Kawamori, R., and Yamasaki, Y. (1996) Diabetes 45, 1478–1488[Abstract]
50. Ahlgren, U., Jonsson, J., Jonsson, L., Simu, K., and Edlund, H. (1998) Genes Dev. 12, 1763–1768[Abstract/Free Full Text]
51. Brissova, M., Shiota, M., Nicholson, W. E., Gannon, M., Knobel, S. M., Piston, D. W., Wright, C. V., and Powers, A. C. (2002) J. Biol. Chem. 277, 11225–11232[Abstract/Free Full Text]
52. Marshak, S., Totary, H., Cerasi, E., and Melloul, D. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 15057–15062[Abstract/Free Full Text]
53. Macfarlane, W. M., McKinnon, C. M., Felton-Edkins, Z. A., Cragg, H., James, R. F., and Docherty, K. (1999) J. Biol. Chem. 274, 1011–1016[Abstract/Free Full Text]
54. Rafiq, I., da Silva Xavier, G., Hooper, S., and Rutter, G. A. (2000) J. Biol. Chem. 275, 15977–15984[Abstract/Free Full Text]
55. St-Onge, L., Sosa-Pineda, B., Chowdhury, K., Mansouri, A., and Gruss, P. (1997) Nature 387, 406–409[CrossRef][Medline] [Order article via Infotrieve]
56. Philippe, J. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 7224–7227[Abstract/Free Full Text]
57. Grzeskowiak, R., Amin, J., Oetjen, E., and Knepel, W. (2000) J. Biol. Chem. 275, 30037–30045[Abstract/Free Full Text]
58. Knepel, W., Vallejo, M., Chafitz, J. A., and Habener, J. F. (1991) Mol. Endocrinol. 5, 1457–1466[Abstract/Free Full Text]
59. Edlund, H. (2002) Nat. Rev. Genet. 3, 524–532[CrossRef][Medline] [Order article via Infotrieve]

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				C. Dos Santos, P. Bougneres, and D. Fradin A Single-Nucleotide Polymorphism in a Methylatable Foxa2 Binding Site of the G6PC2 Promoter Is Associated With Insulin Secretion In Vivo and Increased Promoter Activity In Vitro Diabetes, February 1, 2009; 58(2): 489 - 492. [Abstract] [Full Text] [PDF]

				C. C Martin, B. P Flemming, Y. Wang, J. K Oeser, and R. M O'Brien Foxa2 and MafA regulate islet-specific glucose-6-phosphatase catalytic subunit-related protein gene expression J. Mol. Endocrinol., November 1, 2008; 41(5): 315 - 328. [Abstract] [Full Text] [PDF]

				Y. Wang, B. P. Flemming, C. C. Martin, S. R. Allen, J. Walters, J. K. Oeser, J. C. Hutton, and R. M. O'Brien Long-Range Enhancers Are Required to Maintain Expression of the Autoantigen Islet-Specific Glucose-6-Phosphatase Catalytic Subunit Related Protein in Adult Mouse Islets In Vivo Diabetes, January 1, 2008; 57(1): 133 - 141. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 279/33/34277    most recent M404830200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Martin, C. C. Articles by O'Brien, R. M. Search for Related Content PubMed PubMed Citation Articles by Martin, C. C. Articles by O'Brien, R. M. Social Bookmarking                      What's this?