JBC Avanti Polar Lipids

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M404673200 on June 9, 2004

J. Biol. Chem., Vol. 279, Issue 33, 34614-34623, August 13, 2004
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
279/33/34614    most recent
M404673200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bhatnagar, A.
Right arrow Articles by Roth, B. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bhatnagar, A.
Right arrow Articles by Roth, B. L.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Caveolin-1 Interacts with 5-HT2A Serotonin Receptors and Profoundly Modulates the Signaling of Selected G{alpha}q-coupled Protein Receptors*

Anushree Bhatnagar{ddagger}, Douglas J. Sheffler{ddagger}, Wesley K. Kroeze{ddagger}, BethAnn Compton-Toth{ddagger}, and Bryan L. Roth{ddagger}§||

From the Departments of {ddagger}Biochemistry, §Neurosciences, and Psychiatry, Case Western Reserve University School of Medicine, Cleveland, Ohio 44106

Received for publication, April 27, 2004 , and in revised form, June 4, 2004.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
5-Hydroxytryptamine 2A (5-HT2A) serotonin receptors are important for a variety of functions including vascular smooth muscle contraction, platelet aggregation, and the modulation of perception, cognition, and emotion. In a search for 5-HT2A receptor-interacting proteins, we discovered that caveolin-1 (Cav-1), a scaffolding protein enriched in caveolae, complexes with 5-HT2A receptors in a number of cell types including C6 glioma cells, transfected HEK-293 cells, and rat brain synaptic membrane preparations. To address the functional significance of this interaction, we performed RNA interference-mediated knockdown of Cav-1 in C6 glioma cells, a cell type that endogenously expresses both 5-HT2A receptors and Cav-1. We discovered that the in vitro knockdown of Cav-1 in C6 glioma cells nearly abolished 5-HT2A receptor-mediated signal transduction as measured by calcium flux assays. RNA interference-mediated knockdown of Cav-1 also greatly attenuated endogenous G{alpha}q-coupled P2Y purinergic receptor-mediated signaling without altering the signaling of PAR-1 thrombin receptors. Cav-1 appeared to modulate 5-HT2A signaling by facilitating the interaction of 5-HT2A receptors with G{alpha}q. These studies provide compelling evidence for a prominent role of Cav-1 in regulating the functional activity of not only 5-HT2A serotonin receptors but also selected G{alpha}q-coupled receptors.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
The serotonin (5-hydroxytryptamine) 2A receptor (5-HT2A),1 a member of the "rhodopsin-like" (family A) G-protein-coupled receptors (GPCRs) (1), mediates the actions of many (2) but not all hallucinogens (3, 4) and is the target of a number of commonly prescribed therapeutic agents, including atypical anti-psychotics, antidepressants, and anxiolytics (5). As with other GPCRs, elucidating the mechanisms of signal transduction and regulation for 5-HT2A receptors is likely to be of great relevance for the rational design of novel medications (6–8). In particular, one point where the regulation of GPCR signaling converges is the endocytic pathway (8, 9), and therefore, this pathway is likely to play a role in various functions involving the 5-HT2A receptor.

Prototypically, GPCRs are internalized via an integrated process involving arrestins and G-protein receptor kinases, a process that has been most elegantly elucidated for the {beta}-adrenergic receptor (10), although many other proteins are also involved in the intracellular trafficking of GPCRs (6, 11). For example, we have uncovered a cell type-specific, arrestin-independent, dynamin-dependent mechanism of 5-HT2A receptor regulation (12, 13). In light of recent studies demonstrating that {beta}-adrenergic receptors, in particular, are associated with caveolae and caveolin in their native milieu (14, 15), we hypothesized that 5-HT2A receptors might also be associated with caveolae-enriched membrane specializations and that this interaction might functionally modulate 5-HT2A-mediated signal transduction.

Caveolae are small flask-shaped invaginations of the plasma membrane (16) containing high levels of cholesterol and glycosphingolipids and are initially characterized by the presence of the protein Cav-1 (17). Caveolae differ biochemically from other specialized subdomains of the plasma membrane (16). A family of caveolin proteins has been identified that includes caveolin-1, caveolin-2, and caveolin-3 (Cav-1, -2, and –3, respectively (18)), with Cav-1 and Cav-2 being expressed ubiquitously. Caveolae function is critically dependent on Cav-1 because caveolae are not formed in Cav-1 knockout mice (19); conversely, caveolin-deficient cells acquire caveolae when transfected with Cav-1 (20).

In prior studies, we found that caveolae were not normally required for the membrane targeting of 5-HT2A receptors heterologously expressed in either NIH 3T3 (21) or HEK-293 (12) cells, although a recent study (22) indirectly implicated caveolae in 5-HT2A-mediated signal transduction in vascular smooth muscle cells. Even though prior studies have not implicated Cav-1 as a modulator of 5-HT2A receptor signaling, Cav-1 has been indirectly implicated as a regulator of GPCR signaling via unknown mechanisms (19).

Here we report that both transiently transfected 5-HT2A receptors associate with Cav-1 in HEK-293 cells and endogenously expressed 5-HT2A receptors associate with Cav-1 in C6 glioma cells and rat brain synaptic membrane preparations. We also report that the RNAi-mediated knockdown of Cav-1 has profound functional consequences for 5-HT2A-mediated signal transduction in C6-glioma cells, a cell type that endogenously expresses both Cav-1 and 5-HT2A receptors. Most importantly, screening of C6 glioma cells for other G{alpha}q-coupled receptors showed that knockdown of Cav-1 modulated the signaling of purinergic receptors but not of PAR-1 thrombin receptors in C6 glioma cells, suggesting that only a subset of G{alpha}q-coupled receptors is regulated by Cav-1.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
cDNA Constructs and Reagents—The construct coding for FLAG-tagged wild type (wt) rat 5-HT2A receptor (FLAG-5-HT2A) (12) was modified by addition of an amino-terminal and cleavable signal peptide sequence (MKTIIALSYIFCLVFA; see Ref. 23) from influenza hemagglutinin and has been described elsewhere (24). The caveolin-1-myc cDNA was a gift from Gary Landreth (Case Western Reserve University), and the constitutively active G{alpha}q mutant (Q229L) was from David Siderovski (University of North Carolina, Chapel Hill). Thrombin receptor-activating peptide (TRAP) was a gift from Paul Di Corleto (Lerner Research Institute, Case Western Reserve University). All constructs containing inserts in the appropriate orientation were verified by automated sequencing (Cleveland Genomics, Cleveland, OH). 5-Hydroxytryptamine (5-HT) creatinine sulfate, ATP, and chlorpromazine were acquired from Sigma. [3H]Ketanserin and myo-[3H]inositol were purchased from PerkinElmer Life Sciences.

Transfection of HEK-293 Cells and C6 Glioma Cells—Human embryonic kidney 293 (HEK-293) cells and C6 glioma cells were maintained in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum, 1 mM sodium pyruvate, penicillin (100 units/ml), and streptomycin (100 mg/ml) (Invitrogen) at 37 °C and 5% CO2. Transient transfection of HEK-293 cells with FuGENE 6TM (Roche Applied Science) using a FuGENE to DNA ratio of 5:1 was performed according to the manufacturer's recommendations. A total of 6 µg of DNA was used in each co-transfection, 3 µg of which were FLAG-5-HT2A receptor or constitutively active G-protein (G{alpha}q*) and 3 µg of which were DNA encoding cav-1-myc or GFP. In case of triple transfections with FLAG-5-HT2A receptor, cav-1-myc, G{alpha}q, and/or GFP, 2 µg of each plasmid DNA was used. C6 glioma cells were transfected using LipofectAMINE2000 (Invitrogen). A total of 24 µg of DNA was used with 60 µl of LipofectAMINE as recommended by the manufacturer.

Immunocytochemistry, Agonist-mediated Internalization, and Image Quantification—Dual-labeling immunocytochemistry was performed essentially as described before (12), and images of cells treated with vehicle and or agonist 5-HT (10 µM) were acquired digitally using a Zeiss 410 confocal microscope (Oberkochen, Germany) without saturation of pixel intensities. Images were subsequently analyzed for percent receptor internalization using MetaView software (Universal Imaging) as detailed previously (24).

Co-immunoprecipitation and Immunoblot—Co-immunoprecipitation and immunoblotting were performed essentially as detailed previously (24, 25). For visualization and immunoprecipitation of Cav-1, a polyclonal Cav-1 antibody (1:2000) (BD Transduction Laboratories) was used, and a monoclonal M2-anti-FLAG antibody preconjugated to agarose beads was used to immunoprecipitate FLAG-tagged 5-HT2A receptors. Wheat germ agglutinin (WGA) preconjugated to agarose beads (Sigma) was used to concentrate native 5-HT2A receptors from C6 glioma cells after solubilization in 1.5% CHAPS. A rabbit polyclonal FLAG antibody (1:1500) (Sigma) was used to detect FLAG-5-HT2A receptors. A monoclonal mouse Cav-1 antibody and protein A/G-agarose were used to co-immunoprecipitate native receptor and Cav-1 from C6 glioma cells and rat brain synaptic membrane preparation. Rat brain synaptic membranes were prepared from rat frontal cortex as described previously (26). The native 5-HT2A receptor was detected by using a polyclonal 5-HT2A carboxyl-terminal antibody (27), a gift from Jon Backstrom (Vanderbilt University). The G{alpha}q in immunoprecipitates, the constitutively active G{alpha}q* mutant, and the endogenous wt G{alpha}q in cell lysates were detected by a rabbit polyclonal G{alpha}q antibody (1:2000) (Santa Cruz Biotechnology, Santa Cruz, CA). The immunoblots shown are representative of at least three independent experiments.

RNAi-mediated Knockdown of Cav-1—A DNA vector-based siRNAi was designed to stably knock down the expression of Cav-1 in C6 glioma cells by Genscript. Briefly, a commercial algorithm for designing a specific siRNA was used (www.genscript.com/ssl-bin/app/rnai). The length of the siRNA target, GC % range, and the rat cDNA sequence of Cav-1 were entered into the algorithm and potential siRNA targets generated. The ranking of siRNA candidates was based on the commercial algorithm. The target sequence CACACAGTTTCGACGGCATCT (52.38% GC content) was cloned into pRNA-U6.1/neo under the control of U6 promoter and neomycin selection marker, which was used to select stable lines. This insert-containing vector was then transfected into C6 glioma cells, as described above, and the subsequent isolation of Cav-1-depleted C6 glioma cells was done after selection of stable individual clones by using 0.6 mg of geneticin/liter of cell culture medium. Forty eight clones were individually picked and expanded in selection medium. After passaging the cells a minimum of three times, lysates were prepared as described above. To evaluate the stable knockdown of expression of Cav-1, 10 µg of protein lysates were subjected to SDS-PAGE followed by Western blot analysis probing for Cav-1. The clones, which showed maximal knockdown, were then maintained in the selection media containing 0.6 mg of geneticin/liter for further study. Lysates prepared from the clone with maximal knockdown of Cav-1 was also probed with rabbit polyclonal RSK1 (1:1000) (Santa Cruz Biotechnology), mouse monoclonal Cav-2 (1:500) (BD Transduction Laboratories), and polyclonal rabbit G{alpha}q antibodies.

Microarray Analysis of C6 Glioma Cells—Nearly confluent plates of C6 cells were harvested using RNase-free conditions, and a sample preparation was done by the Gene Expression Array Core Facility at Case Western Reserve University (www.geacf.net), following methods recommended by Affymetrix (see Supplemental Material for full details). Briefly, total RNA was extracted using Trizol (Invitrogen) followed by RNA clean up using Qiagen columns that were used to clean up cDNA and/or RNA as required using the manufacturer's protocol. This was followed by cDNA synthesis using an oligo(dT) primer coupled to T7 RNA polymerase promoter. Reverse transcription of RNA was done using Superscript II reverse transcriptase in a 20-µl reaction at 42 °C for 1 h. Second strand synthesis was carried out immediately in the presence of Escherichia coli DNA polymerase I, RNase H, and DNA ligase. The reaction mixture was incubated for 2 h at 16 °C and an additional 5 min in the presence of T4 DNA polymerase. The reaction was terminated by addition of EDTA followed by cDNA clean up using Qiagen columns and storage overnight at –20 °C. In vitro transcription was used to generate cRNA by using a Bioarray High Yield ENZOkit (Affymetrix) followed by clean up of RNA samples. Purified in vitro transcribed cRNA was subjected to fragmentation at 94 °C for 35 min using 1x fragmentation buffer (40 mM Tris acetate, pH 8.1, 100 mM KOAc, 30 mM MgOAc) and then placed on ice. Preconditioning for hybridization was done in 1x hybridization mixture (100 mM MES, 1 M [Na+], 20 mM EDTA, 0.01% Tween 20). Herring sperm and acetylated bovine serum albumin were added to a final concentration of 0.1 and 0.5 mg/ml, respectively. A 15-µl aliquot of a 20x mixture of in vitro transcripts of bacterial genes bioB, bioC, bioD, and cre were added to the mixture to give final concentrations of 1.5, 5, 25, and 100 pM, respectively. Control oligonucleotide was added to a final concentration of 50 pM. The amount of fragmentation reaction containing 15 µg of cRNA was added to the mixture, and the remaining volume was made up with molecular biology grade water. Preconditioning of the array chip was done in 1x hybridization buffer for 10–15 min at 45 °C with rotation (45 rpm). The preconditioning buffer was then removed from the chip chamber. Sample hybridization mixture was added to the chip and hybridized overnight (16 h) at 45 °C with rotation (45 rpm). For post-hybridization washing and staining, samples were recovered from the chips and stored in their original vials, and the hybridization chamber was filled with Buffer A (nonstringent, 6x), and hybridization was overnight (16 h) at 45 °C with rotation (45 rpm) in the sample hybridization mixture. For post-hybridization washing and staining samples were recovered from the chips and stored in their original vials. The hybridization chamber was filled with Buffer A (nonstringent, 6x SSPE (3 M NaCl, 0.2 M NaH2PO4, 0.02 M EDTA), 0.01% Tween 20). Modules in the Fluidics Station 400 were primed according to the Affymetrix protocol.

Samples were loaded into the modules, and washing and staining were done in stringent buffer B (10 mM MES, 0.1 N [Na+], 0.01% Tween 20), which was also used in the protocol. The streptavidin/phycoerythrin stain mixture was as follows: 50 mM MES, 0.5 M [Na+], 0.025% Tween 20, 2 mg/ml acetylated bovine serum albumin, 10 µg/ml streptavidin phycoerythrin.

The amplification (antibody) solution mixture was as follows: 50 mM MES, 0.5 M [Na+], 0.025% Tween 20, 2 mg/ml acetylated bovine serum albumin, 0.1 mg/ml normal goat IgG, 3 µg/ml biotinylated antibody. All Chips were scanned twice. For data analysis, images obtained were converted into Microsoft Excel format using MAS5.0 software (Affymetrix). All chips were scaled to mean target intensity of 1500. Affymetrix present and absent calls were used. For comparisons between chips, genes with 2-fold differences in expression compared with controls were considered to be significantly differentially expressed.

Radioligand Binding and Second Messenger Studies—Phosphoinositide hydrolysis assays with the constitutively active G{alpha}q* were performed as described previously (24). Kinetic binding parameters (Bmax and Kd) were determined from binding assays with [3H]ketanserin, and the results were replicated in at least three separate experiments as detailed previously (24). Phosphoinositide hydrolysis data were analyzed by nonlinear regression using Prism 3.0 software (GraphPad, San Diego, CA), and saturation-binding data were analyzed by using GraphPad Prism. Measurements of p42/44 ERK phosphorylation were performed as described previously by using total p42/44 ERK for normalization (28). Measurements of intracellular calcium mobilization on a Molecular Devices Flexstation were performed essentially as described recently (29), with response normalized to the maximum with each agonist (5-HT, ATP, and/or TRAP).

Statistical Analysis—Statistical significance for all studies was determined using a Student t test, and statistical significance was defined as p < 0.05.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
5-HT2A Receptors Interact with Cav-1—We initially investigated whether 5-HT2A receptors and cav-1-myc can associate in vitro by co-transfecting HEK-293 cells with FLAG-tagged 5-HT2A receptors (FLAG-5-HT2A) and Myc-tagged Cav-1 (Cav1-myc). As shown in Fig. 1, A–C, FLAG-5-HT2A and Cav-1 were co-localized on both the cell surface of HEK-293 cells and in Cav-1-enriched intracellular vesicles. Most interestingly, following agonist administration to induce internalization, little additional 5-HT2A receptor internalization was induced in cells co-expressing Cav-1 (Fig. 1, D–F; see Fig. 1G for quantification).



View larger version (18K):
[in this window]
[in a new window]
  		FIG. 1.
Cav-1 co-localizes with native 5-HT2A receptors independently of agonist exposure. For these experiments HEK-293 cells were transiently co-transfected with FLAG-5-HT2A + cav-1-myc (A–F). At 48 h following transfection, cells were placed in serum-free media for a minimum of 18 h and then exposed to vehicle (A–C) or 10 µM 5-HT (D–F) for 5 min. This was followed by dual-label immunofluorescent confocal microscopy (see "Experimental Procedures"). Representative images from one of three independent experiments are shown. FLAG-tagged native 5-HT2A receptors are shown in the red channel (A and D) and cav-1-myc is shown in the green channel (B and E). The merged images are in C and F. Scale bars are shown in all panels. G shows the quantitative analysis of percent receptor internalization in the presence and absence of Cav-1 in response to vehicle and or agonist 5-HT (10 µM) for 5 min. **, p < 0.05; ns, no statistically significant difference.

 
We next performed co-immunoprecipitation studies in HEK-293 cells co-transfected with FLAG-5-HT2A and Cav-1 to determine whether 5-HT2A receptors and Cav-1 interact. As can be seen, FLAG-tagged 5-HT2A receptors were co-immunoprecipitated robustly with Cav-1 (Fig. 2, 9th to 12th lanes), indicating that 5-HT2A receptors and Cav-1 associate with each other and are present in a complex in vitro. To establish the specificity of the interaction, we showed that cells co-transfected with Cav-1 and empty vector yielded minimal pull-down of Cav-1 (Fig. 2, 3rd and 4th lanes). Furthermore, no Cav-1 was pulled down from untransfected cells (Fig. 2, 1st and 2nd lanes) or from cells co-expressing 5-HT2A receptors and GFP (Fig. 2, 5th and 6th lanes). The interaction of FLAG-5-HT2A and Cav-1 was unaffected by agonist exposure (Fig. 2, compare 9th to 12th lanes). These findings demonstrated that Cav-1 forms a complex with 5-HT2A receptors in an agonist-independent fashion.



View larger version (33K):
[in this window]
[in a new window]
  		FIG. 2.
Cav-1 interacts with native 5-HT2A receptors in HEK-293 cells. For these experiments, HEK-293 cells were either untransfected (1st and 2nd lanes) or transiently co-transfected with Cav-1 (3rd and 4th lanes), FLAG-5-HT2A + GFP (5th and 6th lanes; treated with vehicle), FLAG-5-HT2A + GFP (7th and 8th lanes; treated with 10 µM 5-HT for 5 min), FLAG-5-HT2A+ Cav-1 (9th and 10th lanes; treated with vehicle), and FLAG-5-HT2A + Cav-1 (11th and 12th lanes; treated with 10 µM 5-HT for 5 min). FLAG-tagged native 5-HT2A receptors were immunoprecipitated (IP) by a monoclonal FLAG antibody conjugated to Sepharose beads. A polyclonal Cav-1 antibody detected Cav-1myc, and a polyclonal FLAG antibody on Western blots detected FLAG-5-HT2A. A polyclonal G{alpha}q antibody was used to probe for G-protein as lysate control. Representative immunoblots (IB) from a single experiment that has been replicated three times with equivalent results are shown. A and B, immunoblots from immunoprecipitates. C and D, immunoblots from cell lysates.

 
We also examined whether 5-HT2A receptors and Cav-1 are associated in a milieu in which both 5-HT2A receptors and Cav-1 are endogenously expressed. Several cell lines reported to express 5-HT2A receptors were tested including an aortic smooth muscle cell line (A7R5 (30)), NIH 3T3 cells (31), and C6 glioma cells (13). As controls, we also examined HEK-293 cells, which express little Cav-1, and GF-62 cells, which we have demonstrated previously (21) express little Cav-1. We found that C6 glioma cells expressed the highest levels of Cav-1, and these were therefore chosen for further study.

Co-immunoprecipitation studies were then performed in C6 glioma cells and rat brain synaptic membrane preparations wherein endogenous Cav-1 was immunoprecipitated, and the immunoprecipitates were probed for endogenous 5-HT2A-like immunoreactivity. Fig. 3B shows that 5-HT2A receptors were co-immunoprecipitated with Cav-1 in C6 glioma cells, and Fig. 3C shows co-immunoprecipitation of native 5-HT2A receptors by Cav-1 from solubilized rat brain synaptic membrane preparations. As controls to verify the specificity of the interaction, 5-HT2A receptors were immunoprecipitated with protein-A/G beads conjugated to agarose in the absence (–) and/or presence of a monoclonal Cav-1 antibody (+). Fig. 3B, top panel, 1st lane, shows no immunoreactivity to 5-HT2A receptor antibody, and the 2nd lane shows that 5-HT2A receptors were co-immunoprecipitated with Cav-1. The 2nd panel from the top of Fig. 3B shows the 1st lane with minimal Cav-1 immunoreactivity (e.g. negative control lane), and the 2nd lane shows a large amount of Cav-1 was detected when Cav-1 was immunoprecipitated (e.g. positive control lane). The 3rd panel from the top of Fig. 3B shows representative immunoblots from cell lysates to detect total Cav-1. The bottom panel of Fig. 3B shows 5-HT2A-like immunoreactivity in C6 glioma lysates.



View larger version (25K):
[in this window]
[in a new window]
  		FIG. 3.
Cav-1 interacts with native 5-HT2A receptors in C6 glioma cells and rat brain homogenates. For these experiments cell lysate was prepared from various cell lines, and equivalent amounts of protein were loaded for all sets in duplicate. Representative immunoblot from a single experiment that has been replicated three times with equivalent results shows the expression of Cav-1 in HEK-293 cells, C6 glioma cells, A75R5, 3T3, and a 3T3 cell line stably expressing 5-HT2A receptors (GF62; A). B, 5-HT2A receptors were immunoprecipitated (IP) with Cav-1 in C6 glioma cells. The top panel shows that 5-HT2A receptors were immunoprecipitated by monoclonal Cav-1 antibody (2nd lane) preconjugated to protein-A/G beads. The 2nd panel from the top shows robust Cav-1 detection in the immunoprecipitate in the presence of Cav-1 antibody (2nd lane (+)). The 3rd and 4th panels from the top represents the immunoblots used to detect Cav-1 and 5-HT2A receptor proteins, respectively, in the total C6 cell lysate. C, 5-HT2A receptors were immunoprecipitated with Cav-1 from rat brain synaptic membrane preparations. Top panel shows 5-HT2A receptors were co-immunoprecipitated with Cav-1 antibody and protein A/G-agarose (2nd lane) but not with protein A/G-agarose beads alone (–). The 2nd panel from the top shows that Cav-1 was found in the immunoprecipitates (lane 2). The 3rd and 4th panels from the top shows immunoblots (IB) used to detect Cav-1 and 5-HT2A receptors, respectively, from total membrane lysates. Shown are representative immunoblots from a single experiment that has been replicated three times with equivalent results.

 
In rat brain membrane preparations 5-HT2A receptors were immunoprecipitated with protein-A/G beads conjugated to agarose without (–) or with a monoclonal Cav-1 antibody (+). As shown in Fig. 3C, top panel, 1st lane (–) shows no immunoreactivity to 5-HT2A receptor antibody, and the 2nd lane (+) shows that 5-HT2A receptors were co-immunoprecipitated with Cav-1. The 2nd panel from the top of Fig. 3C shows the 1st lane wherein minimal Cav-1 immunoreactivity to polyclonal Cav-1 antibody was detected in the negative control, and the 2nd lane shows that Cav-1 in the immunoprecipitate was detected (e.g. positive control). The 3rd panel from the top of Fig. 3C represents the immunoblots from the cell lysates to detect endogenous Cav-1. The bottom panel of Fig. 3C represents the immunoblot from rat membrane preparation to verify the expression of 5-HT2A receptors. Taken together, these results indicate that 5-HT2A receptors are complexed with Cav-1 in both transfected cells and in their native milieu.

RNAi-mediated Knockdown of Cav-1 in C6 Glioma Cells—We next examined whether Cav-1 functions as a physiological modulator of 5-HT2A signaling by stably suppressing the expression of Cav-1 in C6 glioma cells using RNAi-mediated gene silencing. We clonally isolated 48 separate C6 lines that survived selection, and we quantified the level of relative Cav-1 expression by Western blot analysis. Shown in Fig. 4A are representative results from five lines screened for Cav-1 expression. Fig. 4B shows representative results from one of the surviving lines, clone 2 of the several screened for Cav-1 expression. All the signaling studies were subsequently carried out with clone 2. The Cav-1 knockdown C6 glioma cells appeared to be morphologically similar to wild-type C6 cells, although they had a slower doubling time than wt C6 cells (data not shown). In our initial studies we examined the relative expression of two unrelated proteins, G{alpha}q and ribosomal S6 kinase-1 (RSK1), to determine the specificity of the RNAi-mediated knockdown of Cav-1. We also examined the expression of Cav-2, another member of caveolin family of proteins. As can be seen in Fig. 4B, both the parental and the RNAi-Cav-1 lines expressed similar amounts of G{alpha}q and RSK1. However, as shown in Fig. 4C there is a significant down-regulation in the expression of protein Cav-2 with no change in G{alpha}q protein levels suggesting that the expression of Cav-2 protein is regulated by Cav-1, as reported previously (33).



View larger version (22K):
[in this window]
[in a new window]
  		FIG. 4.
RNAi-mediated knockdown of Cav-1. For these experiments C6 glioma cells were transfected with pRNA-U6.1/Neo-RNAi-Cav-1 vector, and clones were stably selected (see "Experimental Procedures" for details). A, representative immunoblot (IB) of five clonally isolated cell lines screened for the presence of Cav-1 (equal amount of protein was loaded in duplicates). B, representative immunoblot for RNAi clone showing knockdown of protein Cav-1 with respect to wt C6 glioma cell lysates. Samples were loaded in duplicate and also probed for total G{alpha}q and RSK1 to assess nonspecific knockdown of unrelated proteins. C, representative immunoblot for RNAi clone showing knockdown of protein Cav-2 with respect to wt C6 glioma cell lysates. Equal amounts of protein were loaded in duplicate and, as a control, probed for total G{alpha}q in the samples.

 
RNAi-mediated Knockdown of Cav-1 Profoundly Suppresses 5-HT2A-mediated Signaling—We next examined 5-HT2A-mediated signal transduction in wt and Cav-1 knockdown C6 cells. As shown in Fig. 5A, 5-HT2A-mediated intracellular Ca2+ mobilization was nearly abolished in Cav-1 knockdown C6 cells. To determine whether this represented a generalized effect on G{alpha}q-mediated signaling, we performed a cDNA microarray experiment to identify other G{alpha}q-coupled GPCRs that are endogenously expressed in C6 cells. As shown in Table I and in the Supplemental Material, several other GPCRs were expressed, including the P2Y purinergic receptor and the coagulation factor II receptor (PAR-1), both of which are coupled to G{alpha}q. Fig. 5B shows that the ATP-induced Ca2+ transients induced by P2Y purinergic receptor activation were also greatly attenuated in Cav-1 knockdown C6 cells. However, the TRAP-induced Ca2+ flux mediated by PAR-1 was unaffected (Fig. 5C). Estimates of agonist potency (EC50) and efficacy (Emax) values revealed that Cav-1 knockdown altered the efficacy without significantly altering potency (Table II). As a control, we also examined the response induced by the calcium ionophore A23187 [GenBank] response (Fig. 5D). These results indicate that Cav-1 modulates signaling of some but not all G{alpha}q-coupled receptors. The results also imply that Cav-1 knockdown does not induce a generalized dysfunction of G{alpha}q-mediated signaling.



View larger version (23K):
[in this window]
[in a new window]
  		FIG. 5.
Knockdown of Cav-1 expression impairs signaling of 5-HT2A receptors and P2Y purinergic receptors without altering signaling of PAR-1 thrombin receptors. For these experiments wt C6 glioma cells and RNAi-mediated knocked down Cav-1 cells were plated onto 96-well plates. Cells were place in serum-free media for a minimum of 18 h and then exposed to agonist as detailed previously (29). Left panel shows the sigmoid dose response to various agonists (A–C, 5-HT, ATP, and TRAP, respectively) in normalized relative fluorescence units (RFU). D shows the bar graph representing the maximal response of wt and Cav-1 knockdown C6 cell to calcium ionophore A23187 [GenBank] . The panels on the right show the changes in fluorescence of wt and RNAi-mediated Cav-1 knockdown C6 cells with time when exposed to vehicle, maximal agonist, and calcium ionophore. (A–D, 5-HT, ATP, TRAP, and A23187 [GenBank] , respectively). A shows the 5-HT-mediated dose response for calcium flux for wild-type and Cav-1 knockdown cells; B shows the ATP-mediated dose response for calcium flux for wild-type and Cav-1 knockdown cells; C shows the thrombin-mediated PAR-1 receptor response of wt C6 glioma and C6 Cav-1 RNAi cells; and D shows the maximal response of wt and Cav-1 knockdown cell response to calcium ionophore A23187 [GenBank] .

 


View this table:
[in this window]
[in a new window]
  		TABLE I
Microarray analysis of rat C6 glioma cells reveals the expression of selected GPCRs

Shown are the gene title and gene symbols for various GPCRs identified by microarray analysis of C6 glioma mRNA as being present (see Supplemental Material for details).

 


View this table:
[in this window]
[in a new window]
  		TABLE II
RNAi-mediated knockdown of Cav-1 modulates 5-HT2A-serotonin and P2Y purinergic but not PAR-1-thrombin receptor-mediated signaling

Agonist potencies (EC50) and efficacies (Emax) were determined for agonist-mediated activation of intracellular Ca2+ mobilization as described under "Experimental Procedures." Data from radioligand binding assays include estimates of affinity (Kd in nM) and the maximal receptor number (Bmax in fmol/mg) for [3H]ketanserin. The results represent the average of three independent experiments.

 
RNAi-mediated Knockdown of Cav-1 Does Not Alter 5-HT2A Receptor Binding or Expression—To address the possibility that the impairment in 5-HT2A receptor signaling was a consequence of decreased 5-HT2A receptor expression in Cav-1 knockdown cells, we concentrated the receptor protein by using WGA-agarose and subjected the eluate to immunoblot analysis in order to estimate receptor protein expression in Cav-1 knockdown cells versus wt C6 glioma cells. Total cell lysates were also probed for G{alpha}q as a loading control. Fig. 6A shows a representative immunoblot of 5-HT2A expression in wt C6 cells and Cav-1 knockdown cells; as can be seen the Cav-1 knockdown cells expressed slightly more 5-HT2A-like immunoreactivity as assessed by Western blot analysis. We also performed radioligand binding assays using [3H]ketanserin, a selective 5-HT2A radioligand in both sets of cells. As shown in Table II there was no significant change in maximal binding potential of 5-HT2A receptor in wt C6 cells and Cav-1 knockdown C6 cells (p value > 0.05) or affinity of 5-HT2A receptors for ketanserin. These data demonstrate that the impairment in signaling of 5-HT2A receptors in Cav-1 knockdown cells is not a consequence of altered receptor expression.



View larger version (43K):
[in this window]
[in a new window]
  		FIG. 6.
Knockdown of Cav-1 expression has no effect on 5-HT2A protein expression. For these experiments wt C6 glioma cells and Cav-1 knockdown cells were prepared for immunoblot (IB) analysis and radioligand binding assays as described previously. Shown here is a representative immunoblot, which reveals a modest increase in expression of WGA affinity-purified 5-HT2A receptors in RNAi-knockdown Cav-1 cells as compared with wt C6 cells.

 
RNAi-mediated Knockdown of Cav-1 Induces a Dysregulation of p42/44 MAP Kinase Activity—We next examined 5-HT2A-mediated p42/44 MAP kinase phosphorylation in response to agonist in wt C6 glioma cells and Cav-1 knockdown C6 cells. Fig. 7A is a representative immunoblot that shows an apparent increase in basal p42/44 phosphorylation in Cav-1 knockdown cells, whereas the total ERK levels were equivalent within each set (Fig. 7B). Exposure to 10 µM 5-HT for 5 min increased p42/44 ERK phosphorylation in wild-type but not in Cav-1 knockdown cells. Fig. 7C depicts the quantification of the increase in phosphorylation upon 5-HT exposure over basal (normalized to total ERK). The average data from three independent experiments showed a significant decrease (p < 0.05) in p42/44 ERK phosphorylation levels upon agonist exposure in Cav-1 knockdown cells when normalized to total ERK. Our data show that upon 5-HT exposure there is an increase in phospho-ERK that is equivalent in both wt and Cav-1 knockdown C6 cells. As shown in Fig. 7D, the data are represented as a 5-HT-induced increase in phospho-ERK normalized to wt basal, where the maximal increase in phospho-ERK is significantly increased (p < 0.05) in both wt and Cav-1 knockdown C6 glioma cells.



View larger version (18K):
[in this window]
[in a new window]
  		FIG. 7.
Knockdown of Cav-1 expression induces a dysregulation of basal and agonist-stimulated p42/44 ERK phosphorylation. For these experiments wt C6 cells endogenously expressing 5-HT2A receptors and Cav-1 and RNAi-mediated knockdown Cav-1 cells were used. Cells were put into serum-free media for a minimum of 18 h and then exposed to vehicle (–) or 10 µM 5-HT (+) for 5 min. Lysates were prepared (see "Experimental Procedures") and subjected to immunoblot analysis and probed for pERK42/44 total ERK42/44 levels. Representative immunoblots from a single experiment that has been replicated three times with equivalent results are shown. A, immunoblot pERK42/44; B, immunoblot ERK42/44; C, quantification of the net pixel intensities of p42/44 ERK normalized to total 42/44 ERK; D, data represent an increase in pixel intensity on 5-HT exposure of p42/44 ERK normalized to wt basal.

 
Cav-1 Overexpression Minimally Affects G{alpha}q*-mediated Activation of Phospholipase C—To investigate the possibility that Cav-1 modulates the phospholipase C signaling pathway by associating with downstream effectors (i.e. G{alpha}q and phospholipase C), we examined whether Cav-1 modulated inositol phosphate accumulation in HEK-293 cells transiently expressing a constitutively active form of G{alpha}q (G{alpha}q*) with GFP and or Cav-1. G{alpha}q* activates phospholipase C and elevates immunoprecipitation levels independent of the activation of G{alpha}q-coupled receptors (32). In the absence of 5-HT2A receptors, overexpression of Cav-1 modestly but significantly attenuated the G{alpha}q*-stimulated inositol phosphate accumulation when compared with GFP alone (p < 0.05; Fig. 8A). It has been reported previously that the association of Cav-1 with G-proteins invariably attenuates their activity. Most importantly, Cav-1 did not cause any change in the relative expression of G{alpha}q* (Fig. 8B). These findings support the hypothesis that Cav-1 modulates intracellular signaling at the level of receptor-effector coupling and not via a receptor-independent attenuation of G{alpha}q signaling.



View larger version (22K):
[in this window]
[in a new window]
  		FIG. 8.
Cav-1 overexpression modestly attenuates G{alpha}q signaling. For these experiments, a constitutively active form of G{alpha}q (Q229L or G{alpha}q*) was co-transfected with either GFP or Cav-1myc in HEK-293 cells. A, Cav-1 (Cav-1 + G{alpha}q*) modestly attenuates G{alpha}q*-stimulated inositol phosphate accumulation over G{alpha}q* + GFP in the absence of 5-HT2A receptors. B shows a representative immunoblot of total G{alpha}q from all sample groups (in duplicate). Results shown represent the mean (±S.E.) of three independent experiments.

 
Caveolin-1 Potentiates the Interaction between G{alpha}q and 5-HT2A Receptors—To investigate further the role of Cav-1 in modulation of 5-HT2A receptor signaling, we performed immunoprecipitation studies in HEK-293 cells co-transfected with 5-HT2A receptors and G{alpha}q in the presence and absence of Cav-1. Forty-eight hours post-transfection cells were serum-starved for 18 h and exposed to agonist for various times. Cells were then lysed, and 5-HT2A receptors were immunoprecipitated as described earlier (see "Experimental Procedures"), and G{alpha}q was detected in the immunoprecipitates using anti-G{alpha}q antibody (Fig. 9A). Immunoblot analysis showed that in presence of Cav-1 there is a significant increase of G{alpha}q detected in the immunoprecipitates under conditions of no agonist and at 2 min after agonist exposure (Fig. 9A compare the 4th and 5th with the 7th and 8th lanes). Fig. 9B shows the quantitative analysis of the net pixel intensities of bands from three independent experiments normalized to the total G{alpha}q in the lysate. The data show a significant increase in G{alpha}q in the immunoprecipitates in presence of Cav-1. These findings imply that Cav-1 plays a major role in modulating the signaling of 5-HT2A receptors by promoting a functional interaction between 5-HT2A receptors and G{alpha}q.



View larger version (22K):
[in this window]
[in a new window]
  		FIG. 9.
Cav-1 potentiates 5-HT2A receptor interactions with G{alpha}q in absence of agonist. For these experiments, G{alpha}q was co-transfected with 5-HT2A receptors and either GFP or Cav-1 in HEK-293 cells. Cells were put in serum-free media for a minimum of 18 h, and then exposed to vehicle (0) or 10 µM 5-HT for 2 and 5 min. Lysates were prepared and subjected to immunoprecipitation (IP) using M2 FLAG preconjugated agarose ("Experimental Procedures"). A, shown is a representative immunoblot (IB) from a single experiment that has been replicated three times with equivalent results. B, quantification of the net pixel intensities of G{alpha}q in the immunoprecipitates normalized to total G{alpha}q. Each set was then normalized to the maximum in each set. Result shown here are the means ± S.E. from all three experiments.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
The major findings of the present work are that Cav-1 associates with 5-HT2A receptors in vivo and in vitro, promotes the association of 5-HT2A receptors with G{alpha}q, and that the RNAi-mediated knockdown of Cav-1 profoundly impairs signaling of 5-HT2A receptors and selected G{alpha}q-coupled GPCRs. Caveolin-1 has thus emerged as a novel modulator of 5-HT2A receptor signaling. We also demonstrate that the RNAi-mediated knockdown of Cav-1 expression in C6 glioma cells profoundly impairs signaling for extracellular ATP acting on P2Y purinergic receptors without altering PAR-1 thrombin receptor-mediated signaling. Taken together, these results imply that Cav-1 plays a major role in modulating the signal transduction of selected G{alpha}q-coupled GPCRs. We also show that the impairment of signaling in Cav-1 knockdown cells was not a consequence of altered receptor or G{alpha}q protein content. Additionally, our studies with a constitutively active G{alpha}q imply that Cav-1 does not directly potentiate G{alpha}q signaling. Instead, our results suggest that Cav-1 facilitates functional interactions between G{alpha}q and selected GPCRs.

Prior studies by Razani et al. (33) in Cav-1 null mouse fibroblasts have shown that in the absence of Cav-1 there is a drastic reduction in Cav-2 levels because Cav-2 is not targeted to the membrane and is subsequently degraded intracellularly. In another study, an antisense strategy used to deplete Cav-1 in NIH 3T3 cells had no effect on expression of Cav-2 (34). In our present study we report that the stable knockdown of Cav-1 had no significant effect on the mRNA levels of Cav-2; Cav-3 was not measured because it is not expressed in C6 glioma cells (microarray data not shown). However, we report a significant reduction in Cav-2 protein expression suggesting that Cav-2 protein is degraded in Cav-1 knockdown C6 glioma cells, as shown previously (33) for mouse embryonic fibroblasts from Cav-1 knockout mice.

Cav-1 is an integral membrane protein, which associates with numerous lipid-modified signaling molecules including Ha-Ras, c-Src, and endothelial nitric-oxide synthase, and almost invariably attenuates the activity of the signaling molecule when overexpressed (35, 36). Additionally, Cav-1 directly interacts with the EGF receptor and inhibits its activity (37), and such an interaction leads to internalization of EGF receptor via caveolar domains (38). More recent studies have shown that transcriptional up-regulation of Cav-1 in senescent cells attenuates EGF-mediated signaling thus implicating the role of Cav-1 in EGF receptor-mediated signaling and the general unresponsiveness of senescent cells to growth stimuli (39). The ability of Cav-1 to regulate oncogenes and the downstream signaling cascades has been observed in many overexpression studies wherein Cav-1 is a potent inhibitor of the Ras-p42/44 MAP kinase cascade (40). On the other hand antisense-mediated down-regulation of Cav-1 leads to hyperactivation of the p42/44 MAP kinase cascade (34). These studies suggest that Cav-1 is a modulator of multiple signaling cascades. In this regard, we found that Cav-1 knockdown in C6 glioma cells significantly elevates basal p42/44 ERK phosphorylation and impairs 5-HT2A agonist-mediated p42/44 ERK phosphorylation. Thus, Cav-1 knockdown appears to induce a dysregulation of GPCR-mediated p42/44 ERK phosphorylation.

Our results are especially intriguing in light of a recent study that has indirectly implicated caveolae in 5-HT2A-mediated signal transduction (22) in vascular smooth muscle cells. In those studies, the authors reported that 5-HT2A receptors were enriched in "lipid rafts" isolated by sucrose density gradients. We have also found that a small fraction of 5-HT2A receptors is located in the caveolar fraction when Cav-1 is overexpressed in HEK-293 cells and in C6 glioma cells where both proteins are endogenously expressed.2 The localization of other GPCRs such as B2 bradykinin receptors (41) and {beta}1- and {beta}2-adrenergic receptors in the caveolar fraction has been reported previously (42), where the role of caveolae has been implicated as trafficking centers where GPCRs translocate into or out of the caveolae. Our findings that the effect of Cav-1 knockdown is seen with at least one other G{alpha}q-coupled GPCR family (P2Y purinergic receptors) and not with PAR-1 implies that Cav-1 selectively modulates G{alpha}q-coupled receptor signaling, perhaps by promoting association with G{alpha}q.

Recent in vivo studies with Cav-1 knockout mice (19) suggest an indispensable role of Cav-1 in normal life span and cardiac, pulmonary, and vascular functioning (43, 44). Our studies, wherein Cav-1 is knocked down, revealed that in the absence of Cav-1 the signalings of 5-HT2A and P2Y receptors were nearly totally abolished. Because 5-HT2A receptors represent the principal vascular smooth muscle 5-HT receptor and a main pulmonary and cardiac 5-HT receptor, and because purinergic receptors are ubiquitously expressed, our results suggest that the profound cardiovascular phenotype found in Cav-1 knockout mice may result, in part, from impaired serotonergic and purinergic signaling.

A preliminary microarray analysis of Cav-1 knockdown C6 glioma cells shows that the Cav-1 knockdown cells exhibited no global changes in gene expression compared with the parental cells, although Cav-1 but not Cav-2 mRNA was significantly diminished (not shown). Most important, mRNA levels for 5-HT2A serotonin receptors and PAR-1 receptors remained unchanged along with the relative mRNA levels for all of the various proteins involved in G{alpha}q-mediated signaling (not shown). However, the mRNA encoding the P2Y2 purinergic receptors was absent in Cav-1 knockdown cells and present in wt C6 cells. Most intriguingly, for another G{alpha}q-coupled P2Y receptor subtype (P2Y5), the steady-state mRNA levels remain unchanged in parental and Cav-1 knockdown cells (not shown). The selective knockdown of P2Y2 likely accounts for at least some of the decreased response to ATP seen in the Cav-1 knockdown cells. The precise role of Cav-1 in selectively regulating the expression of a single subtype of P2Y family receptors (e.g. P2Y2 and not P2Y5) will require further study.

In summary we have discovered a novel role for Cav-1 in regulating the activity of serotonergic and purinergic receptors but not thrombinergic G{alpha}q-coupled receptors. Our results indicate that Cav-1 associates with the 5-HT2A receptors in vitro (HEK-293 and C6 cells) and in vivo (rat brain synaptic membranes) and that this interaction has profound functional significance. Given the widespread distribution of serotonergic receptors (e.g. platelets, gastrointestinal smooth muscle, uterine smooth muscle, kidneys, the cardiovascular system, and the brain) and the correspondingly ubiquitous distribution of Cav-1, it is likely that the 5-HT2A-Cav-1 interactions represent a functionally significant protein-protein interaction of potentially profound biological significance.


   FOOTNOTES
 
* This work was supported in part by NIH Grants KO2MH01366, RO1MH57635, and RO1MH61887 (to B. L. R.) and Grant P30 CA43703 from the Gene Expression Array Core Facility of the Comprehensive Cancer Center of Case Western Reserve University and University Hospitals of Cleveland. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

The on-line version of this article (available at http://www.jbc.org) contains a table. Back

|| To whom correspondence should be addressed: Dept. of Biochemistry, Rm. W441, Case Western Reserve University School of Medicine, 2109 Adelbert Rd., Cleveland, OH 44106-4935. Tel.: 216-368-2730; Fax: 216-368-3419; E-mail: bryan.roth{at}case.edu.

1 The abbreviations used are: 5-HT2A, 5-hydroxytryptamine 2A; GPCR, G-protein-coupled receptor; wt, wild type; HEK-293, human embryonic kidney 293; MES, 4-morpholineethanesulfonic acid; WGA, wheat germ agglutinin; GFP, green fluorescent protein; CHAPS, 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonic acid; ERK, extracellular signal-regulated kinase; RNAi, RNA interference; Cav-1, caveolin-1; 5-HT, 5-hydroxytryptamine; MAP, mitogen-activated protein; EGF, epidermal growth factor; siRNA, small interfering RNA; TRAP, thrombin receptor-activating peptide. Back

2 A. Bhatnagar, W. Kroeze, and B. L. Roth, manuscript in preparation. Back


   ACKNOWLEDGMENTS
 
We thank Dr. David Siderovski for providing the constitutively active form of G{alpha}q and Dr. Jon Backstrom for generously providing the 5-HT2A carboxy terminus-specific antibody.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Kroeze, W. K., Sheffler, D. J., and Roth, B. L. (2003) J. Cell Sci. 116, 4867–4869[Free Full Text]
  2. Glennon, R. A., Titler, M., and McKenney, J. D. (1984) Life Sci. 35, 2505–2511[CrossRef][Medline] [Order article via Infotrieve]
  3. Roth, B. L., Baner, K., Westkaemper, R., Siebert, D., Rice, K. C., Steinberg, S., Ernsberger, P., and Rothman, R. B. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, 11934–11939[Abstract/Free Full Text]
  4. Sheffler, D. J., and Roth, B. L. (2003) Trends Pharmacol. Sci. 24, 107–109[CrossRef][Medline] [Order article via Infotrieve]
  5. Roth, B. L., Kroeze, W. K., and Sheffler, D. J. (2004) Nat. Rev. Drug Discov. 3, 353–359[CrossRef][Medline] [Order article via Infotrieve]
  6. Gray, J. A., and Roth, B. L. (2002) Science 297, 529–531[Free Full Text]
  7. Raymond, J. R., Mukhin, Y. V., Gelasco, A., Turner, J., Collinsworth, G., Gettys, T. W., Grewal, J. S., and Garnovskaya, M. N. (2001) Pharmacol. Ther. 92, 179–212[CrossRef][Medline] [Order article via Infotrieve]
  8. Sorkin, A., and Von Zastrow, M. (2002) Nat. Rev. Mol. Cell Biol. 3, 600–614[CrossRef][Medline] [Order article via Infotrieve]
  9. Ferguson, S. S. (2001) Pharmacol. Rev. 53, 1–24[Abstract/Free Full Text]
  10. Pierce, K. L., Premont, R. T., and Lefkowitz, R. J. (2002) Nat. Rev. Mol. Cell Biol. 3, 639–650[CrossRef][Medline] [Order article via Infotrieve]
  11. Whistler, J. L., Enquist, J., Marley, A., Fong, J., Gladher, F., Tsuruda, P., Murray, S. R., and Von Zastrow, M. (2002) Science 297, 615–620[Abstract/Free Full Text]
  12. Bhatnagar, A., Willins, D. L., Gray, J. A., Woods, J., Benovic, J. L., and Roth, B. L. (2001) J. Biol. Chem. 276, 8269–8277[Abstract/Free Full Text]
  13. Gray, J. A., Sheffler, D. J., Bhatnagar, A., Woods, J. A., Hufeisen, S. J., Benovic, J. L., and Roth, B. L. (2001) Mol. Pharmacol. 60, 1020–1030[Abstract/Free Full Text]
  14. Rybin, V. O., Xu, X., Lisanti, M. P., and Steinberg, S. F. (2000) J. Biol. Chem. 275, 41447–41457[Abstract/Free Full Text]
  15. Xiang, Y., Rybin, V. O., Steinberg, S. F., and Kobilka, B. (2002) J. Biol. Chem. 277, 34280–34286[Abstract/Free Full Text]
  16. Anderson, R. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 10909–10913[Abstract/Free Full Text]
  17. Rothberg, K. G., Heuser, J. E., Donzell, W. C., Ying, Y. S., Glenney, J. R., and Anderson, R. G. (1992) Cell 68, 673–682[CrossRef][Medline] [Order article via Infotrieve]
  18. Razani, B., Woodman, S. E., and Lisanti, M. P. (2002) Pharmacol. Rev. 54, 431–467[Abstract/Free Full Text]
  19. Drab, M., Verkade, P., Elger, M., Kasper, M., Lohn, M., Lauterbach, B., Menne, J., Lindschau, C., Mende, F., Luft, F. C., Schedl, A., Haller, H., and Kurzchalia, T. V. (2001) Science 293, 2449–2452[Abstract/Free Full Text]
  20. Fra, A. M., Williamson, E., Simons, K., and Parton, R. G. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 8655–8659[Abstract/Free Full Text]
  21. Berry, S., Shah, M., Khan, N., and Roth, B. (1996) Mol. Pharmacol. 50, 306–313[Abstract]
  22. Dreja, K., Voldstedlund, M., Vinten, J., Tranum-Jensen, J., Hellstrand, P., and Sward, K. (2002) Arterioscler. Thromb. Vasc. Biol. 22, 1267–1272[Abstract/Free Full Text]
  23. Guan, X. M., Kobilka, T. S., and Kobilka, B. K. (1992) J. Biol. Chem. 267, 21995–21998[Abstract/Free Full Text]
  24. Xia, Z., Gray, J. A., Compton-Toth, B. A., and Roth, B. L. (2003) J. Biol. Chem. 278, 21901–21908[Abstract/Free Full Text]
  25. Gray, J. A., Bhatnagar, A., Gurevich, V. V., and Roth, B. L. (2003) Mol. Pharmacol. 63, 961–972[Abstract/Free Full Text]
  26. Roth, B., Laskowski, M., and Coscia, C. (1981) J. Biol. Chem. 256, 10017–10023[Medline] [Order article via Infotrieve]
  27. Backstrom, J. R., and Sanders-Bush, E. (1997) J. Neurosci. Methods 77, 109–117[CrossRef][Medline] [Order article via Infotrieve]
  28. Setola, V., Hufeisen, S. J., Grande-Allen, K. J., Vesely, I., Glennon, R. A., Blough, B., Rothman, R. B., and Roth, B. L. (2003) Mol. Pharmacol. 63, 1223–1229[Abstract/Free Full Text]
  29. Rothman, R. B., Vu, N., Partilla, J. S., Roth, B. L., Hufeisen, S. J., Compton-Toth, B. A., Birkes, J., Young, R., and Glennon, R. A. (2003) J. Pharmacol. Exp. Ther. 307, 138–145[Abstract/Free Full Text]
  30. Doyle, V. M., Creba, J. A., Ruegg, U. T., and Hoyer, D. (1986) Naunyn-Schmiedeberg's Arch. Pharmacol. 333, 98–103[CrossRef][Medline] [Order article via Infotrieve]
  31. Saucier, C., and Albert, P. R. (1997) J. Neurochem. 68, 1998–2011[Medline] [Order article via Infotrieve]
  32. Booden, M. A., Siderovski, D. P., and Der, C. J. (2002) Mol. Cell. Biol. 22, 4053–4061[Abstract/Free Full Text]
  33. Razani, B., Engelman, J. A., Wang, X. B., Schubert, W., Zhang, X. L., Marks, C. B., Macaluso, F., Russell, R. G., Li, M., Pestell, R. G., Di Vizio, D., Hou, H., Jr., Kneitz, B., Lagaud, G., Christ, G. J., Edelmann, W., and Lisanti, M. P. (2001) J. Biol. Chem. 276, 38121–38138[Abstract/Free Full Text]
  34. Galbiati, F., Volonte, D., Engelman, J. A., Watanabe, G., Burk, R., Pestell, R. G., and Lisanti, M. P. (1998) EMBO J. 17, 6633–6648[CrossRef][Medline] [Order article via Infotrieve]
  35. Smart, E. J., Graf, G. A., McNiven, M. A., Sessa, W. C., Engelman, J. A., Scherer, P. E., Okamoto, T., and Lisanti, M. P. (1999) Mol. Cell. Biol. 19, 7289–7304[Free Full Text]
  36. Li, S., Couet, J., and Lisanti, M. P. (1996) J. Biol. Chem. 271, 29182–29190[Abstract/Free Full Text]
  37. Couet, J., Sargiacomo, M., and Lisanti, M. P. (1997) J. Biol. Chem. 272, 30429–30438[Abstract/Free Full Text]
  38. Matveev, S. V., and Smart, E. J. (2002) Am. J. Physiol. 282, C935–C946
  39. Park, W. Y., Cho, K. A., Park, J. S., Kim, D. I., and Park, S. C. (2001) Ann. N. Y. Acad. Sci. 928, 79–84[Abstract/Free Full Text]
  40. Park, H., Go, Y. M., Darji, R., Choi, J. W., Lisanti, M. P., Maland, M. C., and Jo, H. (2000) Am. J. Physiol. 278, H1285–H1293
  41. de Weerd, W. F., and Leeb-Lundberg, L. M. (1997) J. Biol. Chem. 272, 17858–17866[Abstract/Free Full Text]
  42. Schwencke, C., Okumura, S., Yamamoto, M., Geng, Y. J., and Ishikawa, Y. (1999) J. Cell. Biochem. 75, 64–72[CrossRef][Medline] [Order article via Infotrieve]
  43. Schubert, W., Frank, P. G., Woodman, S. E., Hyogo, H., Cohen, D. E., Chow, C. W., and Lisanti, M. P. (2002) J. Biol. Chem. 277, 40091–40098[Abstract/Free Full Text]
  44. Schubert, W., Frank, P. G., Razani, B., Park, D. S., Chow, C. W., and Lisanti, M. P. (2001) J. Biol. Chem. 276, 48619–48622[Abstract/Free Full Text]

Add to CiteULike CiteULike