![]()
|
|
||||||||
J. Biol. Chem., Vol. 279, Issue 33, 34406-34410, August 13, 2004
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||





¶||
From the
Department of Molecular Biotechnology, Hiroshima University, Hiroshima 739-8530, Japan, the
Department of Biotechnology, Osaka University, Osaka 565-0871, Japan, and ¶PRESTO, Japan Science and Technology Corporation, Kawaguchi, Saitama 332-0012, Japan
Received for publication, April 28, 2004 , and in revised form, June 1, 2004.
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
We demonstrated previously that polyP forms a complex with the ATP-dependent Lon protease, an enzyme that degrades intracellular proteins during nutritional downshift (4). We further showed that most of the proteins degraded by the polyP-Lon were free ribosomal proteins. Thus, it appears that polyP helps mediate adaptation to nutritional downshift by directing the degradation of ribosomal proteins. PolyP also binds to ribosomal proteins, suggesting that its interaction with the substrate may be important for the stimulation of degradation (4). However, whether polyP first binds to Lon or to the ribosomal proteins has not been established.
Lon is a highly conserved enzyme present in Archaea and eubacteria as well as in the mitochondria of eukaryotes. The Lon monomer includes an N terminus of unknown function, a central ATPase containing a typical ATP-binding motif, and a C-terminal proteolytic domain with a catalytically active residue at Ser-679 (58). The N-terminal region also contains a "basic-acid-basic" region (9). A "sensor and substrate discrimination" domain has been identified between the ATPase and protease domains (10). Purified sensor and substrate discrimination domain binds to known Lon substrates (10), suggesting that it plays a role in substrate recognition. Although E. coli Lon is thought to be a homo-tetramer or -octamer, recent structural analysis of the proteolytic domain of Lon revealed that it assembles into hexameric rings (11).
Lon contributes to the regulation of several important cellular functions, including radiation resistance, cell division, filamentation, capsular polysaccharide production, lysogeny of certain bacteriophages (reviewed in Refs. 1214), and adaptation to nutritional downshift (4). E. coli Lon is known to bind nonspecifically to DNA (15). However, human Lon binds specifically to a single-stranded GT-rich DNA sequence of human mitochondrial DNA (16). In addition, Fu et al. (17) showed that the E. coli Lon binds to a TG-rich site (pets) of the human immunodeficiency virus type2 enhancer. Whether E. coli Lon has a specific binding site on the E. coli chromosome is unclear.
It has been suggested that the basic-acid-basic domain is involved in DNA binding (5). Another report speculated that the protease domain is involved in DNA binding, because the amino acid sequence of this domain is similar to that of the DNA-binding protein LexA (18). In both cases, the DNA-binding sites of Lon were predicted from its amino acid sequence. Here, our experimental data suggested that both the polyP- and DNA-binding sites of Lon are localized in the ATPase domain. This explains why polyP competes with DNA for binding to Lon. Finally, based on these findings, we discuss the regulatory effects of polyP on the proteolytic and DNA-binding activities of Lon.
| EXPERIMENTAL PROCEDURES |
|---|
|
|
|---|
Ribosomal proteins were purified from isolated ribosomes as follows. Ribosomes were isolated from E. coli MG1655 by ultracentrifugation (21). Ribosomal proteins were extracted by incubating the purified ribosomes for 20 h at 4 °C with 4.5 M LiCl and 6 mM
-mercaptoethanol (22). After precipitating the ribosomal RNAs by centrifugation (5000 x g, 5 min), the supernatant containing ribosomal proteins was dialyzed against buffer B (50 mM ammonium acetate, pH 5.6, 10% glycerol, and 0.15 M NaCl). The supernatant was applied to a carboxymethyl cation exchange column (PerSeptive Biosystems, Framingham, MA), and ribosomal proteins were eluted with a linear gradient of 150750 mM NaCl in buffer B over 15-column volumes. Some ribosomal proteins were further purified by gel filtration chromatography with Superdex 75 (Amersham Biosciences) in buffer A containing 150 mM NaCl.
Degradation of Ribosomal Proteins by LonRibosomal proteins (5 µg) and Lon (1.5 µg) were incubated in a buffer containing 25 mM Tris-HCl, pH 7.8, 4 mM ATP, and 5 mM Mg2+ in the presence and absence of 1.4 µM polyP700 as a polymer at 37 °C and then separated by 12.5% SDS-PAGE. PolyP700 was synthesized by polyP kinase with ATP as a substrate as described previously (4). After electrophoresis, ribosomal proteins were stained with SYPRO Orange (Molecular Probes, Eugene, OR) and then visualized with a Typhoon image analyzer (Amersham Biosciences).
Construction of Deletion Mutants of LonTo construct deletion mutants of Lon fused to MBP, a DNA fragment corresponding to Lon 1713 was amplified using primers F1 and R713 and pMal-Lon (S679A) as the template. The amplified DNA fragment was digested with EcoRI and then inserted into XmnI and EcoRI-digested pMal-c-2x (New England BioLabs, Ontario, Canada). Lon 1302, Lon 136784, Lon 272784, Lon 320784, Lon 181302, Lon 272437, Lon 320437, Lon 472616, and Lon 618775 were constructed with using primers F1 and R302, F136 and R784, F272 and R784, F320 and R784, F181 and R302, F272 and R437, F320 and R437, F472 and R616, and F618 and R775, respectively. DNA sequences of these primers are shown in Table I.
|
on 2x YT medium (16 g of tryptone, 10 g of yeast extract, and 5 g of NaCl/liter) (23) with 0.5 mM isopropyl-
-D-thiogalactopyranoside. Cells were collected by centrifugation and suspended in SDS sample buffer (23). After boiling for 5 min, samples were separated by 12.5% SDS-PAGE. Separated proteins were transferred to nitrocellulose membranes. The membranes were washed twice with an incubation buffer (50 mM Tris-HCl, pH 7.4, 50 mM NaCl, 1 mM MgCl2, and 0.1% Triton X-100) and incubated for 12 h at 37 °C in the same buffer containing 1% bovine serum albumin. PolyP700 (10.3 pmol) labeled with 32P (4) was added, and the mixture was incubated for 2 h at 37 °C. The membranes were washed twice with the incubation buffer and then exposed to a film (Bas-IP, Fujifilm, Kanagawa, Japan). The exposed film was analyzed using the Typhoon image analyzer (Amersham Biosciences).
PolyP- and DNA-binding AssaysDeletion mutants of Lon fused with MBP were purified using amylose resin. Purified proteolytically inactive MBP-Lon (S679A) or its deletion mutants (35 pmol) and [32P]polyP (1 pmol) were mixed for 5 min at room temperature in 50 µl of 25 mM Tris-HCl, pH 7.8, 5 mM MgCl2, and 1 mM ATP. The mixture was applied to a nitrocellulose filter (0.45 µm), and the free [32P]polyP was washed off under a vacuum with a solution of 25 mM Tris-HCl, pH 7.8, 5 mM MgCl2, and 100 mM NaCl (4). The radioactivity remaining on the filter, corresponding to the amount of polyP-protein complex, was measured by scintillation counting. For the DNA-binding experiment, a DNA fragment (722 bp) coding leuC (5141189 bp from the translational initiation site) was amplified using CAGGTCGACTCTAGAGGATC and CAGTGAATTCGAGCTCGGTA as primers and pUC-leuC as a template, and then labeled with [
-32P]ATP (23). The DNA-binding activity of Lon was assessed as described above except using 32P-labeled DNA instead of polyP. The radioactivity remaining on the filter was measured by scintillation counting.
Sequencing of DNA Extracted from DNA-Lon ComplexProteolytically inactive Lon fused with MBP was expressed in E. coli harboring pMal-Lon(S679A). After the E. coli cells were disrupted, a lysate containing MBP-Lon-DNA complexes was applied to the immobilized amylose column. The column was washed with five volumes of 20 mM Tris-HCl, pH 8.0, 1 mM EDTA, and 0.25% Tween 20 and then washed with five volumes of the same buffer containing 200 mM NaCl. After free DNA was completely eluted from the column, MBP-Lon was eluted with the same buffer containing 10 mM maltose. The fraction containing MBP-Lon was extracted twice with the same volume of phenol-chloroform, after which DNA was precipitated with ethanol. The DNA was dissolved with water, inserted into the SmaI site of pUC119, and then used to transform E. coli. Inserted DNAs obtained from 21 individual recombinants were sequenced (23).
Gel-shift AssayLeuC DNA (0.5 pmol) and Lon (S679A) (1 µg) were incubated for 5 min at room temperature in the presence or absence of polyP. The reactions were then mixed with loading dye and separated by 1% agarose gel electrophoresis (23). After staining with ethidium bromide, DNA was visualized under UV light. Double-stranded pets DNA (GATCCAGCTATACTTGGTCAGGGCGAATTCTAACTA) (17) was synthesized and used as a competitor.
| RESULTS |
|---|
|
|
|---|
|
Lon also binds polyP (4). Does polyP first bind to Lon and then the polyP-Lon complex degrades the ribosomal proteins? Alternatively, does polyP bind to ribosomal proteins and then Lon recognizes the polyP-ribosomal protein complex for degradation? In the latter case, polyP may function as a molecular tag, much like ubiquitin in eukaryotic cells (reviewed in Refs. 2426), to identify ribosomal proteins for degradation by proteases. To answer these questions, we examined the effect of the order of addition on L24 cleavage (Fig. 2). We found that Lon efficiently degraded L24 when Lon and polyP were mixed together prior to the addition of L24, whereas there was little degradation of L24 when L24 was first mixed with polyP before the addition of Lon (Fig. 2). This indicated that polyP-Lon complex formation is important for the stimulation of protein degradation and that polyP does not act as a tag for Lon-mediated degradation.
|
|
Although Lon was originally identified as a DNA-binding protein (5, 15), the location of the DNA-binding site has not been determined. We therefore performed a DNA-binding assay using the purified Lon deletion mutants. We used 32P-labeled E. coli leuC DNA as a probe because, as shown below, a leuC DNA fragment was co-purified with MBP-Lon. Fig. 3C shows that the DNA-binding site also appears to be localized in the ATPase domain of Lon.
Lon Binds to polyP More Strongly than to DNABecause the ATPase domain contains both polyP- and DNA-binding sites, polyP may compete with DNA for the binding to Lon. To examine this possibility, we determined the effect of polyP on the DNA-Lon complex using a gel-shift assay (Fig. 4). DNA (leuC) formed a complex with Lon, but in the presence of an equimolar amount of polyP, formation of the DNA-Lon complex was almost completely inhibited. This suggested that polyP binds to Lon more strongly than to DNA. To further confirm that the DNA-Lon complex is inhibited in the presence of polyP, we examined the effect of polyP on MBP-Lon binding to a DNA-cellulose column. MBP-Lon was not eluted from the column by a buffer alone, but was eluted when the buffer contained polyP (Fig. 5). This result suggested that polyP can bind to Lon at the same site as DNA (Fig. 5).
|
|
Lon Binds Nonspecifically to E. coli Chromosomal DNA Although Fu et al. (17) showed that the E. coli Lon binds to a TG-rich pets site of the human immunodeficiency virus type2 enhancer, it is unclear whether Lon binds to specific sites on the E. coli genome. To examine this in greater detail, we cloned and sequenced the DNA fragments that were co-purified with the amylose resin-purified Lon. Twenty-one DNA clones were randomly selected for analysis. Their DNA sequences corresponded to 3821009-bp fragments containing b0899, b2324, ftsJ, leuC, lon, lpdX, malE, rhsE, secD, yacK, yafA, ybbC, yecA, yejB, yfhK, ygcU, and ymfE, and 496679-bp fragments containing the intercistronic regions between b2973 and b2972, cynS and cynX, rplM and rpsI, and yecS and yecC (Table II). There was no significant similarity among the sequences of these DNA fragments. Thus, in agreement with Charette et al. (15), it appears that Lon binds nonspecifically to E. coli chromosomal DNA.
|
| DISCUSSION |
|---|
|
|
|---|
We recently found that based on gel chromatography, the polyP-Lon complex is very large (>2000 kDa).2 Furthermore, dynamic light scattering measurements indicated a molecular mass of
8750 kDa (data not shown). Because one molecule polyP binds to approximately four molecules of Lon (4), it might be considered that the polyP-Lon complex is a multiple of the Lon hexamer. Additional studies must be performed to more precisely determine the structure of the polyP-Lon complex.
PolyP Affects the DNA-binding Activity of LonAnalysis of polyP and DNA binding by Lon mutants indicated that the polyP- and DNA-binding sites of Lon are localized in the ATPase domain. Also, polyP bound to Lon more strongly than DNA, which allows polyP to displace the Lon-associated DNA in vitro as well as in vivo. The ATPase domain is thought to be involved in the important chaperon activity (10), and DNA has been reported to stimulate the ATPase activity of Lon (15). However, we have shown previously that polyP slightly inhibits the ATPase activity of Lon in the absence of substrates (4). It is a bit puzzling that both of the polyP-Lon and DNA-Lon complexes show ATPase activities if polyP and DNA persistently cover the ATPase domain. It might be possible that polyP and DNA binding to the ATPase domain are dynamic rather than static.
Regulatory Effects of polyP on the Proteolytic and DNA-binding Activities of LonGoff and Goldberg (28) reported that overproduction of Lon causes the proteolysis of normal proteins in cells and is lethal to the host cells. We also observed that E. coli growth stopped immediately when Lon was overproduced (data not shown). Excess Lon is unfavorable to cells under normal conditions. Sonezaki et al. (29) speculated that Lon is normally localized in the multiprotein-DNA complex (nucleoid), which might restrict its ability to access and degrade proteins under normal conditions. They also showed that MBP-Lon was dissociated from DNA in the presence of denatured but not native bovine serum albumin and that treatment of MBP-Lon at 47 °C reduced its DNA-binding ability but does not affect its protease activity. These findings suggested that exposure to heat shock causes a release of Lon from DNA allowing it to degrade denatured proteins. Similarly our data suggested that when the levels of polyP increase in response to nutritional downshift, the polyP-Lon complex is released from DNA whereupon it can access and degrade free ribosomal proteins.
It is also possible that Lon binds to DNA at a site adjacent to a regulatory protein-binding site, thus leading to enhanced degradation of the regulatory protein. In agreement with this model, some early studies have suggested that Lon controls the level of mRNA transcription from the E. coli gal operon (30). In this case, polyP may modulate the function of Lon in transcriptional regulation. However, like Charette et al. (15), we suspected that E. coli Lon is a DNA-binding protein with low specificity. Further investigations are required to clarify the role of Lon in transcriptional regulation.
It remains unclear whether the main role of the DNA-binding ability of Lon is to prevent it from accessing and degrading substrate proteins or to mediate enhanced degradation of regulatory proteins. In any event, the drastic change in intracellular polyP levels that occurs during nutritional downshift can affect the DNA-binding ability of Lon and its regulation of cellular functions.
| FOOTNOTES |
|---|
|| To whom correspondence should be addressed: Dept. of Molecular Biotechnology, Hiroshima University, Hiroshima 739-8530, Japan. Tel.: 81-82-424-7758; Fax: 81-82-424-7047; E-mail: akuroda{at}hiroshima-u.ac.jp.
1 The abbreviations used are: polyP, inorganic polyphosphate; MBP, maltose-binding protein. ![]()
2 K. Nomura, J. Kato, N. Takiguchi, H. Ohtake, and A. Kuroda, unpublished observation. ![]()
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
S.-H. Chen, C. K. Suzuki, and S.-H. Wu Thermodynamic characterization of specific interactions between the human Lon protease and G-quartet DNA Nucleic Acids Res., March 27, 2008; 36(4): 1273 - 1287. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Lu, S. Yadav, P. G. Shah, T. Liu, B. Tian, S. Pukszta, N. Villaluna, E. Kutejova, C. S. Newlon, J. H. Santos, et al. Roles for the Human ATP-dependent Lon Protease in Mitochondrial DNA Maintenance J. Biol. Chem., June 15, 2007; 282(24): 17363 - 17374. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |