Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M402454200 on June 23, 2004

J. Biol. Chem., Vol. 279, Issue 34, 36158-36165, August 20, 2004
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
279/34/36158    most recent
M402454200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wu, X.
Right arrow Articles by Stafforini, D. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wu, X.
Right arrow Articles by Stafforini, D. M.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

The p38 MAPK Pathway Mediates Transcriptional Activation of the Plasma Platelet-activating Factor Acetylhydrolase Gene in Macrophages Stimulated with Lipopolysaccharide*

Xiaoqing Wu{ddagger}§, Guy A. Zimmerman¶, Stephen M. Prescott{ddagger}§, and Diana M. Stafforini{ddagger}||

From the {ddagger}Huntsman Cancer Institute and the Departments of §Oncological Sciences and Internal Medicine, University of Utah, Salt Lake City, Utah 84112

Received for publication, March 4, 2004 , and in revised form, June 22, 2004.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Administration of lipopolysaccharide (LPS) to experimental animals results in the up-regulation of expression of the plasma form of platelet-activating factor acetylhydrolase (PAF AH) in tissue macrophages. To investigate the mechanism underlying induction of PAF AH by LPS we used murine RAW264.7 and human THP-1 macrophages as model systems. We found that the p38 mitogen-activated protein kinase (p38 MAPK) pathway mediates transcriptional activation of the PAF AH gene through the participation of nucleotides -68/-316 relative to the transcriptional initiation site. This promoter region spans two Sp1/Sp3 binding sites (SP-A and SP-B) and is necessary and sufficient for the observed effect. Disruption of these Sp binding sites significantly reduces promoter activity in LPS-stimulated cells. The ability of LPS to induce transcriptional activation of PAF AH is not due to enhanced Sp1/Sp3 binding to the promoter but involves enhanced transactivation function of Sp1 via p38 MAPK activation. These studies characterize the mechanism by which LPS modulates expression of PAF AH at the transcriptional level, and they have important implications for our understanding of responses that occur during the development of LPS-mediated inflammatory diseases.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Platelet-activating factor (PAF,1 1-O-alkyl-2-acetyl-sn-glycero-3-phosphocholine) is a potent pro-inflammatory phospholipid synthesized upon exposure of monocytes/macrophages to lipopolysaccharide (LPS), one of the main components of the cell wall of Gram-negative bacteria (1). In addition to PAF, administration of LPS to animals and exposure of macrophages in culture to LPS also result in the accumulation of other mediators such as PGE2 and proinflammatory cytokines including IL-1, IL-6, IL-8, and tumor necrosis factor-{alpha} and -{beta} (2). Excess release of these molecules in vivo is thought to play a key role in the pathogenesis of several human syndromes including sepsis, a severe inflammatory disease that causes ~20,000 annual deaths in the United States (1–3). The observation that PAF and LPS have common physiological and pathological activities led to the finding that this phospholipid is one of the key downstream intermediates produced after exposure to LPS (4, 5). The down-regulation of signals elicited by PAF (and PAF-like lipids) is mediated by PAF acetylhydrolases (PAF AHs), calcium-independent phospholipases A2 with specificity for hydrolysis of these lipid mediators (6). The secreted or plasma form of PAF AH circulates in blood as a complex with lipoproteins (7). Its precise role in pathophysiological processes is controversial (8–14) but our work and that of others has shown that the enzyme has anti-inflammatory properties in vivo (15–20).

Results from studies in patients diagnosed with syndromes in which LPS is thought to participate as a mediator, such as the acute respiratory distress syndrome, sepsis, and septic shock have revealed alterations in the secreted form of PAF AH at the activity, protein, and mRNA levels. Endo et al. find that PAF AH activity levels correlate with markers of disease severity such as endotoxin, tumor necrosis factor-{alpha}, IL-8 (21) and thrombomodulin (22) during sepsis. Alveolar macrophages isolated from patients during the acute phase of acute respiratory distress syndrome have been reported to express higher PAF AH activity and mRNA levels compared with alveolar macrophages from patients at risk and healthy subjects (23). The combination of these observations suggests that LPS or the release of potent downstream mediators during sepsis, acute respiratory distress syndrome, and related syndromes results in macrophage activation followed by secretion of phospholipases and other key proteins (24). The increase in PAF AH levels may serve as a compensatory mechanism to down-regulate local and systemic activation mediated by PAF and PAF-like lipids through transcriptional activation of the PAF AH gene (25). A number of studies, however, reported decreased levels of PAF AH activity in plasma during severe sepsis (26, 27).2 Thus, seemingly opposing results have been obtained using relatively small patient populations, a number of different cells and body fluids, and various methodologies to detect PAF AH activity. Consequently, the role of PAF AH in sepsis and related human syndromes remains obscure.

In contrast to studies in humans, administration of LPS to experimental animals has consistently resulted in robust increases in the levels of PAF AH at the activity, protein, and mRNA levels during the first 24–48 h (29–32). The origin of PAF AH synthesized in response to LPS seems to be limited to cells of the macrophage lineage including tissue macrophages from hepatic (29–32) and most likely pulmonary and peritoneal origins. This is consistent with the observation by Asano et al. (33) that most of the circulating PAF AH originates in cells of the hematopoietic lineage.

The actions of LPS are mediated by TLR4, a member of the toll-like receptor (TLR) superfamily (34). LPS associates with LPS-binding protein (LBP) and is delivered to the cell surface receptor CD14. The LPS·LBP·CD14 complex interacts with TLR4 and activates the intracellular mitogen-activated protein kinase kinase kinases (MAPKKK(MKK)) (34), leading to stimulation of three distinct MAPKs including p38 MAPK, extracellular signal-regulated kinases (ERK1/2), and c-Jun NH2-terminal kinase (JNK) (35, 36). LPS is thought to activate ERK1/2 via the Ras/Raf-1/MAPK kinase-1 (MKK1 or MEK1) cascade (35). On the other hand, p38 MAPK and JNK are phosphorylated and activated by MKK3/6 and MKK4/7, respectively (37, 38). Active JNK and p38 MAPK participate in the LPS-mediated regulation of diverse pro-inflammatory genes by stimulating multiple transcription factors including the Ap1 complex (c-Jun and c-Fos), ATF-2, cAMP-response element-binding protein (CREB), and C/EBP (39).

To investigate the mechanisms that underlie PAF AH up-regulation by LPS, we developed a model system that recapitulates PAF AH responses to LPS similar to those observed in vivo. Second, we established that the ability of LPS to enhance PAF AH expression involves participation of the p38 MAPK signaling pathway combined with the presence of essential Sp1/Sp3 binding sites in the PAF AH promoter. Finally, we demonstrated that transactivation by Sp1 is the mechanism by which this transcription factor enhances PAF AH expression.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Cell Culture and Reagents—Murine RAW264.7 macrophages were purchased from American Type Culture Collection and were maintained in a 5% CO2 atmosphere at 37 °C in Dulbecco's modified Eagle's medium (Invitrogen) supplemented with 10% fetal bovine serum (Hy-Clone). Human THP-1 monocytes overexpressing surface CD14 (generously provided by Dr. Richard Ulevitch, Scripps Research Institute, San Diego, CA) were maintained at 37 °C in RPMI 1640 (Invitrogen) supplemented with 500 µg/ml Geneticin (Invitrogen). Lipoprotein-free LPS from Salmonella enteriditis (Sigma-Aldrich) was sterilized by {gamma}-irradiation and used at 1 µg/ml unless otherwise specified. The inhibitors SP600125 and PD98059 (Biomol), U0126, SB202190, and SB203580 (Alexis Biochemicals) were dissolved in Me2SO before addition to the culture medium. Cells were treated with LPS and/or inhibitors in the presence of fetal bovine serum. Polyclonal antibodies against PAF AH (N-20), Sp1 (PEP-2), Sp3 (D-20), ERK2 (C-14), and phospho-ERK1/2 (E-4) were obtained from Santa Cruz Biotechnology, Inc. The antibodies against JNK, phospho-JNK, p38, and phospho-p38 were from Cell Signaling, and the anti-actin antibody was from ICN.

RT-PCR—Total RNA was isolated from cultured cells using TRIzol reagent (Invitrogen) according to the manufacturer's instructions. We used 5 µg of total RNA in reverse transcription reactions performed using a commercially available cDNA synthesis kit (Invitrogen). Mouse PAF AH and {beta}-actin cDNAs were amplified as described previously (40). Human PAF AH, IL-6, IL-10, and GAPDH cDNAs were amplified using the following primer pairs and parameters: PAF AH, 5'-GAACACACTGGCTTATGGGCAAC (sense) and 5'-GAGTCTGAATAACCGTTGCTCCACC (antisense) (94 °C for 30 s, 58 °C for 60 s, 72 °C for 120 s; 30 cycles); IL-10, 5'-ATGCCCCAAGCTGAGAACCAAGACCCA (sense) and 5'-TCTCAAGGGGCTGGGTCAGCTATCCCA (antisense) (94 °C for 30 s, 65 °C for 30 s, 72 °C for 30 s; 29 cycles); IL-6, 5'-ATGAACTCCTTCTCCACAAG (sense) and 5'-ACATTTGCCGAAGAGCCCTCAG (anti-sense) (94 °C for 60 s, 58 °C for 60 s, 72 °C for 120 s; 25 cycles); GAPDH, 5'-ACCACAGTCCATGCCATCAC (sense) and 5'-TCCACCACCCTGTTGCTGTA (antisense) (94 °C for 30 s, 54 °C for 60 s, 72 °C for 60 s, 22 cycles). The PCR products were subjected to electrophoresis on 1.5% (w/v) agarose gels and visualized with ethidium bromide.

Plasmids—All mouse PAF AH promoter constructs (wild-type and mutant) have been described previously (40). To generate the human promoter construct (-2588/+102-Luc), a genomic region spanning nt -2588/+102 of the human PAF AH gene was amplified by PCR using two BglII-tagged primers (sense, 5'-CGTAAGATCTCCAGACTTCCTACTGCAATCAG; antisense, 5'-GACTTAGATCTTCTCGCCGACAGCACTG) and then cloned into the vector pGL3-Basic (Promega). Dr. Roger Davis (University of Massachusetts, Worcester, MA) generously provided expression vectors of dominant-negative JNK1 (APF; cloned in pcDNA3) and dominant-negative p38 MAPK (AGF; cloned in pCMV5). The dominant negative mutants of ERK1 (K71R) and ERK2 (K52R) cloned in the pCEP4 vector were kindly provided by Dr. Andrew Thorburn (Wake Forest University, Winston-Salem, NC). The Gal4DBD-Sp1, Gal4DBD-Sp1B, and Gal4DBD-TAT fusion gene plasmids were generous gifts from Dr. Stephen Smale (University of California, Los Angeles, CA). The Gal4DBD control plasmid (pFC2-dbd) and 5x Gal4-TATA-luciferase reporter plasmid (pFR-Luc) were purchased from Stratagene. All plasmids were purified using the endotoxin-free plasmid preparation kit (Qiagen).

Transient Transfection and Promoter Activity Assays—We seeded 1 million cells in 35-mm wells, and 18 h later we transfected 2 µg of promoter reporter constructs for 4 h using LipofectAMINE-PLUS (Promega). After transfection, we washed the cells with 1x phosphate-buffered saline supplemented with fresh medium for 6 h, added 1 µg/ml LPS, and continued the incubations for 24 additional hours. The cells were lysed using 200 µl per well of Reporter lysis buffer (Promega), the total protein content was determined (Pierce), and the luciferase activity (luciferase assay system, Promega) was assayed in the supernatants. For co-transfection assays, both the promoter and the protein expression constructs (1 µg each) were transfected, as above.

Western Blot Analyses—After stimulation, cells were washed twice with phosphate-buffered saline and lysed in 1x lysis buffer (20 mM Tris, pH 7.5, 150 mM NaCl, 1 mM Na2EDTA, 1 mM EGTA, 1% Triton X-100, 2.5 mM sodium pyrophosphate, 1 mM {beta}-glycerophosphate, 1 mM Na3VO4, and 1 µg/ml leupeptin). After sonication, the cell lysates were clarified by centrifugation at 16,000 x g for 15 min at 4 °C. We subjected 30 µg of protein to electrophoresis on a 10% SDS-PAGE gel and then transferred the proteins to a polyvinylidene fluoride membrane (PerkinElmer Life Sciences). The membrane was then blocked in 1x TBST buffer (50 mM Tris-HCl, pH 7.5, 250 mM NaCl, 0.1% Tween 20) containing 5% nonfat dry milk and then probed with the primary antibody indicated in each case at 4 °C overnight. After three washes in 1x TBST, the membrane was exposed to a horseradish peroxidase-conjugated secondary antibody (BIOSOURCE) for 1 h at room temperature. Immunoreactive bands were visualized using chemiluminescence detection reagents (PerkinElmer Life Sciences).

Kinase Activity Assays—The cellular activities of p38 MAPK and JNK were measured using p38 MAPK and JNK assay kits from Cell Signaling following the instructions suggested by the manufacturer.

Electrophoretic Mobility Shift Assay (EMSA)—Nuclear protein extraction and EMSA assays were performed as described previously (40).


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
LPS Induces Plasma PAF AH Expression in Cultured Macrophage Cell Lines—Previous reports in which LPS was tested for its ability to alter PAF AH expression in cell culture failed to reproduce the characteristic increase in activity shown using in vivo approaches (29–32). These studies employed terminally differentiated macrophages and reported decreased PAF AH activity (41, 42) or mRNA (29) levels upon exposure to LPS. To examine if the in vivo responses to LPS were recapitulated using cells at an earlier stage of differentiation, we used the murine peritoneal monocyte/macrophage cell line RAW264.7 and a human monocytic cell line overexpressing CD14 (THP-1/CD14). Resting RAW264.7 and THP-1/CD-14 cells expressed extremely low levels of PAF AH mRNA (Fig. 1, A and B) and protein (Fig. 1C), thus resembling the characteristic phenotype of primary human monocytes (43). Stimulation with LPS at low concentrations (1–10 ng/ml) consistently increased PAF AH mRNA levels; maximal expression was observed at 1 µg/ml LPS (Fig. 1, A and B). In a time-course analysis, PAF AH mRNA levels were increased 3 h after the addition of 1 µg/ml LPS and were sustained up to 12 h after stimulation (Fig. 1, A and B). These changes were followed by robust increases in PAF AH protein that remained elevated for at least 24 h (Fig. 1C).



View larger version (39K):
[in this window]
[in a new window]
  		FIG. 1.
Characterization of LPS-mediated increases in PAF AH expression in macrophage cell lines. A, RAW264.7 cells were stimulated with LPS at the indicated concentrations for 6 h or at 1 µg/ml for 1–24 h. PAF AH and {beta}-actin mRNA expressions were determined by semi-quantitative RT-PCR. B, THP-1/CD14 cells were stimulated with LPS at the indicated concentrations for 6 h or at 1 µg/ml for 3–48 h. PAF AH and GAPDH mRNA levels were determined by RT-PCR. C, RAW264.7 and THP-1/CD14 cells were treated with LPS for the indicated times. PAF AH and actin levels then were assessed by Western analyses.

 
The p38 MAPK Pathway Mediates LPS Induction of PAF AH mRNA in Macrophages—Previous studies have shown that LPS activates multiple pathways including those involving MAPK participation (36). Our next goal was to elucidate the signaling pathway(s) that participates in LPS-mediated up-regulation of PAF AH expression. We initially examined the effect of various MAPK inhibitors on the ability of LPS to up-regulate PAF AH expression in RAW264.7 cells. We found (Fig. 2A) that the p38 MAPK inhibitors SB203580 (10 µM) and SB202190 (15 µM) completely prevented LPS-mediated up-regulation of PAF AH mRNA in RAW264.7 cells. The inhibitor SB203580 attenuated the phosphorylation of ATF-2, a reaction catalyzed by p38 MAPK (Fig. 2B) and had no effect on ERK and JNK activation, as expected (Fig. 2B). In contrast, the MEK1/2 inhibitor U0126 and the JNK inhibitor SP600125 had no effect on the up-regulation of PAF AH mediated by LPS but were effective inhibitors of ERK and JNK activation, respectively (Fig. 2B). We also observed (Fig. 2C) a robust increase in PAF AH mRNA levels after LPS stimulation of human THP-1/CD14 cells. The stimulation of human PAF AH mRNA production was almost completely inhibited by p38 MAPK inhibitors (Fig. 2D), which were also effective inhibitors of LPS-mediated up-regulation of IL-10 mRNA levels, as expected (44). In contrast, the ability of LPS to mediate up-regulation of PAF AH mRNA levels was completely independent of MEK1/2 activation because supplementation of U0126 was without effect (Fig. 2, A and C). The effectiveness of U0126 as a MEK1/2 inhibitor was demonstrated by its ability to inhibit the increase in IL-6 mRNA levels in response to LPS, a process that requires active MEK1/2 (Fig. 2C). These results demonstrate the participation of p38 MAPK, but not ERK or JNK, as one of the key intermediates in the ability of LPS to induce expression of PAF AH mRNA in cells of the monocytic lineage.



View larger version (58K):
[in this window]
[in a new window]
  		FIG. 2.
The p38 MAPK pathway mediates LPS induction of PAF AH mRNA in macrophages. A, RAW264.7 cells were pretreated with U0126 (20 µM), SP600125 (20 µM), SB203580 (10 µM), SB202190 (15 µM), or Me2SO (DMSO) for 30 min. LPS was added, and the incubations were continued for 6 h. PAF AH and {beta}-actin mRNA levels were determined by RT-PCR as described in Fig. 3A. B, RAW264.7 cells were pretreated for 30 min with the indicated inhibitors as in A followed by LPS treatment. Western analyses were performed using 50 µg of total protein to detect phospho-ERK1/2, ERK2, JNK1, and p38 MAPK. JNK and p38 MAPK activity assays were performed using c-Jun and ATF-2 as substrates, respectively. C, THP-1/CD14 monocytic cells were incubated with LPS alone or in the presence of U0126 (10 and 25 µM) for 6 h. PAF AH, IL-6, and GAPDH mRNA levels were determined by RT-PCR, as described under "Experimental Procedures." D, THP-1/CD14 cells were treated with LPS alone or in the presence of SB202190 (15 µM) and SB203580 (10 µM). After 6 h we determined mRNA levels of PAF AH, IL-10, and GAPDH by RT-PCR.

 
The Proximal Region of the PAF AH Promoter Participates in LPS-mediated Increases in PAF AH mRNA Levels; Role of p38 MAPK—The effect of LPS on PAF AH mRNA levels could be due to increased mRNA synthesis, increased stability, or both. We first investigated what regions of the PAF AH promoter are necessary for the observed effects. We transfected RAW264.7 cells with various mouse and human PAF AH promoter constructs fused to a luciferase reporter and then stimulated the cells with LPS for 24 h. We found (Fig. 3A) that LPS treatment increased the activity of the transfected human and mouse promoter constructs by 4–5-fold. In contrast, the promoter activity of the backbone vector (pGL3-Basic) was only moderately increased by LPS (1.8-fold, data not shown). These data suggest that one of the mechanisms by which LPS up-regulates expression of PAF AH includes transcriptional activation.



View larger version (37K):
[in this window]
[in a new window]
  		FIG. 3.
LPS stimulates PAF AH promoter activity via p38 MAPK signaling. A, RAW264.7 macrophages were transfected with either a mouse (-1806-M) or a human (-2588-H) PAF AH promoter construct fused to a luciferase reporter. Promoter activity was then assessed by determining expression of luciferase activity. B, RAW264.7 cells were co-transfected with either the empty vector (pcDNA3) or the indicated expression vectors and 1 µg of the murine plasma PAF AH promoter construct (-1806-M). The expression vectors used encoded dominant-negative forms of ERK1 (dnERK1), ERK2 (dnERK2), JNK1 (dnJNK1), and p38 MAPK{alpha} (dnp38{alpha}). After transfection, cells were either left untreated or stimulated with LPS for 24 h. The luciferase activity of each sample was normalized for protein content, and the normalized luciferase activities with and without LPS treatment were graphed. Results reported consist of the mean ± S.D. of three independent experiments. C, RAW264.7 cells were transfected with a series of murine plasma PAF AH promoter constructs and then stimulated with LPS. The luciferase activity of each transfectant was normalized for protein content. D, transfections were performed in a manner similar to that described for Fig. 3B except that a shorter promoter construct (-316/+86) was used. Results reported consist of the mean ± S.D. of three separate transfections.

 
We next investigated whether the participation of p38 MAPK in LPS-mediated effects occurred at the promoter level using dominant-negative constructs of various MAPKs. We co-transfected RAW264.7 macrophages with the mouse PAF AH promoter construct that spans nt -1806/+86 and an expression plasmid encoding either dominant-negative ERK1 (dnERK1), ERK2 (dnERK2), JNK1 (dnJNK1), or p38 MAPK{alpha} (dnp38{alpha}). We found (Fig. 3B) that promoter activation mediated by LPS was completely abolished by overexpression of dnp38{alpha}; in contrast, expression of dnERK1, dnERK2, or dnJNK1 had no effect. These results demonstrate that LPS-induced PAF AH expression requires participation of the p38 MAPK pathway at the transcriptional level.

To precisely map the promoter regions necessary for LPS-mediated effects, we transfected RAW264.7 cells with a series of previously characterized mouse promoter constructs fused to a luciferase reporter (40). All the promoter constructs exhibited 4–5-fold LPS-dependent increases in promoter activity except a very short construct, which spanned nt -68/+86 (2.2-fold activation, Fig. 3C). The minimal sequence necessary for maximal LPS-dependent promoter activation included 316 nt up-stream of the transcriptional initiation site of the mouse gene. This 316-nt sequence contained elements targeted by the p38 MAPK pathway as co-expression of dnp38{alpha}, but not dnERK1, dnERK2, or dnJNK1, inhibited LPS-mediated promoter activation (Fig. 3D). Thus, LPS elicits signals from the p38 MAPK pathway that target the proximal mouse PAF AH promoter region between nt -68 and -316.

Sp1/Sp3 Binding Sites Participate in the Transcriptional Activation of PAF AH by LPS—We recently demonstrated that nt -68/-316 in the mouse PAF AH promoter contain three functional Sp1/Sp3 binding sites (SP-A, -B, and -C) and that SP-A and SP-B are essential for the constitutive expression of murine PAF AH in macrophages (40). We next tested the hypothesis that these Sp1/Sp3 sites also participate in LPS-mediated transcriptional effects. We systematically mutated SP-A, SP-B, SP-C, and combinations therein and then asked if the promoter activity of the mutant constructs was altered by LPS. We found (Fig. 4) that disruption of SP-A or SP-B, but not SP-C, significantly reduced promoter activation mediated by LPS. Mutation of both SP-A and SP-B completely abolished LPS-induced promoter activation in RAW264.7 macrophages, thus demonstrating that these sites are essential for the ability of LPS to activate the murine PAF AH gene. We next conducted similar experiments within the context of the human PAF AH promoter. We previously showed that constitutive expression of the human PAF AH gene is largely dependent on the presence of one Sp1/Sp3 binding site homologous to murine SP-B (40). We found (Fig. 4) that mutation of this Sp1/Sp3 site completely blocked LPS-induced stimulation of the minimal human PAF AH promoter.



View larger version (20K):
[in this window]
[in a new window]
  		FIG. 4.
Mutation of Sp1/Sp3 binding sites in the PAF AH promoter prevents activation by LPS. RAW264.7 cells were transfected with either a wild-type mouse PAF AH promoter construct (-316-Wt) or a wild-type human construct (-139H-Wt) or derivatives that harbored point mutations (-316-MuA, -316-MuB, -316-MuC, -139H-MuB), double mutations (-316-MuAB), or triple mutations (-316-MuABC) within the Sp1/Sp3 binding sites. Cells were left unstimulated or were stimulated with LPS for 24 h. The luciferase activity was normalized as described before. The upper and lower axes correspond to luciferase activity in the mouse and human constructs, respectively. Results represent the mean ± S.D. of three separate transfections.

 
LPS Stimulation Enhances the Transactivation Function of Sp1, but Not Its DNA Binding Activity, in a p38 MAPK-dependent Manner—To further investigate the mechanism of LPS-mediated increases in PAF AH mRNA levels, we tested the hypothesis that enhanced binding of Sp1/Sp3 to SP-A and SP-B takes place after LPS stimulation. We performed EMSA using oligonucleotides spanning SP-A and SP-B combined with nuclear extracts from RAW264.7 or THP-1/CD14 cells treated with LPS for various time periods. We found no changes in the extent of DNA-protein complex formation (Fig. 5, A and B) or the amount of nuclear Sp1 levels (not shown) after LPS treatment. In contrast, LPS stimulation resulted in significant increases in NF-{kappa}B and C/EBP binding activities (Fig. 5, A and B, compare lane 1 with lanes 6 and 7), suggesting adequate activation efficiency. Our results demonstrate that the ability of LPS to enhance PAF AH mRNA levels does not occur because of increased DNA binding activity of Sp1 and Sp3.



View larger version (48K):
[in this window]
[in a new window]
  		FIG. 5.
LPS increases the transcriptional, but not the binding, activity of Sp1. A, EMSA using 32P-labeled probes containing either site SP-A (5'-CCATCATCACCCTCCCCGCCCCCCAGGCACAGTCAG), SP-B (AGGAGGCTGGGCCACACGCTCCTCCCCTGTCCCTCTT), consensus NF-{kappa}B(5'-AGTTGAGGGGACTTTCCCAGGC), or consensus C/EBP (5'-CGGTTCTTGCGCAACTCACT) oligonucleotides and nuclear extracts from RAW264.7 cells treated with LPS for 15 min to 6 h. B, EMSA using 32P-labeled probes containing the human SP-B site (hSP-B, 5'-CACACACGCTCCTCCCCGGTACCTC) or the consensus NF-{kappa}B probe and nuclear extracts from THP-1/CD14 cells treated with LPS for 15 min to 4 h. C, RAW264.7 cells were co-transfected with 1 µg of a reporter plasmid (5XGal4-TATA-Luc), 1 µg of an empty vector (pcDNA3), and 50 ng of an expression plasmid encoding the Gal4 Gal4DBD or Gal4DBD fused to the transactivation domains of TAT (Gal4DBD-TAT), Elk1 (Gal4DBD-Elk1), or Sp1B (Gal4DBD-Sp1B) or to full-length Sp1 (Gal4DBD-Sp1). We then treated the cells with LPS for 18 h and determined luciferase activity. D, RAW264.7 cells transfected with Gal4DBD-Sp1B were pretreated with Me2SO, PD98059 (10 µM), SP600125 (20 µM), or SB202190 (15 µM) for 1 h before LPS stimulation (18 h). The luciferase activity of each sample was determined as described previously. The results represent the mean ± S.D. of three separate experiments.

 
We next considered additional mechanisms to account for the participation of Sp1/Sp3 in LPS-mediated up-regulation of PAF AH mRNA levels. We co-transfected RAW264.7 cells with a Gal4-luciferase reporter plasmid and plasmids expressing either the Gal4 DNA binding domain (Gal4DBD) or Gal4DBD fused to the transactivation domains of TAT, Elk1, Sp1 (Sp1B), or the entire Sp1 protein. We found that the transactivation domain of Elk1, a known target of Ras/MEK signaling, enhanced transcriptional activity in response to LPS, as expected (Fig. 5C). In contrast, transfection with Gal4DBD or Gal4DBD-TAT fusion protein showed undetectable transcriptional activity (Fig. 5C). The transactivation domain of Sp1 (Sp1B) conferred responsiveness to LPS to the same extent as full-length Sp1, in agreement with previous findings (45). These data demonstrate that Sp1 can mediate transcriptional induction by LPS without an increase in its DNA binding activity.

To investigate what intracellular signaling pathways were involved in this process, we treated RAW264.7 cells transfected with Gal4DBD-Sp1B with inhibitors targeting the MEK, JNK, and p38 MAPK pathways. After transfection, we supplemented LPS along with inhibitors or vehicle (Me2SO) for 18 additional hours and then determined luciferase activity to assess the activation status of the signaling events. LPS-mediated induction of luciferase expression was considerably reduced by the p38 MAPK inhibitor SB202190 (Fig. 5D) and by dnp38{alpha} (not shown). In contrast, inhibition of the ERK- and JNK-signaling pathways using specific inhibitors (Fig. 5D) or dominant negative approaches (not shown) failed to inhibit luciferase expression. Interestingly, SP600125 further increased promoter activation induced by LPS, suggesting an inhibitory role for the JNK signaling in p38 MAPK-mediated Sp1 activation. These results indicate that p38 MAPK plays a key role in LPS responses mediated by the transactivating domain of Sp1. In contrast, the remaining MAPK pathways activated by LPS (ERK and JNK) do not participate in the regulation of PAF AH expression by LPS.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
LPS has been demonstrated to act as a potent inducer of PAF AH expression in animals (29–32), but some studies show that this agent down-regulates expression of either PAF AH activity or mRNA levels in cultured decidual macrophages (41), RAW264.7 cells (25), liver Kupffer cells (29), and TPA-differentiated HL-60 cells (41). These seemingly contradictory results can be explained by careful examination of the experimental conditions used in each case, the state of cellular differentiation or activation, and the type and timing of the measurements. First, in our previous studies using RAW264.7 cells we found that LPS decreased the promoter activity of a human PAF AH promoter construct that spanned nt -3416/+206 (25). This large construct included additional sequences that may have silenced LPS-mediated events involving proximal sites. Second, studies using terminally differentiated macrophages and/or activated macrophages may have limited value in the assessment of mechanisms aimed at characterizing the effect of cytokines and other effectors of cellular function on PAF AH expression. The significant heterogeneity observed in macrophage populations both in the resting sate and when activated by inflammatory stimuli is likely to play important roles in this process (46–48). For example, the kinetics and magnitude of PAF AH expression are different in primary macrophage populations that differ in CD14 and CD16 expression levels.3 Moreover, differentiation of monocytes into dendritic cells results in significantly lower levels of intracellular and secreted PAF AH activity compared with macrophages (49). A key contribution of the present study is the utilization of a murine model system that mimics in vivo responses in cells that are not terminally differentiated and, thus, potentially recapitulates events that occur when monocytic cells are recruited and induced to differentiate in inflamed tissues in vivo. The RAW264.7 and THP-1/CD14 macrophages used here express extremely low levels of PAF AH in the basal state. LPS robustly up-regulated expression of PAF AH mRNA, and this effect was maximal 12 h after stimulation. However, PAF AH expression subsequently decreased at later time points in RAW264.7 cells, as in previous studies (>24 h, Fig. 1A), suggesting that the ability of LPS to regulate PAF AH expression is dependent on the state of cellular maturation and activation.

The work presented here also shows that the p38 MAPK pathway participates in LPS-mediated modulation of PAF AH expression. First, inhibitors of the p38 MAPK pathway prevented up-regulation of PAF AH by LPS (Fig. 2). Second, overexpression of dominant-negative p38 MAPK attenuated the transcriptional activation of PAF AH (Fig. 3B). The p38 MAPK pathway plays key roles in the expression of genes involved in stress-induced responses, such as tumor necrosis factor-{alpha}, IL-1{beta}, inducible nitric-oxide synthase, and cyclooxygenase-2 (50, 51). In addition, this pathway mediates increases in the expression of IL-10, a cytokine that inhibits inflammatory and cell-mediated immune responses (44). Thus, the role of the p38 MAPK kinase signaling pathway is complex because it controls expression of factors that both amplify and modulate responses to stress, injury, and inflammatory stimuli.

We recently demonstrated that non-canonical Sp1/Sp3 binding sites in the human and mouse PAF AH promoters are essential for the constitutive expression of PAF AH in macrophages (40). The present study established that these Sp1/Sp3 binding motifs (SP-A and SP-B) are also critical for increased PAF AH expression in response to LPS (Fig. 4). Both studies showed that SP-A and SP-B are essential for the constitutive activity of the mouse PAF AH promoter because combined disruption of these sites reduced promoter activity by 70–80%. However, mutation of sites SP-A, SP-B, and SP-C in combination resulted in promoter activity levels significantly lower compared with the wild-type construct but appreciably higher than those of the double mutation (SP-A and SP-B, Fig. 4 and Ref. 40). We also consistently observed that mutation of SP-C alone weakly increases promoter activity, suggesting that SP-C may contain negative regulatory elements.

We next performed experiments aimed at characterizing the mechanism by which Sp1 participates in LPS-induced transcriptional activation of the PAF AH gene. The level of Sp1 activity is modulated by post-translational modifications, alterations of Sp1 protein abundance, or both (52). The possibility that changes in the total amount of Sp1 accounted for increased PAF AH expression in response to LPS was ruled out when we found no significant change in the levels of Sp1 and Sp3 expressed by both RAW and THP-1 cells throughout the entire period of LPS treatment (data not shown). Likewise, we found no changes in the ability of either the SP-A or SP-B sites to bind nuclear proteins present in LPS-treated extracts (Fig. 5, A and B). Brightbill et al. (45) also report no changes in the binding of oligonucleotides containing Sp1 sites present in the murine IL-10 promoter after treatment with LPS. Interestingly, the TC-rich sequence found in site SP-B of the murine and human PAF AH promoters is highly homologous to a TC-rich motif in the murine IL-10 promoter that is required for constitutive and LPS-induced IL-10 expression in RAW264.7 cells (45). Bethea et al. (53) report similar findings in studies that utilized probes spanning Sp1 binding sites present in the tumor necrosis factor receptor II (TNFR-II) promoter. In contrast, Jarvis and Qureshi (54) and Ma et al. (44) observe robust increases in Sp1 binding activity after treatment of RAW264.7 and human THP-1/CD14 cells with LPS, respectively. These investigators utilized consensus Sp1 probes whose sequences differ from those present in the CD14 and IL-10 promoters they were studying, respectively. Marco et al. (55) presented the notion that a "recognition code" exists that correlates specific residues in the recognition helix of Sp1 with particular bases in the DNA site. Although the code is known to tolerate some level of degeneracy, small alterations in the sequences within both the core motif and the flanking regions result in altered affinities. These observations may account at least in part for the observed variability in Sp1 binding to various promoter sequences in response to LPS.

We investigated another potential mechanism by which Sp1 could mediate LPS-induced effects on PAF AH expression. Sp1 has been reported to induce gene expression in response to TGF-{beta} (56) or LPS (45) through increases in the function of a domain known as the B transactivation domain. Our studies confirmed that LPS activates the transactivating domain of Sp1. In addition, we demonstrated that p38 MAPK is necessary for this activation to occur. The mechanism that mediates this effect is not known, but it may involve phosphorylation of serine and/or threonine residues in the Sp1 "B" domain resulting in enhanced transactivation (28). Thus, our results are consistent with the hypothesis that the ability of LPS to enhance PAF AH expression involves phosphorylation (and activation) of the transactivating domain of Sp1 through the p38 MAPK pathway.

In summary, our data demonstrate that LPS is a key effector of PAF AH expression in surrogate monocytic cell models and that LPS induction of PAF AH is mediated through a p38 MAPK-dependent signaling pathway. PAF AH regulation by LPS occurs at the transcriptional level and requires specific Sp1/Sp3 binding sites within the proximal promoter region. The most likely mechanism involves enhanced transactivation mediated by Sp1. This study has furthered our understanding of the molecular mechanisms that participate in the induction of this enzyme during endotoxic challenge.


   FOOTNOTES
 
* This work was supported in part by National Institutes of Health Grant HL35828 (to D. M. S.) and Special Center of Research in Acute Respiratory Distress Syndrome Grant HL50153. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

|| To whom correspondence should be addressed: Huntsman Cancer Institute, 2000 Circle of Hope, Suite 5362, University of Utah, Salt Lake City, UT 84112-5550. Tel.: 801-585-3402; Fax: 801-585-6345; E-mail: diana.stafforini{at}hci.utah.edu.

1 The abbreviations used are: PAF, platelet-activating factor; PAF AH, PAF acetylhydrolase; LPS, lipopolysaccharide; Sp, specificity protein; EMSA, electrophoretic mobility shift assay; nt, nucleotide(s); MAPK, mitogen-activated protein kinase; ERK, extracellular signal-regulated kinase; JNK, c-Jun NH2-terminal kinase; NF, nuclear factor; C/EBP, CCAAT/enhancer-binding protein; Elk, Ets-like protein 1; DBD, DNA binding domain; TAT, transactivator of transcription from human immunodeficiency virus; RT, reverse transcription; IL, interleukin; dn, dominant negative; MEK, mitogen-activated protein kinase/extracellular signal-regulated kinase kinase. Back

2 R. Novaes Gomes, F. A. Bozza, R. Amancio, A. Japiassu, R. Vianna, A. P. Larangeira, M. S. Bastos, G. A. Zimmerman, D. M. Stafforini, S. M. Prescott, P. T. Bozza, and H. C. Castro-Faria-Neto, submitted for publication. Back

3 D. M. Stafforini and G. A. Zimmerman, unpublished observations. Back


   ACKNOWLEDGMENTS
 
We thank Dr. Robert Schackmann at the DNA/peptide Core Facility of the University of Utah for the synthesis of oligonucleotides used in RT-PCR and EMSA. We are grateful to the many investigators from other institutions for providing a variety of expression plasmids utilized during the execution of this work. We thank Diana Lim for figure preparation.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Rietschel, E. T., Brade, H., Holst, O., Brade, L., Muller-Loennies, S., Mamat, U., Zahringer, U., Beckmann, F., Seydel, U., Brandenburg, K., Ulmer, A. J., Mattern, T., Heine, H., Schletter, J., Loppnow, H., Schonbeck, U., Flad, H. D., Hauschildt, S., Schade, U. F., Di Padova, F., Kusumoto, S., and Schumann, R. R. (1996) Curr. Top. Microbiol. Immunol. 216, 39-81[Medline] [Order article via Infotrieve]
  2. Ulevitch, R. J., and Tobias, P. S. (1995) Annu. Rev. Immunol. 13, 437-457[CrossRef][Medline] [Order article via Infotrieve]
  3. Pinner, R. W., Teutsch, S. M., Simonsen, L., Klug, L. A., Graber, J. M., Clarke, M. J., and Berkelman, R. L. (1996) J. Am. Med. Assoc. 275, 189-193[Abstract/Free Full Text]
  4. Bulger, E. M., Arbabi, S., Garcia, I., and Maier, R. V. (2002) Shock 17, 173-179[CrossRef][Medline] [Order article via Infotrieve]
  5. Lo, C. J., Cryer, H. G., Fu, M., and Kim, B. (1997) Arch. Surg. 132, 1342-1347[Abstract/Free Full Text]
  6. Stafforini, D. M., McIntyre, T. M., Zimmerman, G. A., and Prescott, S. M. (1997) J. Biol. Chem. 272, 17895-17898[Free Full Text]
  7. Stafforini, D. M., Tjoelker, L. W., McCormick, S. P., Vaitkus, D., McIntyre, T. M., Gray, P. W., Young, S. G., and Prescott, S. M. (1999) J. Biol. Chem. 274, 7018-7024[Abstract/Free Full Text]
  8. Tew, D. G., Southan, C., Rice, S. Q., Lawrence, M. P., Li, H., Boyd, H. F., Moores, K., Gloger, I. S., and Macphee, C. H. (1996) Arterioscler. Thromb. Vasc. Biol. 16, 591-599[Abstract/Free Full Text]
  9. Hakkinen, T., Luoma, J. S., Hiltunen, M. O., Macphee, C. H., Milliner, K. J., Patel, L., Rice, S. Q., Tew, D. G., Karkola, K., and Yla-Herttuala, S. (1999) Arterioscler. Thromb. Vasc. Biol. 19, 2909-2917[Abstract/Free Full Text]
  10. MacPhee, C. H., Moores, K. E., Boyd, H. F., Dhanak, D., Ife, R. J., Leach, C. A., Leake, D. S., Milliner, K. J., Patterson, R. A., Suckling, K. E., Tew, D. G., and Hickey, D. M. (1999) Biochem. J. 338, 479-487[CrossRef][Medline] [Order article via Infotrieve]
  11. Packard, C. J., O'Reilly, D. S., Caslake, M. J., McMahon, A. D., Ford, I., Cooney, J., Macphee, C. H., Suckling, K. E., Krishna, M., Wilkinson, F. E., Rumley, A., and Lowe, G. D. (2000) N. Engl. J. Med. 343, 1148-1155[Abstract/Free Full Text]
  12. Caslake, M. J., Packard, C. J., Suckling, K. E., Holmes, S. D., Chamberlain, P., and Macphee, C. H. (2000) Atherosclerosis 150, 413-419[CrossRef][Medline] [Order article via Infotrieve]
  13. Carpenter, K. L., Dennis, I. F., Challis, I. R., Osborn, D. P., Macphee, C. H., Leake, D. S., Arends, M. J., and Mitchinson, M. J. (2001) FEBS Lett. 505, 357-363[CrossRef][Medline] [Order article via Infotrieve]
  14. Leach, C. A., Hickey, D. M., Ife, R. J., Macphee, C. H., Smith, S. A., and Tew, D. G. (2001) Farmaco 56, 45-50[CrossRef][Medline] [Order article via Infotrieve]
  15. Tjoelker, L. W., Wilder, C., Eberhardt, C., Stafforini, D. M., Dietsch, G., Schimpf, B., Hooper, S., Le Trong, H., Cousens, L. S., Zimmerman, G. A., Yamada, Y., McIntyre, T. M., Prescott, S. M., and Gray, P. W. (1995) Nature 374, 549-553[CrossRef][Medline] [Order article via Infotrieve]
  16. Theilmeier, G., De Geest, B., Van Veldhoven, P. P., Stengel, D., Michiels, C., Lox, M., Landeloos, M., Chapman, M. J., Ninio, E., Collen, D., Himpens, B., and Holvoet, P. (2000) FASEB J. 14, 2032-2039[Abstract/Free Full Text]
  17. Quarck, R., De Geest, B., Stengel, D., Mertens, A., Lox, M., Theilmeier, G., Michiels, C., Raes, M., Bult, H., Collen, D., Van Veldhoven, P., Ninio, E., and Holvoet, P. (2001) Circulation 103, 2495-2500[Abstract/Free Full Text]
  18. Morgan, E. N., Boyle, E. M., Jr., Yun, W., Kovacich, J. C., Canty, T. G., Jr., Chi, E., Pohlman, T. H., and Verrier, E. D. (1999) Circulation 100, 365-368
  19. Noto, H., Hara, M., Karasawa, K., Iso, O. N., Satoh, H., Togo, M., Hashimoto, Y., Yamada, Y., Kosaka, T., Kawamura, M., Kimura, S., and Tsukamoto, K. (2003) Arterioscler. Thromb. Vasc. Biol. 23, 829-835[Abstract/Free Full Text]
  20. Hase, M., Tanaka, M., Yokota, M., and Yamada, Y. (2002) Prostaglandins Other Lipid Mediat. 70, 107-118[CrossRef][Medline] [Order article via Infotrieve]
  21. Endo, S., Inada, K., Yamashita, H., Takakuwa, T., Nakae, H., Kasai, T., Kikuchi, M., Ogawa, M., Uchida, K., and Yoshida, M. (1994) Res. Commun. Chem. Pathol. Pharmacol. 83, 289-295[Medline] [Order article via Infotrieve]
  22. Takakuwa, T., Endo, S., Nakae, H., Suzuki, T., Inada, K., Yoshida, M., Ogawa, M., and Uchida, K. (1994) Res. Commun. Chem. Pathol. Pharmacol. 84, 271-281[Medline] [Order article via Infotrieve]
  23. Grissom, C. K., Orme, J. F. J., Richer, L. D., McIntyre, T. M., Zimmerman, G. A., and Elstad, M. R. (2003) Crit. Care Med. 31, 770-775[CrossRef][Medline] [Order article via Infotrieve]
  24. Kim, D. K., Fukuda, T., Thompson, B. T., Cockrill, B., Hales, C., and Bonventre, J. V. (1995) Am. J. Physiol. 269, L109-L118[Medline] [Order article via Infotrieve]
  25. Cao, Y., Stafforini, D. M., Zimmerman, G. A., McIntyre, T. M., and Prescott, S. M. (1998) J. Biol. Chem. 273, 4012-4020[Abstract/Free Full Text]
  26. Trimoreau, F., Francois, B., Desachy, A., Besse, A., Vignon, P., and Denizot, Y. (2000) Mediators Inflamm. 9, 197-200[CrossRef][Medline] [Order article via Infotrieve]
  27. Graham, R. M., Stephens, C. J., Silvester, W., Leong, L. L., Sturm, M. J., and Taylor, R. R. (1994) Crit. Care Med. 22, 204-212[Medline] [Order article via Infotrieve]
  28. Courey, A. J., and Tjian, R. (1988) Cell 55, 887-898[CrossRef][Medline] [Order article via Infotrieve]
  29. Howard, K. M., Miller, J. E., Miwa, M., and Olson, M. S. (1997) J. Biol. Chem. 272, 27543-27548[Abstract/Free Full Text]
  30. Howard, K. M., and Olson, M. S. (2000) J. Biol. Chem. 275, 19891-19896[Abstract/Free Full Text]
  31. Memon, R. A., Fuller, J., Moser, A. H., Feingold, K. R., and Grunfeld, C. (1999) Am. J. Physiol. 277, R94-R103[Medline] [Order article via Infotrieve]
  32. Svetlov, S. I., Sturm, E., Olson, M. S., and Crawford, J. M. (1999) Hepatology 30, 128-136[CrossRef][Medline] [Order article via Infotrieve]
  33. Asano, K., Okamoto, S., Fukunaga, K., Shiomi, T., Mori, T., Iwata, M., Ikeda, Y., and Yamaguchi, K. (1999) Biochem. Biophys. Res. Commun. 261, 511-514[CrossRef][Medline] [Order article via Infotrieve]
  34. Akira, S., Takeda, K., and Kaisho, T. (2001) Nat. Immunol. 2, 675-680[CrossRef][Medline] [Order article via Infotrieve]
  35. Guha, M., O'Connell, M. A., Pawlinski, R., Hollis, A., McGovern, P., Yan, S. F., Stern, D., and Mackman, N. (2001) Blood 98, 1429-1439[Abstract/Free Full Text]
  36. Sweet, M. J., and Hume, D. A. (1996) J. Leukocyte Biol. 60, 8-26[Abstract]
  37. Moriguchi, T., Kuroyanagi, N., Yamaguchi, K., Gotoh, Y., Irie, K., Kano, T., Shirakabe, K., Muro, Y., Shibuya, H., Matsumoto, K., Nishida, E., and Hagiwara, M. (1996) J. Biol. Chem. 271, 13675-13679[Abstract/Free Full Text]
  38. Shirakabe, K., Yamaguchi, K., Shibuya, H., Irie, K., Matsuda, S., Moriguchi, T., Gotoh, Y., Matsumoto, K., and Nishida, E. (1997) J. Biol. Chem. 272, 8141-8144[Abstract/Free Full Text]
  39. Treisman, R. (1996) Curr. Opin. Cell Biol. 8, 205-215[CrossRef][Medline] [Order article via Infotrieve]
  40. Wu, X., McIntyre, T. M., Zimmerman, G. A., Prescott, S. M., and Stafforini, D. M. (2003) Biochem. J. 375, 351-363[CrossRef][Medline] [Order article via Infotrieve]
  41. Narahara, H., Frenkel, R. A., and Johnston, J. M. (1993) Arch. Biochem. Biophys. 301, 275-281[CrossRef][Medline] [Order article via Infotrieve]
  42. Narahara, H., and Johnston, J. M. (1993) Am. J. Obstet. Gynecol. 169, 531-537[Medline] [Order article via Infotrieve]
  43. Elstad, M. R., Stafforini, D. M., McIntyre, T. M., Prescott, S. M., and Zimmerman, G. A. (1989) J. Biol. Chem. 264, 8467-8470[Abstract/Free Full Text]
  44. Ma, W., Lim, W., Gee, K., Aucoin, S., Nandan, D., Kozlowski, M., Diaz-Mitoma, F., and Kumar, A. (2001) J. Biol. Chem. 276, 13664-13674[Abstract/Free Full Text]
  45. Brightbill, H. D., Plevy, S. E., Modlin, R. L., and Smale, S. T. (2000) J. Immunol. 164, 1940-1951[Abstract/Free Full Text]
  46. Palucka, K. A., Taquet, N., Sanchez-Chapuis, F., and Gluckman, J. C. (1998) J. Immunol. 160, 4587-4595[Abstract/Free Full Text]
  47. Laskin, D. L., Weinberger, B., and Laskin, J. D. (2001) J. Leukocyte Biol. 70, 163-170[Abstract/Free Full Text]
  48. Cook, A. D., Braine, E. L., and Hamilton, J. A. (2003) J. Immunol. 171, 4816-4823[Abstract/Free Full Text]
  49. Al-Darmaki, S., Schenkein, H. A., Tew, J. G., and Barbour, S. E. (2003) J. Immunol. 170, 167-173[Abstract/Free Full Text]
  50. Caivano, M., and Cohen, P. (2000) J. Immunol. 164, 3018-3025[Abstract/Free Full Text]
  51. Chen, C. C., and Wang, J. K. (1999) Mol. Pharmacol. 55, 481-488[Abstract/Free Full Text]
  52. Ye, X., and Liu, S. F. (2002) J. Biol. Chem. 277, 31863-31870[Abstract/Free Full Text]
  53. Bethea, J. R., Ohmori, Y., and Hamilton, T. A. (1997) J. Immunol. 158, 5815-5823[Abstract]
  54. Jarvis, B. W., and Qureshi, N. (1997) Infect. Immun. 65, 1640-1643[Abstract]
  55. Marco, E., Garcia-Nieto, R., and Gago, F. (2003) J. Mol. Biol. 328, 9-32[CrossRef][Medline] [Order article via Infotrieve]
  56. Li, J. M., Datto, M. B., Shen, X., Hu, P. P., Yu, Y., and Wang, X. F. (1998) Nucleic Acids Res. 26, 2449-2456[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 Am. J. Physiol. Heart Circ. Physiol.Home page
J. A. Wall, J. Wei, M. Ly, P. Belmont, J. J. Martindale, D. Tran, J. Sun, W. J. Chen, W. Yu, P. Oeller, et al.
Alterations in oxidative phosphorylation complex proteins in the hearts of transgenic mice that overexpress the p38 MAP kinase activator, MAP kinase kinase 6
Am J Physiol Heart Circ Physiol, November 1, 2006; 291(5): H2462 - H2472.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
X. Li, S. Wang, H. Wang, and D. Gupta
Differential Expression of Peptidoglycan Recognition Protein 2 in the Skin and Liver Requires Different Transcription Factors
J. Biol. Chem., July 28, 2006; 281(30): 20738 - 20748.
[Abstract] [Full Text] [PDF]

Home page
 FASEB J.Home page
L. Servillo, C. Balestrieri, A. Giovane, P. Pari, D. Palma, G. Giannattasio, M. Triggiani, and M. L. Balestrieri
Lysophospholipid Transacetylase in the Regulation of Paf Levels in Human Monocytes and Macrophages
FASEB J, May 1, 2006; 20(7): 1015 - 1017.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
D. M. Stafforini, J. R. Sheller, T. S. Blackwell, A. Sapirstein, F. E. Yull, T. M. McIntyre, J. V. Bonventre, S. M. Prescott, and L. J. Roberts II
Release of Free F2-isoprostanes from Esterified Phospholipids Is Catalyzed by Intracellular and Plasma Platelet-activating Factor Acetylhydrolases
J. Biol. Chem., February 24, 2006; 281(8): 4616 - 4623.
[Abstract] [Full Text] [PDF]

Home page
 Arterioscler. Thromb. Vasc. Bio.Home page
A. Zalewski and C. Macphee
Role of Lipoprotein-Associated Phospholipase A2 in Atherosclerosis: Biology, Epidemiology, and Possible Therapeutic Target
Arterioscler. Thromb. Vasc. Biol., May 1, 2005; 25(5): 923 - 931.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
279/34/36158    most recent
M402454200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wu, X.
Right arrow Articles by Stafforini, D. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wu, X.
Right arrow Articles by Stafforini, D. M.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2004 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement