Originally published In Press as doi:10.1074/jbc.M406499200 on June 25, 2004
J. Biol. Chem., Vol. 279, Issue 35, 36608-36615, August 27, 2004
Regulation of Insulin Action by Ceramide
DUAL MECHANISMS LINKING CERAMIDE ACCUMULATION TO THE INHIBITION OF Akt/PROTEIN KINASE B*
Suzanne Stratford
,
Kyle L. Hoehn
,
Feng Liu
, and
Scott A. Summers
¶
From the
Department of Biochemistry and Molecular Biology, Colorado State University, Fort Collins, Colorado 80523-1870 and the
Departments of Pharmacology and Biochemistry, University of Texas Health Science Center, San Antonio, Texas 78229
Received for publication, June 11, 2004
 |
ABSTRACT
|
|---|
The sphingolipid ceramide negatively regulates insulin action by inhibiting Akt/protein kinase B (PKB), a serine/threonine kinase that is a central regulator of glucose uptake and anabolic metabolism. Despite considerable attention, the molecular mechanism accounting for this action of ceramide has remained both elusive and controversial. Herein we utilized deletion constructs encoding two different functional domains of Akt/PKB to identify which region of the enzyme conferred responsiveness to ceramide. Surprisingly the findings obtained with these separate domains reveal that ceramide blocks insulin stimulation of Akt/PKB by two independent mechanisms. First, using the isolated pleckstrin homology domain, we found that ceramide specifically blocks the translocation of Akt/PKB, but not its upstream activator phosphoinositide-dependent kinase-1, to the plasma membrane. Second, using a construct lacking this pleckstrin homology domain, which does not require translocation for activation, we found that ceramide stimulates the dephosphorylation of Akt/PKB by protein phosphatase 2A. Collectively these findings identify at least two independent mechanisms by which excessive ceramide accumulation in peripheral tissues could contribute to the development of insulin resistance. Moreover the results obtained provide a unifying theory to account for the numerous dissenting reports investigating the actions of ceramide toward Akt/PKB.
 |
INTRODUCTION
|
|---|
A strong correlation between intramyocellular lipid levels and the severity of insulin resistance has prompted investigators to hypothesize that insulin resistance results from the ectopic accumulation of fat in tissues other than adipose (1, 2). Specifically, many researchers have speculated that increased availability of lipids to peripheral tissues causes insulin resistance by promoting the accumulation of fat-derived metabolites capable of inhibiting insulin action (1, 2). Numerous recent studies support the hypothesis that the aberrant deposition of the sphingolipid ceramide in skeletal muscle and liver contributes to the development of insulin resistance resulting from lipid oversupply. First, insulin resistant rodents (3, 4) and humans (5, 6) have elevated ceramide levels in their peripheral tissues. Second, exercise training insulin-resistant rodents markedly improves their insulin sensitivity while substantially lowering intramuscular ceramide levels (7). Third, ceramide analogs or agents that induce endogenous ceramide accumulation inhibit insulin signaling and insulin-stimulated glycogen synthesis and glucose uptake (814). Fourth, inhibitors of de novo ceramide synthesis prevent the antagonistic effects of saturated fatty acids on insulin signaling in cultured myotubes (9). The inhibitory effect of ceramides on insulin signaling result, at least partially, from their ability to block the phosphorylation and activation of Akt/protein kinase B, a serine/threonine kinase that is a central mediator of many insulin effects (10, 15, 16). The studies described herein investigated the molecular mechanism(s) by which ceramide inhibits Akt/PKB1 activation by insulin.
Numerous hormones, growth factors, and transforming oncogenes activate Akt/PKB using a redundant signaling pathway triggered by phosphatidylinositol 3-kinase, a lipid kinase that catalyzes production of 3'-phosphoinositides (i.e. phosphatidylinositol 3,4-bisphosphate (PI(3,4)P2) and phosphatidylinositol 3,4,5-trisphosphate (PI(3,4,5)P3) (for reviews, see Refs. 16 and 17). These unique phospholipids serve as docking sites for cytoplasmic proteins with pleckstrin homology (PH) domains, including the serine/threonine kinases Akt/PKB and phosphoinositide-dependent kinase-1 (PDK1). 3'-Phosphoinositides displace the PH domain of Akt/PKB, exposing regulatory phosphorylation sites in the catalytic/regulatory domain of the enzyme (e.g. Ser-473 and Thr-308 for the Akt1/PKB
isoform). Moreover, by recruiting both Akt/PKB and PDK1 to common membrane domains, the two enzymes come into closer proximity, facilitating the phosphorylation of the Thr-308 residue by PDK1. 3'-Phosphoinositides, through a second mechanism not involving the recruitment of Akt/PKB to the plasma membrane, promote Ser-473 phosphorylation, which is required for subsequent Thr-308 phosphorylation (18, 19). The enzyme responsible for phosphorylating the Ser-473 site has not yet been cloned (20, 21).
Ceramide levels in various insulin-resistant rodents and humans are approximately twice those of insulin-sensitive controls (3, 4). By using a variety of different treatments to modulate intracellular ceramide levels in either C2C12 myotubes or 3T3-L1 preadipocytes, we have shown that artificially increasing intracellular ceramide 2-fold over basal values blocks activation of Akt/PKB by insulin (8, 9, 22). Short-chain ceramide analogs recapitulate the effect of inducing endogenous ceramide accumulation (9, 10, 22). Interestingly in our prior studies we have detected no effects of either induced endogenous ceramide or short-chain ceramide analogs on upstream signaling events, such as the phosphorylation of insulin receptor substrate proteins or the activation of PI 3-kinase (8, 10, 22). In this study, we sought to understand the mechanisms underlying the inhibitory effect of ceramide by defining the region of Akt/PKB that confers responsiveness to ceramide. Specifically we evaluated effects of ceramide analogs on truncated constructs encoding either (a) the isolated PH domain, which translocates to the plasma membrane following insulin treatment, or (b) the isolated catalytic/regulatory domain, which is phosphorylated and activated in response to insulin via a translocation-independent mechanism. Surprisingly the findings obtained revealed the existence of two independent mechanisms by which ceramide regulates Akt/PKB, each initiated downstream of PI 3-kinase and culminating on a separate domain of Akt/PKB.
 |
EXPERIMENTAL PROCEDURES
|
|---|
Antibodies and ReagentsPolyclonal antibodies directed against the phosphorylated forms of mitogen-activated protein kinase and Akt/PKB (Ser-473 site) were from Promega (Madison, WI) and Cell Signaling Technology, Inc. (Beverly, MA), respectively, and those against hemagglutinin were from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). Secondary anti-rabbit antibodies coupled to Texas Red or horseradish peroxidase were from Jackson Immunoresearch Laboratories (West Grove, PA) or Santa Cruz Biotechnology, Inc., respectively. C2-ceramide and C2-dihydroceramide were from Calbiochem-Novabiochem. Porcine insulin was from Sigma. PI(3,4,5)P3 was from Echelon Biosciences (Salt Lake City, UT).
Cell Culture3T3-L1 preadipocytes were maintained in Dulbecco's modified Eagle's medium supplemented with 10% calf serum. Preadipocytes expressing the Akt/PKB constructs were periodically selected in 800 µg/ml G418 and were described previously (23).
Cell Lines and cDNA Constructs3T3-L1 preadipocytes stably expressing HA-tagged human Akt1/PKB
(HA-Akt/PKB) or
4129-Akt/PKB (Cat/Reg-Akt/PKB) were provided by Richard Roth (Stanford University, Stanford, CA) and were described previously (24). Sandra Watton and Doreen Cantrell (Imperial Cancer Research Fund, London, UK) provided the PH domain of Akt/PKB coupled to green fluorescent protein (GFP) (25). HA-tagged PDK1 was described previously (26). The GFP-tagged catalytic domain of Akt/PKB (amino acids 126480) was generated by PCR using a forward primer (GGGAGATCTAGTGACAACTCAGGGGCTGAAG), which inserted a BglII restriction site, and a reverse primer 3' primer (GGGGAATTCTCAGGCTGTCGGACTGGC), which inserted an EcoRI restriction site after the stop codon. The PCR fragment was obtained using full-length GFP-Akt as a template, and the PCR product obtained was cloned into the pGEM TA cloning vector (Promega), digested with BglII and EcoRI, and subcloned into the pEGFP vector (Clontech).
Analysis of Akt/PKB Translocation by Confocal Microscopy3T3-L1 preadipocytes at 2030% confluency on coverslips were transfected with 10 µg of cDNA encoding GFP-Akt-PH, GFP-Cat/Reg-Akt/PKB, or HA-PDK1 using the LipoTAXI mammalian transfection kit (Stratagene, La Jolla, CA). Cells were analyzed by confocal fluorescence microscopy 48 h post-transfection. Digital image processing was performed as described previously using Metamorph software (22). GFP-tagged proteins were visualized directly, while HA-tagged ones were visualized by immunofluorescence with anti-HA antibodies using methods described previously (27).
PI 3-Kinase AssaysPI 3-kinase assays were performed using the method of Wang and Summers (28).
Delivery of PI(3,4,5)P3PI(3,4,5)P3 was delivered using the Shuttle PIPTM kit from Echelon Biosciences. Briefly 3T3-L1 preadipocytes were grown to confluency and serum-starved in Dulbecco's modified Eagle's medium + 0.2% bovine serum albumin for 2 h prior to treatment. Equimolar concentrations of PI(3,4,5)P3 and histone carrier were mixed, sonicated, and incubated at room temperature for 10 min. The mixture was added to cells at a final concentration of 1 µM for 10 min prior to lysis. For selected assays, NBD-labeled PI(3,4,5)P3 was included and visualized by fluorescence microscopy.
Immunoblot Analyses of Total Cell LysatesCells grown to confluency in 100-mm-diameter dishes were serum-deprived as indicated in the figure legends. Cells were washed twice with ice-cold phosphate-buffered saline and lysed in 100 µl of 66 mM Tris (pH 8.0) containing 2% SDS and 100 mM vanadate. Samples were boiled for 2 min, and DNA was sheared by passing extracts through a 27-gauge needle several times. Insoluble material was pelleted by centrifuging the samples for 30 min at 20,000 x g. Protein concentrations were determined using the bicinchoninic protein assay kit from Pierce, and 40 µg of total protein were loaded into each well of a 7.5% or 10% polyacrylamide gel. Proteins were transferred to nitrocellulose and probed with the indicated antibodies as described previously (29). Antibody detection was performed using the enhanced chemiluminescence kit from Amersham Biosciences.
PDK1 Kinase Assay3T3-L1 preadipocytes were grown to 50% confluency and transfected with pBEX-PDK1 using calcium phosphate. Cells were serum-deprived in Dulbecco's modified Eagle's medium and 0.2% bovine serum albumin for 2 h and treated with or without insulin and/or C2-ceramide. Cells were lysed in 1 ml of lysis buffer (150 mM NaCl, 25 mM Tris-HCl, 1 mM EDTA, 0.2 mM EGTA, 5 mM MgCl2, 1 mM dithiothreitol, 10% glycerol, 2% Igepal, 1 mM phenylmethylsulfonyl fluoride, 50 IU/ml aprotinin, 2 µg/ml leupeptin), incubated on ice for 15 min, and then centrifuged for 10 min. The supernatant (900 µl) was transferred to new tubes and rocked with 8 µl of rabbit anti-HA antibodies for 1 h at 4 °C. Thirty microliters of Protein A-agarose beads were washed in lysis buffer, centrifuged, and incubated with the supernatant for 1 h at 4 °C. Samples were then washed three times with lysis buffer, twice more with kinase buffer (50 mM Hepes, 10 mM MgCl2, 2 mM MnCl2, 0.2 mM dithiothreitol), and resuspended in kinase buffer. Sphingosine (1 mM) and C2-ceramide (1 mM) were prepared as stock solutions in kinase buffer containing 4 mg/ml bovine serum albumin and were added at a final concentration of 100 µM.[32P]ATP (5 µCi) was added to each sample in 200 µM ATP + Mg2+. The final volume for the reaction was 50 µl. Samples were incubated at 30 °C for 30 min, and the reaction was stopped by the addition of 50 µl of sample buffer. Proteins were resolved by SDS-PAGE, transferred to nitrocellulose, and visualized on a Storm PhosphorImager.
 |
RESULTS
|
|---|
Ceramide Blocks the Effects of Insulin on Both the PH Domain and the Catalytic/Regulatory Domain of Akt/PKBAkt/PKB is comprised of an amino-terminal pleckstrin homology domain followed by a carboxyl-terminal catalytic/regulatory domain (31). As described earlier, Akt/PKB translocates to the plasma membrane in insulin-stimulated cells because of high affinity interactions between its PH domain and insulin-generated 3'-phosphoinositides (32). The 3'-phosphoinositides displace the PH domain of Akt/PKB, exposing two regulatory phosphorylation sites within the catalytic/regulatory domain (17). To determine whether ceramide blocked the insulin-stimulated recruitment of Akt/PKB to the plasma membrane, we assessed the effects of a short-chain ceramide analog (C2-ceramide) on the subcellular distribution of Akt/PKB constructs tagged with GFP. Within minutes, insulin stimulated the translocation of either a full-length Akt/PKB construct (wild type, WT-Akt/PKB) or a truncated one encoding only the PH domain (PH-Akt/PKB). Pretreating with C2-ceramide completely blocked this insulin-stimulated movement of either construct (Fig. 1). Removal of the PH domain (Cat/Reg-Akt/PKB) rendered Akt/PKB incapable of translocating to the plasma membrane, and its subcellular distribution was unaltered by C2-ceramide (Fig. 1).

View larger version (57K):
[in this window]
[in a new window]
|
FIG. 1. Regulation of Akt/PKB and PH-Akt/PKB translocation by C2-ceramide. 3T3-L1 preadipocytes were transfected with the GFP-tagged constructs depicted, including a wild type form of the enzyme (WT-Akt/PKB), the isolated PH domain (PH-Akt/PKB), or the truncated catalytic/regulatory domain (Cat/Reg-Akt/PKB). Twenty-four hours after transfection cells were treated with or without C2-ceramide (C2, 100 µM, 10 min) or insulin (1 µM, 5 min) as indicated, fixed with paraformaldehyde, and visualized by fluorescence confocal microscopy. Arrows denote membrane localized constructs. The images shown are representative of at least five independent experiments.
|
|
Interestingly Roth and colleagues (33) have demonstrated previously that, through a PI 3-kinase-dependent mechanism, insulin activates Cat/Reg-Akt/PKB by stimulating its phosphorylation on two sites. Presumably removal of the PH domain eliminates the need for membrane localization as the domain no longer blocks accessibility to the regulatory residues. However, activation of the enzyme still requires PI 3-kinase as Ser-473 phosphorylation occurs through a separable PI 3-kinase-dependent pathway (18, 19). Reasoning that this construct would be insensitive to the inhibitory effects of ceramide, we determined whether C2-ceramide blocked the phosphorylation and activation of Cat/Reg-Akt/PKB. Surprisingly C2-ceramide completely inhibited the insulin-stimulated phosphorylation and activation of Cat/Reg-Akt/PKB (Fig. 2). Specifically we were able to simultaneously assess the phosphorylation state of both endogenous Akt/PKB and Cat/Reg-Akt/PKB in 3T3-L1 preadipocytes stably expressing the deletion construct. Using antibodies that recognize the Ser-473 phosphorylation site, we found that C2-ceramide blocks phosphorylation of both endogenous Akt/PKB and Cat/Reg-Akt/PKB comparably (Fig. 2A). We additionally measured the kinase activity of the immunoisolated Cat/Reg-Akt/PKB construct and found that ceramide completely ablated the insulin-stimulated increase in enzymatic activity (Fig. 2B).

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 2. Regulation of Cat/Reg-Akt/PKB phosphorylation and activation by C2-ceramide. 3T3-L1 preadipocytes expressing the HA-tagged form of Cat/Reg-Akt/PKB were treated with or without C2-ceramide (C2, 100 µM, 10 min), C2-dihydroceramide (C2H2, 100 µM, 10 min), and/or insulin (Ins, 1 µM, 5 min) prior to lysis. In A cells were solubilized in 66 mM Tris, 2%SDS, and the lysates were resolved by SDS-PAGE and immunoblotted with antibodies recognizing the phosphorylated Ser-473 residue. In B, the activity of the Cat/Reg-Akt/PKB construct was determined by measuring the incorporation of 32P from [32P]ATP to histone 2B. The inset depicts a representative autoradiogram. WB, Western blot.
|
|
Ceramide Does Not Inhibit Upstream Signaling EventsThe observation that ceramide inhibits distinct domains on Akt/PKB suggested that the effects of sphingolipid were the result of an inhibition of upstream signaling events. Moreover researchers have used labeled PH domains as a means of measuring 3-phosphoinositide generation in vivo (34, 35), suggesting that C2-ceramide was probably blocking the activation of PI 3-kinase or the accumulation of PI(3,4)P2 or PI(3,4,5)P3. Although others and we have demonstrated that C2-ceramide has no effect on PI 3-kinase in NIH-3T3 fibroblasts or 3T3-L1 adipocytes (9, 10, 13, 15, 22, 3639), contradicting reports have suggested that C2-ceramide potently inhibits PI 3-kinase activation (11, 40, 41). To confirm that the effects of C2-ceramide did not result from its inhibition of PI 3-kinase we evaluated whether C2-ceramide blocked activation of Akt/PKB triggered by directly introducing PI(3,4,5)P3 into intracellular domains. Specifically, Shuttle PIP carriers (Echelon Biosciences) were used to deliver PI(3,4,5)P3 into living 3T3-L1 preadipocytes. Fig. 3A demonstrates the subcellular localization of NBD-labeled PI(3,4,5)P3, which did not appear in either the nucleus or plasma membrane but instead localized to large structures present throughout the interior of the cell (Fig. 3A). At concentrations as low as 1 µM, PI(3,4,5)P3 stimulated the phosphorylation of Akt/PKB (Fig. 3B). Interestingly PI(3,4,5)P3 also stimulated the phosphorylation of Cat/Reg-Akt/PKB, confirming the existence of a PI 3-kinase-dependent pathway responsible for Akt/PKB phosphorylation that is independent of the effect on Akt/PKB translocation (42). C2-ceramide completely blocked Akt/PKB phosphorylation induced by PI(3,4,5)P3, confirming that C2-ceramide regulates Akt/PKB independently of effects on PI 3-kinase.

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 3. C2-ceramide blocks PI(3,4,5) P3-stimulated Akt/PKB phosphorylation. A, 3T3-L1 preadipocytes were grown on coverslips until 20% confluent, serum-starved for 2 h in Dulbecco's modified Eagle's medium + 0.2% bovine serum albumin, and treated with 1 µM NBD-PI(3,4,5)P3 (PIP3) coupled to a carrier complex (available from Echelon Biosciences). After a 10-min incubation, NBD-labeled PI(3,4,5)P3 could be visualized inside the cell by fluorescence microscopy. B, 3T3-L1 preadipocytes expressing Cat/Reg-Akt/PKB or empty vector were treated with 100 µM C2-ceramide for 10 min before treating with or without PI(3,4,5)P3/histone (mixed at equimolar ratios) carrier or insulin (1 µM) for an additional 10 min. Cells were lysed in 2% SDS, 66 mM Tris-HCl, resolved by SDS-PAGE, and immunoblotted with antibodies recognizing the phosphorylated Ser-473 residue of Akt/PKB. Ceramide inhibits the insulin or PI(3,4,5)P3-stimulated phosphorylation of both endogenous Akt/PKB and Cat/Reg-Akt/PKB. Results are representative of three independent experiments. Ins, insulin; C2, C2-ceramide.
|
|
An alternative possibility was that C2-ceramide was promoting 3'-phosphoinositide degradation or altering the ability of 3'-phosphoinositide to effectively signal to all of its target molecules. To confirm that 3'-phosphoinositides were capable of signaling to downstream effectors other than Akt/PKB, we determined whether C2-ceramide altered the translocation of another target of 3'-phosphoinositides, PDK1. To effectively remove PDK1 from the plasma membrane, we treated cells with the PI 3-kinase inhibitor LY294002
16 h before performing the experiment. This treatment effected a redistribution of GFP-tagged PDK1 from the plasma membrane to the cytoplasm. The addition of insulin rapidly stimulated the translocation of PDK1 to the plasma membrane (Fig. 4) via a PI 3-kinase-dependent mechanism (data not shown). C2-ceramide, under conditions that completely blocked Akt/PKB phosphorylation, activation, and translocation, had no effect on the movement of PDK1 (Fig. 4). These data indicate that PI(3,4,5)P3 is produced and functional in these cells, but it is incapable of recruiting and activating Akt/PKB in cells loaded with excess ceramide.

View larger version (42K):
[in this window]
[in a new window]
|
FIG. 4. C2-ceramide does not inhibit PDK1 translocation or activation. A, 3T3-L1 preadipocytes expressing HA-tagged PDK1 were treated with or without C2-ceramide (100 µM) for 20 min prior to stimulation with or without insulin (1 µM, 5 min). The HA-PDK1 was visualized by immunofluorescence using antibodies recognizing the HA epitope. Arrows denote membrane localized PDK1. B, left panel, PDK1 kinase assays were performed on immunoprecipitated HA-PDK1 by quantifying autophosphorylation using [32P]ATP. Ceramide (C2, 100 µM) or sphingosine (Sph, 100 µM) were added to the isolated protein 15 min prior to adding [32P]ATP. Right panel, the cells were treated with 1 µM insulin (Ins), 100 µM C2-ceramide, or both prior to immunoprecipitating HA-PDK1. As before, sphingosine was added in vitro (100 µM) 15 min prior to the addition of [32P]ATP. Results are representative of three independent experiments.
|
|
Surprisingly Filippa et al. (43) reported that the catalytic/regulatory domain of Akt/PKB can interact directly with PDK1, thus negating the need for 3'-phosphoinositides in its translocation. In this prior study, catalytically inactive forms of PDK1, as well as those lacking their PH domains, were incapable of promoting Akt/PKB translocation. Although we were unable to detect any movement of Cat/Reg-Akt to the plasma membrane (Fig. 1), we nonetheless evaluated the effects of ceramide on PDK1 kinase activity as the inhibition of PDK1 activity could account for the effects on Cat/Reg-Akt phosphorylation and activation. C2-ceramide, at concentrations as high as 100 µM, had no effect on the activity of immunoisolated PDK1 (Fig. 4B). Interestingly King et al. (44) found that sphingosine dramatically stimulates PDK1 activity and have hypothesized that this is important for PDK1 activation by hormonal stimuli. Since C2-ceramide contains a sphingosine backbone, we hypothesized that C2-ceramide might block the sphingosine-induced increase in PDK1 activity. However, although sphingosine potently activated PDK1 activity (
8-fold), its stimulatory effects were insensitive to C2-ceramide added either in vitro (i.e. C2-ceramide added after immunoisolation of PDK1) (Fig. 4A) or in vivo (i.e. C2-ceramide added to the cells before immunoisolation of PDK1) (Fig. 4B). We also assessed the effects of C2-ceramide on PDK1 isolated from insulin-stimulated cells but detected no change in activity.
Okadaic Acid Selectively Blocks the Effect of C2-ceramide on Cat/Reg-Akt/PKB but Not PH-AktOur inability to identify any effects of ceramide on upstream signaling events led us to suspect the existence of two independent pathways linking ceramide accumulation to the inhibition of Akt/PKB. Specifically we speculated that C2-ceramide could block Akt/PKB translocation by preventing the association between the PH domain and PI(3,4,5)P3 while simultaneously blocking phosphorylation of the catalytic/regulatory domain through an independent mechanism. Protein phosphatase 2A (PP2A) is the primary regulator of Akt/PKB dephosphorylation (45) and is a reported target of ceramide (46). In parental 3T3-L1 preadipocytes, the PP2A inhibitor okadaic acid (OA) did not prevent the inhibitory effects of ceramide on endogenous Akt/PKB phosphorylation (Fig. 5A). Interestingly, however, OA completely blocked the antagonistic effects of C2-ceramide on Cat/Reg-Akt/PKB phosphorylation or activation (Fig. 5B). OA prevented the effects of C2-ceramide not only toward insulin-stimulated Akt/PKB but also toward PI(3,4,5)P3-stimulated Akt/PKB (Fig. 5C).

View larger version (34K):
[in this window]
[in a new window]
|
FIG. 5. Okadaic acid selectively prevents the effects of C2-ceramide on Cat/Reg-Akt/PKB. Parental 3T3-L1 preadipocytes (A) or those expressing Cat/Reg-Akt/PKB (B and C) were pretreated with or without okadaic acid (1 µM, 30 min) prior to treating with C2-ceramide (C2, 100 µM, 20 min), insulin (Ins, 1 µM, 10 min), and/or PI(3,4,5)P3 (PIP2)/histone (mixed at equimolar ratios) (1 µM, 10 min). Cells lysates were resolved by SDS-PAGE and immunoblotted with antibodies recognizing the phosphorylated Ser-473 or Thr-308 residue of Akt. Results are representative of at least four independent experiments. Blots are representative of at least five independent experiments. B, lower panel, Cat/Reg-Akt/PKB kinase activity was determined by visualizing the phosphorylation of histone 2B (H2B) as described under "Experimental Procedures." WB, Western blot; P-, phospho-; KA, okadaic acid.
|
|
The differential sensitivity of full-length Akt/PKB and Cat/Reg-Akt/PKB to okadaic acid suggested the existence of two independent mechanisms, defined by their sensitivity to the inhibitor, linking ceramide to the regulation of Akt/PKB. We thus tested whether OA prevented the inhibitory effects of C2-ceramide on Akt/PKB or PH-Akt/PKB translocation. Surprisingly treating with OA effected a primarily plasma membrane distribution of full-length Akt/PKB, but not Cat/Reg-Akt/PKB or PH-Akt/PKB, in the absence of other hormonal stimuli. However, OA failed to prevent the inhibitory effects of C2-ceramide on the translocation of either full-length Akt/PKB or PH-Akt/PKB (Fig. 6). This finding confirms the existence of both OA-sensitive and OA-insensitive pathways linking ceramide to the inhibition of Akt/PKB.

View larger version (38K):
[in this window]
[in a new window]
|
FIG. 6. Okadaic acid does not prevent the inhibitory effects of C2-ceramide on PH-Akt/PKB translocation. 3T3-L1 preadipocytes were transfected with GFP-Akt/PKB (WT-Akt/PKB), GFP-PH-Akt/PKB (PH-Akt/PKB), or GFP-Cat/Reg-Akt/PKB (Cat/Reg-Akt/PKB) 24 h prior to treating with or without okadaic acid (1 µM, 30 min). Cells were subsequently treated with or without C2-ceramide (C2, 100 µM, 20 min) or insulin (1 µM, 10 min) and fixed in paraformaldehyde, and the GFP-tagged constructs were visualized by confocal microscopy. Arrows denote membrane localized constructs. Images are representative of at least five independent experiments.
|
|
Overexpression of the SV40 Small T Antigen Prevents the Inhibitory Effects of C2-ceramide on Cat/Reg-Akt/PKB PhosphorylationPP2A is a major serine/threonine phosphatase present in all eukaryotic cells. The enzyme functions in vivo in both a dimeric and trimeric form. The dimer is composed of a 36-kDa catalytic subunit (C) bound to a 65-kDa regulatory subunit (A). These proteins form a core dimer that interacts with another variable subunit that reportedly confers to the enzyme a sensitivity to ceramide. Although PP2A seemed to be the most likely link between C2-ceramide and Cat/Reg-Akt/PKB, the concentration of OA required to prevent the ceramide effects was sufficiently high to additionally inhibit another putative target of ceramide, protein phosphatase-1 (47). To confirm that PP2A linked C2-ceramide to the regulation of Cat/Reg-Akt/PKB, we used recombinant adenovirus to overexpress the SV40 small T antigen in 3T3-L1 preadipocytes. The SV40 small T antigen has been shown to displace the variable subunits and should specifically negate the effects of C2-ceramide on PP2A. As shown in Fig. 7, the overexpression of the SV40 small T antigen recapitulated the effects of OA by preventing the dephosphorylation of Cat/Reg-Akt/PKB but not full-length Akt/PKB.

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 7. Inhibition of PP2A by SV40 small T antigen prevents the inhibitory effects of C2-ceramide on Akt phosphorylation on Cat/Reg-Akt/PKB but not endogenous Akt/PKB. 3T3-L1 preadipocytes expressing Cat/Reg-Akt/PKB were infected with recombinant adenovirus (multiplicity of infection = 100) encoding the SV40 small T antigen. After 3 days of infection, cells were treated with or without C2-ceramide (C2, 100 µM, 20 min) or insulin (Ins, 1 µM, 10 min). Cells lysates were resolved by SDS-PAGE and immunoblotted with antibodies recognizing the phosphorylated Ser-473 residue of Akt or the SV40 small T antigen. Results are representative of three independent experiments.
|
|
 |
DISCUSSION
|
|---|
Ceramide has been described as a central regulator of numerous cellular processes, including apoptosis (4852), differentiation (51), and proliferation (53, 54). Despite considerable attention, the molecular mechanisms linking ceramide accumulation to these diverse biological processes have remained both elusive and controversial. While some researchers have speculated that ceramide functions as a traditional second messenger (5557), others have argued that ceramide regulates cellular processes primarily by altering biophysical properties of membranes (58). To understand the mechanism by which ceramide antagonizes insulin action, we have sought to determine the molecular events linking excessive accumulation of ceramide to the antagonism of insulin stimulation of Akt/PKB. Ultimately we feel that such studies will produce important information not only about possible metabolic defects that contribute to the development of insulin resistance but also to answer fundamental questions regarding the role of ceramide in various biological processes.
Multiple groups, including ours, have demonstrated that short-chain ceramide analogs or agents that induce endogenous ceramide accumulation block the activation of Akt/PKB by a diverse array of extracellular stimuli (9, 10, 13, 15, 22, 3639).2 In the majority of studies (9, 10, 15, 3840),2 but not all (11, 40, 41), ceramide analogs were shown to have no effect on hormone-stimulated PI 3-kinase. Moreover others and we have demonstrated previously that ceramide does not inhibit 3'-phosphoinositide production by insulin or other hormonal agonists (14, 22). The findings presented above indicate that, within a single cell type, short-chain ceramide analogs block insulin-stimulated Akt/PKB activation by two independent mechanisms, both of which occur "downstream" of 3'-phosphoinositide production. The two independent ceramide effects can be defined by their relative sensitivity or insensitivity to OA. First, via an OA-insensitive mechanism, C2-ceramide blocks the insulin-stimulated translocation of either full-length Akt/PKB or the isolated Akt/PKB PH domain to the plasma membrane (Fig. 1). Second, using an Akt/PKB derivative that does not require translocation for activation (i.e. Cat/Reg-Akt/PKB, Fig. 4), we found that C2-ceramide promotes the dephosphorylation of Akt/PKB by an OA-sensitive phosphatase.
Okadaic Acid-insensitive PathwayThe results obtained confirm that the effect of C2-ceramide on Akt/PKB or PH-Akt/PKB translocation (Figs. 1 and 6), which is OA-insensitive, occurs downstream of PI(3,4,5)P3 production. First, C2-ceramide did not block the translocation of PDK1 (Fig. 3), indicating that 3'-polyphosphoinositides were produced and functional in insulin-stimulated cells. Moreover PI(3,4,5)P3-stimulated activation of full-length Akt/PKB was also insensitive to OA, confirming that the OA-insensitive pathway exists independently of effects on PI(3,4,5)P3. These findings are consistent with prior studies, done by our laboratory and others, indicating that C2-ceramide does not inhibit PI 3-kinase (9, 10, 15, 3840),2 prevent the intracellular accumulation of PI(3,4)P2 or PI(3,4,5)P3 (22), or alter the activity of PDK1 (26).
Reviewing the multiple studies evaluating the inhibitory effects of C2-ceramide on Akt/PKB activation reveals that the inhibition of Akt/PKB translocation by ceramide is likely to be a cell type-specific phenomenon. Specifically, in PC12 cells (38), brown adipocytes (13), C2C12 myotubes (9), and a human glioblastoma cell line, U87MG (36), OA was shown to completely prevent the inhibitory effects of short-chain ceramide analogs on Akt/PKB phosphorylation. By contrast, ceramide analogs, through an OA-insensitive mechanism, were shown to inhibit Akt/PKB phosphorylation or activation in hybrid motor neurons (15), 3T3-L1 preadipocytes and adipocytes (10), A7r5 vascular smooth muscle cells (37), and L6 muscle cells (14). The findings presented herein provide a clear explanation for this apparent discrepancy. We have demonstrated that, within the same cell type, ceramide regulates Akt/PKB by both OA-sensitive and OA-insensitive pathways. Since PP2A is ubiquitously expressed, these studies suggest that the OA-sensitive pathway is present in most, if not all, cell types. By contrast, the effect of C2-ceramide on Akt/PKB translocation is likely to occur only in those cells demonstrating the presence of this OA-insensitive pathway. Convincingly, in PC-12 cells, where OA completely prevents the inhibition of Akt/PKB by C2-ceramide, the sphingolipid did not block Akt/PKB translocation to the plasma membrane (38).
Okadaic Acid-sensitive PathwayWithin the mammalian genome, the number of catalytic phosphatase domains is considerably smaller than the corresponding list of kinases. PP2A is one of the most highly expressed phosphatases, comprising 0.31% of cellular protein (59). Moreover ceramide activates purified PP2A (47), which is the primary phosphatase responsible for the dephosphorylation and inactivation of Akt/PKB in rat adipocytes (45). As described above, several groups have implicated PP2A as a mediator of the effects of ceramide on Akt/PKB phosphorylation (13, 36, 38). These groups base their conclusions largely on the effects of phosphatase inhibitors, such as OA and calyculin A. OA binds directly to the catalytic subunit of PP2A and has been a useful reagent for identifying phosphatase-mediated events. However, it has significant limitations as a tool for identifying the key ceramide-responsive phosphatases. Significantly OA inhibits PP4 with comparable sensitivity, while it inhibits PP1 and PP5 with somewhat lower potency (60). Ceramide also reportedly activates PP1 (47). Moreover OA penetrates cell membranes rapidly but accumulates slowly, making it difficult to control the intracellular concentration of the compound in vivo (61). Thus, at the elevated concentrations used in these and other studies, OA was incapable of distinguishing between PP2A and other protein phosphatases. For this reason, we utilized the SV40 small T antigen, which, as described below, selectively blocks activation of the PP2A enzyme (62).
Unlike kinases, which achieve specificity for particular targets as a result of the selective ability of their catalytic core to interact with particular substrates, protein phosphatases achieve specificity as a result of their ability to form a large repertoire of heterotrimeric holoenzymes. PP2A exists in either heterodimeric (PP2AD) or heterotrimeric forms (PP2AT) in intact cells. The dimer consists of a catalytic subunit (A) bound to a constant regulatory subunit (A), while the trimeric form additionally contains one of several additional regulatory proteins (termed B, B', B'', or B'''). Dobrowsky and Hannun (46) have demonstrated that C2-ceramide directly activates heterotrimeric PP2A but not the dimeric form. The SV40 small T antigen displaces the B class of subunits (30), and we hypothesized that its overexpression would selectively block activation of PP2A by ceramide and render Cat/Reg-Akt/PKB insensitive to the inhibitory effects of C2-ceramide. As shown in Fig. 7, SV40 small T antigen expression selectively prevented the inhibitory effects of C2-ceramide toward Cat/Reg-Akt/PKB but not endogenous Akt/PKB. This finding definitively identifies PP2A as the phosphatase responsible for these ceramide effects and confirms that one or more of the B class subunits confers ceramide responsiveness to the enzyme.
Implications on the Mechanism Underlying Akt/PKB ActivationIn addition to providing important insight into the mechanisms underlying the ceramide effects on Akt/PKB, our findings with the deletion or truncation Akt/PKB mutants have important implications on the molecular pathways leading to full Akt/KPB activation. For example, the observation that both insulin and PI(3,4,5)P3 will promote phosphorylation of
PH-Akt/PKB (Figs. 2 and 3), which does not translocate to the plasma membrane following hormonal stimulation (Fig. 1), confirms the findings of Roth's and Woodgett's laboratories (18, 19, 33) that 3'-phosphoinositides are required for promoting Akt/PKB phosphorylation even under conditions where they are not required to facilitate Akt/PKB translocation. Interestingly this second PI 3-kinase-dependent effect appears to be insensitive to ceramides. The identification of the molecular targets of 3'-phosphoinositides that mediate this phosphorylation event remains an important hurdle for our understanding of the molecular details underlying this redundant signaling pathway.
ConclusionsGiven the plethora of studies investigating the regulation of Akt/PKB by ceramide (911, 13, 15, 22, 3641),2 the interaction between these two biomolecules is of considerable biological interest. We describe herein a possible reason why delineation of the cellular events disrupted by excess cellular ceramide may have proven so problematic, and we provide a unifying theory regarding the inhibitory effects of ceramide on Akt/PKB activation. Specifically we demonstrate that, in 3T3-L1 preadipocytes, ceramide blocks the translocation of Akt/PKB to the plasma membrane while simultaneously promoting Akt/PKB dephosphorylation by PP2A. In addition to understanding the mechanism by which ceramide blocks the recruitment of Akt/PKB by 3'-phosphoinositides, researchers must now endeavor to determine whether either of these separate mechanisms contributes to the regulation of Akt/PKB in more physiologically relevant tissues (e.g. insulin-resistant skeletal muscle).
 |
FOOTNOTES
|
|---|
* This work was supported by National Institutes of Health Grants R01-DK58784 (to S. A. S.) and R01-DK56166 (to F. L.) and a career development award from the American Diabetes Association (to S. A. S.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. 
¶ Current address: Div. of Endocrinology, Metabolism, and Diabetes, Dept. of Medicine, University of Utah, Salt Lake City, UT 84132. To whom correspondence should be addressed. Tel.: 801-581-7755; Fax: 801-585-0956; E-mail: scott.summers{at}hsc.utah.edu.
1 The abbreviations used are: PKB, protein kinase B; PI, phosphatidylinositol; PDK1, phosphoinositide-dependent kinase-1; PH, pleckstrin homology; GFP, green fluorescent protein; HA, hemagglutinin; PI(3,4,5)P3, phosphatidylinositol 3,4,5-trisphosphate; PI(3,4)P2, phosphatidylinositol 3,4-bisphosphate; NBD, 12-(N-methyl-N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)); WT, wild type; PP, protein phosphatase; OA, okadaic acid. 
2 S. Stratford, K. L. Hoehn, and S. A. Summers, submitted for publication. 
 |
ACKNOWLEDGMENTS
|
|---|
We gratefully acknowledge the assistance of Richard Roth (Stanford Medical School, Stanford, CA), who provided the Cat/Reg-Akt/PKB construct used herein, and Sandra Watton and Doreen Cantrell (Imperial Cancer Research Fund, London, UK), who provided GFP-tagged Akt/PKB.
 |
REFERENCES
|
|---|
- Schmitz-Peiffer, C. (2000) Cell. Signal. 12, 583594[CrossRef][Medline]
[Order article via Infotrieve]
- McGarry, J. D. (2002) Diabetes 51, 718[Free Full Text]
- Turinsky, J., O'Sullivan, D. M., and Bayly, B. P. (1990) J. Biol. Chem. 265, 1688016885[Abstract/Free Full Text]
- Kim, J. K., Fillmore, J. J., Chen, Y., Yu, C., Moore, I. K., Pypaert, M., Lutz, E. P., Kako, Y., Velez-Carrasco, W., Goldberg, I. J., Breslow, J. L., and Shulman, G. I. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 75227527[Abstract/Free Full Text]
- Straczkowski, M., Kowalska, I., Nikolajuk, A., Dzienis-Straczkowska, S., Kinalska, I., Baranowski, M., Zendzian-Piotrowska, M., Brzezinska, Z., and Gorski, J. (2004) Diabetes 53, 12151221[Abstract/Free Full Text]
- Adams, J. M., II, Pratipanawatr, T., Berria, R., Wang, E., DeFronzo, R. A., Sullards, M. C., and Mandarino, L. J. (2004) Diabetes 53, 2531[Abstract/Free Full Text]
- Dobrzyn, A., and Gorski, J. (2002) Am. J. Physiol. 282, E277E285
- Chavez, J. A., and Summers, S. A. (2003) Arch. Biochem. Biophys. 419, 101109[CrossRef][Medline]
[Order article via Infotrieve]
- Chavez, J. A., Knotts, T. A., Wang, L. P., Li, G., Dobrowsky, R. T., Florant, G. L., and Summers, S. A. (2003) J. Biol. Chem. 278, 1029710303[Abstract/Free Full Text]
- Summers, S. A., Garza, L. A., Zhou, H., and Birnbaum, M. J. (1998) Mol. Cell. Biol. 18, 54575464[Abstract/Free Full Text]
- Kanety, H., Hemi, R., Papa, M. Z., and Karasik, A. (1996) J. Biol. Chem. 271, 98959897[Abstract/Free Full Text]
- Schmitz-Peiffer, C., Craig, D. L., and Bidn, T. J. (1999) J. Biol. Chem. 274, 2420224210[Abstract/Free Full Text]
- Teruel, T., Hernandez, R., and Lorenzo, M. (2001) Diabetes 50, 25632571[Abstract/Free Full Text]
- Hajduch, E., Balendran, A., Batty, I. H., Litherland, G. J., Blair, A. S., Downes, C. P., and Hundal, H. S. (2001) Diabetologia 44, 173183[CrossRef][Medline]
[Order article via Infotrieve]
- Zhou, H., Summers, S. A., Birnbaum, M. J., and Pittman, R. N. (1998) J. Biol. Chem. 273, 1656816575[Abstract/Free Full Text]
- Summers, S. A., Whiteman, E. L., and Birnbaum, M. J. (2000) Int. J. Obes. Relat. Metab. Disord. 24, Suppl. 4, S67S70
- Whiteman, E. L., Cho, H., and Birnbaum, M. J. (2002) Trends Endocrinol. Metab. 13, 444451[CrossRef][Medline]
[Order article via Infotrieve]
- Scheid, M. P., and Woodgett, J. R. (2003) FEBS Lett. 546, 108112[CrossRef][Medline]
[Order article via Infotrieve]
- Scheid, M. P., Marignani, P. A., and Woodgett, J. R. (2002) Mol. Cell. Biol. 22, 62476260[Abstract/Free Full Text]
- Murata, H., Hresko, R. C., and Mueckler, M. (2003) J. Biol. Chem. 278, 2160721614[Abstract/Free Full Text]
- Hresko, R. C., Murata, H., and Mueckler, M. (2003) J. Biol. Chem. 278, 2161521622[Abstract/Free Full Text]
- Stratford, S., DeWald, D. B., and Summers, S. A. (2001) Biochem. J. 354, 359368[CrossRef][Medline]
[Order article via Infotrieve]
- Summers, S. A., Whiteman, E. L., Cho, H., Lipfert, L., and Birnbaum, M. J. (1999) J. Biol. Chem. 274, 2385823867[Abstract/Free Full Text]
- Kohn, A. D., Kovacina, K. S., and Roth, R. A. (1995) EMBO J. 14, 42884295[Medline]
[Order article via Infotrieve]
- Watton, S. J., and Downward, J. (1999) Curr. Biol. 9, 433436[CrossRef][Medline]
[Order article via Infotrieve]
- Wick, M. J., Dong, L. Q., Riojas, R. A., Ramos, F. J., and Liu, F. (2000) J. Biol. Chem. 275, 4040040406[Abstract/Free Full Text]
- Summers, S. A., Kao, A. W., Kohn, A. D., Backus, G. S., Roth, R. A., Pessin, J. E., and Birnbaum, M. J. (1999) J. Biol. Chem. 274, 1793417940[Abstract/Free Full Text]
- Wang, L. P., and Summers, S. A. (2003) Methods Mol. Med. 83, 127136[Medline]
[Order article via Infotrieve]
- Summers, S. A., Lipfert, L., and Birnbaum. (1998) Biochem. Biophys. Res. Commun. 246, 7681[CrossRef][Medline]
[Order article via Infotrieve]
- Pallas, D. C., Shahrik, L. K., Martin, B. L., Jaspers, S., Miller, T. B., Brautigan, D. L., and Roberts, T. M. (1990) Cell 60, 167176[CrossRef][Medline]
[Order article via Infotrieve]
- Datta, K., Franke, T. F., Chan, T. O., Makris, A., Yang, S. I., Kaplan, D. R., Morrison, D. K., Golemis, E. A., and Tsichlis, P. N. (1995) Mol. Cell. Biol. 15, 23042310[Abstract]
- Kavran, J. M., Klein, D. E., Lee, A., Falasca, M., Isakoff, S. J., Skolnik, E. Y., and Lemmon, M. A. (1998) J. Biol. Chem. 273, 3049730508[Abstract/Free Full Text]
- Kohn, A. D., Takeuchi, F., and Roth, R. A. (1996) J. Biol. Chem. 271, 2192021926[Abstract/Free Full Text]
- Whiteman, E. L., Chen, J. J., and Birnbaum, M. J. (2003) Endocrinology 144, 38113820[Abstract/Free Full Text]
- Gray, A., Van Der Kaay, J., and Downes, C. P. (1999) Biochem. J. 344, 929936[CrossRef][Medline]
[Order article via Infotrieve]
- Zinda, M. J., Vlahos, C. J., and Lai, M. T. (2001) Biochem. Biophys. Res. Commun. 280, 11071115[CrossRef][Medline]
[Order article via Infotrieve]
- Bourbon, N. A., Sandirasegarane, L., and Kester, M. (2002) J. Biol. Chem. 277, 32863292[Abstract/Free Full Text]
- Salinas, M., Lopez-Valdaliso, R., Martin, D., Alvarez, A., and Cuadrado, A. (2000) Mol. Cell. Neurosci. 15, 156169[CrossRef][Medline]
[Order article via Infotrieve]
- Schubert, K. M., Scheid, M. P., and Duronio, V. (2000) J. Biol. Chem. 275, 1333013335[Abstract/Free Full Text]
- Zundel, W., and Giaccia, A. (1998) Genes Dev. 12, 19411946[Abstract/Free Full Text]
- Peraldi, P., Hotamisligil, G. S., Buurman, W. A., White, M. F., and Spiegelman, B. M. (1996) J. Biol. Chem. 271, 1301813022[Abstract/Free Full Text]
- Scheid, M. P., Lauener, R. W., and Duronio, V. (1995) Biochem. J. 312, 159162[Medline]
[Order article via Infotrieve]
- Filippa, N., Sable, C. L., Hemmings, B. A., and Van Obberghen, E. (2000) Mol. Cell. Biol. 20, 57125721[Abstract/Free Full Text]
- King, C. C., Zenke, F. T., Dawson, P. E., Dutil, E. M., Newton, A. C., Hemmings, B. A., and Bokoch, G. M. (2000) J. Biol. Chem. 275, 1810818113[Abstract/Free Full Text]
- Resjo, S., Goransson, O., Harndahl, L., Zolnierowicz, S., Manganiello, V., and Degerman, E. (2002) Cell. Signal. 14, 231238[CrossRef][Medline]
[Order article via Infotrieve]
- Dobrowsky, R. T., Kamibayashi, C., Mumby, M. C., and Hannun, Y. A. (1993) J. Biol. Chem. 268, 1552315530[Abstract/Free Full Text]
- Chalfant, C. E., Kishikawa, K., Mumby, M. C., Kamibayashi, C., Bielawska, A., and Hannun, Y. A. (1999) J. Biol. Chem. 274, 2031320317[Abstract/Free Full Text]
- Hannun, Y. (1994) J. Biol. Chem. 269, 31253128[Free Full Text]
- Hannun, Y. A., and Obeid, L. M. (1995) Trends Biochem. Sci. 20, 7377[CrossRef][Medline]
[Order article via Infotrieve]
- Jarvis, W. D., Grant, S., and Kolesnick, R. N. (1996) Clin. Cancer Res. 2, 16[Medline]
[Order article via Infotrieve]
- Mathias, S., Pena, L. A., and Kolesnick, R. N. (1998) Biochem. J. 335, 465480[Medline]
[Order article via Infotrieve]
- Hannun, Y. A., and Luberto, C. (2000) Trends Cell Biol. 10, 7380[CrossRef][Medline]
[Order article via Infotrieve]
- Dbaibo, G. S., Pushkareva, M. Y., Jayadev, S., Schwarz, J. K., Horowitz, J. M., Obeid, L. M., and Hannun, Y. A. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 13471351[Abstract/Free Full Text]
- Jayadev, S., Liu, B., Bielawska, A. E., Lee, J. Y., Nazaire, F., Pushkareva, M., Obeid, L. M., and Hannun, Y. A. (1995) J. Biol. Chem. 270, 20472052[Abstract/Free Full Text]
- Hannun, Y. A., and Obeid, L. M. (2002) J. Biol. Chem. 277, 2584725850[Free Full Text]
- Perry, D. K., and Hannun, Y. A. (1998) Biochim. Biophys. Acta 1436, 233243[Medline]
[Order article via Infotrieve]
- Ruvolo, P. P. (2003) Pharmacol. Res. 47, 383392[CrossRef][Medline]
[Order article via Infotrieve]
- Van Blitterswijk, W. J., Van Der Luit, A. H., Veldman, R. J., Verheij, M., and Borst, J. (2003) Biochem. J. 369, 199211[CrossRef][Medline]
[Order article via Infotrieve]
- Virshup, D. M. (2000) Curr. Opin. Cell Biol. 12, 180185[CrossRef][Medline]
[Order article via Infotrieve]
- Zolnierowicz, S. (2000) Biochem. Pharmacol. 60, 12251235[CrossRef][Medline]
[Order article via Infotrieve]
- Shima, H., Tohda, H., Aonuma, S., Nakayasu, M., DePaoli-Roach, A. A., Sugimura, T., and Nagao, M. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 92679271[Abstract/Free Full Text]
- Johannessen, M., Olsen, P. A., Johansen, B., Seternes, O. M., and Moens, U. (2003) Biochem. Pharmacol. 65, 13171328[CrossRef][Medline]
[Order article via Infotrieve]

CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
W. L. Holland and S. A. Summers
Sphingolipids, Insulin Resistance, and Metabolic Disease: New Insights from in Vivo Manipulation of Sphingolipid Metabolism
Endocr. Rev.,
June 1, 2008;
29(4):
381 - 402.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Langeveld, K. J. M. Ghauharali, H. P. Sauerwein, M. T. Ackermans, J. E. M. Groener, C. E. M. Hollak, J. M. Aerts, and M. J. Serlie
Type I Gaucher Disease, a Glycosphingolipid Storage Disorder, Is Associated with Insulin Resistance
J. Clin. Endocrinol. Metab.,
March 1, 2008;
93(3):
845 - 851.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J.-a Kim, Y. Wei, and J. R. Sowers
Role of Mitochondrial Dysfunction in Insulin Resistance
Circ. Res.,
February 29, 2008;
102(4):
401 - 414.
[Abstract]
[Full Text]
[PDF]
|
 |
|