Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M405205200 on June 18, 2004

J. Biol. Chem., Vol. 279, Issue 35, 36708-36714, August 27, 2004
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
279/35/36708    most recent
M405205200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yang, X. F.
Right arrow Articles by Reitzer, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yang, X. F.
Right arrow Articles by Reitzer, L.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Phosphorylation-independent Dimer-Dimer Interactions by the Enhancer-binding Activator NtrC of Escherichia coli

A THIRD FUNCTION FOR THE C-TERMINAL DOMAIN*

Xiaofeng F. Yang§, Youngran Ji, Barbara L. Schneider, and Larry Reitzer||

From the Molecular and Cell Biology Department, University of Texas at Dallas, Richardson, Texas 75083-0688

Received for publication, May 10, 2004 , and in revised form, June 10, 2004.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
The response regulator NtrC transcriptionally activates genes of the nitrogen-regulated (Ntr) response. Phosphorylation of its N-terminal receiver domain stimulates an essential oligomerization of the central domain. Deletion of the central domain reduces, but does not eliminate, intermolecular interactions as assessed by cooperative binding to DNA. To analyze the structural determinants and function of this central domain-independent as well as phosphorylation-independent oligomerization, we randomly mutagenized DNA coding for an NtrC without its central domain and isolated strains containing NtrC with defective phosphorylation-independent cooperative binding. The alterations were primarily localized to helix B of the C-terminal domain. Site-specific mutagenesis that altered surface residues of helix B confirmed this localization. The purified NtrC variants, with or without the central domain, were specifically defective in phosphorylation-independent cooperative DNA binding and had little defect, if any, on other functions, such as non-cooperative DNA binding. We propose that this region forms an oligomerization interface. Full-length NtrC variants did not efficiently repress the glnA-ntrBC operon when NtrC was not phosphorylated, which suggests that phosphorylation-independent cooperative binding sets the basal level for glutamine synthetase and the regulators of the Ntr response. The NtrC variants in these cells generally, but not always, supported wild-type growth in nitrogen-limited media and wild-type activation of a variety of Ntr genes. We discuss the differences and similarities between the NtrC C-terminal domain and the homologous Fis, which is also capable of intermolecular interactions.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Nitrogen-limited growth induces about 100 nitrogen-regulated (Ntr)1 genes in Escherichia coli, whose products assimilate ammonia, scavenge nitrogen-containing compounds, and integrate nitrogen assimilation with other metabolic processes (1, 2). Low intracellular glutamine signals nitrogen deficiency, which through a cascade of regulators, results in phosphorylation of the response regulator NtrC (also called nitrogen regulator I or NRI) by the sensor kinase NtrB (also called nitrogen regulator II or NRII) (2). NtrC~P can activate transcription when bound to sites that are a considerable distance from the start site of transcription (3). NtrC~P interacts with {sigma}54-containing RNA polymerase. This interaction can require or be facilitated by auxiliary DNA-bending proteins such as integration host factor or ArgR (4–6).

NtrC has three domains (7, 8). The 120-residue N-terminal domain (NTD) is homologous to receiver domains found in response regulators (9). Its structure, with and without phosphorylation, has been thoroughly analyzed by Kustu and co-workers (10–13). Phosphorylation results in movement of the NTD 3445 face (from {alpha}-helix 3 to {beta}-strand 5), which exposes a hydrophobic surface that has been proposed to interact with the central domain and stimulate its activities. The ~230-residue central domain mediates a phosphorylation-dependent oligomerization that is required for transcriptional activation (14–18). The central domain hydrolyzes ATP, which is required for productive open promoter complex formation and which oligomerization stimulates (19–22). The central domain also interacts with RNA polymerase (23). A structure has been presented for the central domain of one NtrC-like protein (24). The ~80-residue C-terminal domain (CTD) contains DNA-binding and dimerization determinants (23, 25, 26). The structure of the NtrC CTD from Salmonella enterica has been determined (27).

Biochemical evidence indicates a presumably stimulatory interaction between the 3445 face of phosphorylated NTD of NtrC and small peptides of the central domain (10). In addition, genetic evidence suggests a potentially inhibitory interaction between {alpha}-helix 5 of the NTD and the central domain, which phosphorylation may alter (28). In contrast, it has been proposed that phosphorylation of the NTD of Rhizibial DctD impairs a dimerization between two {alpha}-helix 5s, which stimulates central domain activities (29, 30). The proposed dimerization determinants of the NTD of DctD are not found in NtrC. Nonetheless, an in vivo protein-protein interaction study suggests that NTDs of NtrC have the potential to dimerize (31). Though details of the activation mechanism may differ, a common theme of NtrC-like proteins is that the phosphorylation of NTD probably exposes or stabilizes (or both) oligomerization determinants of the central domain (28).

One manifestation of this oligomerization is cooperative binding to DNA. We previously showed that deletion of the central domain abolishes phosphorylation-stimulated cooperative binding, but did not eliminate cooperative binding (16). We refer to the residual cooperative binding as phosphorylation-independent. The goals of this work were to determine the domain, structural determinants, and function of phosphorylation-independent cooperative binding.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Strains and Plasmids—Strains used for mutant isolation and enzyme assays were derivatives of the Escherichia coli K-12 strain W3110 (lacIq lacL8) and are listed in Table I. All lacZ fusions are single copy on the chromosome. The strains were constructed using previously described methods (32, 33). Plasmid pXY11 is the parental plasmid for mutagenesis of ntrC alleles. It is equivalent to the pBR322-derived pCB12 (26), except that DNA coding for residues 135–136 has been changed from GGC CCA to GGG CCC, which introduces an ApaI site but does not affect the amino acid sequence. The ntrC allele also contains a deletion of the central domain from residues 143 to 398. pXY12 is a variant of pXY11, which contains full-length wild-type ntrC. Full-length versions of pXY11 derivatives were generated by inserting an ApaI-Eco47III fragment from pXY12 (which contains DNA from codons 136 to 411) into pXY11 derivatives cut with ApaI and Eco47III.


View this table:
[in this window]
[in a new window]
  		TABLE I
Strains

 
Cell Growth and Enzyme Assays—The minimal growth medium contained W salts, 0.4% of the carbon source, 0.2% of each nitrogen source, and 0.02% thiamine (34). Assays for glutamine synthetase and {beta}-galactosidase were performed as described (34, 35). Units are nmol of product min–1 mg protein–1, unless otherwise specified.

Isolation of Mutants with NtrC Defective in Cooperative DNA Binding—The strategy for mutant isolation is described under "Results." The region encoding the ntrC gene in plasmid pXY11 was mutagenized by a PCR-based method (36), except that 0.1 µM MnCl2 and 4 mM MgCl2 were included in the buffer. The resulting PCR fragments were digested with PflM1 and EcoRI and the ntrC-containing fragments (from codon 15 to about 200 bases past the stop codon) were subcloned into unmutagenized pXY11. The ligation mixture was transformed into LR20. About 1% of the transformants were glutamine prototrophs on glycerol-ammonia minimal medium plates. The prototrophs were then screened for repression of the ntrB promoter by a qualitative {beta}-galactosidase assay. Cells were resuspended into wells of a 96-well plate that contained 100 µl of Z buffer (35), 1 mg/ml sodium deoxycholate, and 0.2 mg/ml hexadecyltrimethylammonium bromide. Cells were permeabilized by incubation for 5 min at 30 °C. The reaction was initiated with 25 µl of 4 mg/ml o-nitrophenol-{beta}-D-galactoside, stopped with 100 µlof1 M Na2CO3, and color development examined visually.

Site-specific Mutagenesis—Plasmid pXY12 was used as a template for megaprimer mutagenesis (37). The primer sequences of the forward and reverse primers were GCGCTGAATATGGCAGCTATCCCA and CGTATCACGAGGCCCTTT, respectively. The sequences of the mutagenic oligonucleotide for NtrC-R431A, NtrC-S423A, and NtrC-T435A were 5'-GAGCTGGAGGCGACGTTACTGACG, 5'-AAATCTGCTAGCGGAAGCGCAGC, and 5'-GACGTTACTCGCGACCGCGTTGC, respectively. Mismatched sites are underlined.

Purification of NtrC Variants—NtrC variants were overexpressed using a phage T7 RNA polymerase expression system, and purified as previously described (16, 38). In brief, the strain for overexpression was BL21 ({lambda}DE3)/pLysE with ntrC alleles cloned into derivatives of pCB5, itself a derivative of pT7-7, which contains a T7 promoter preceding ntrC. Various ntrC alleles were subcloned into pCB5 by swapping PflMI-EcoRI fragments; the PflMI site is 50 bases downstream from the 5'-end of ntrC, while the EcoRI site is about 200 bases downstream from the 3'-end. Cells were lysed by sonication, and ribosomes removed by streptomycin precipitation. The NtrC variant proteins were precipitated with 40% ammonium sulfate, bound to and eluted from an heparin-Sepharose column, reprecipitated with ammonium sulfate, dialyzed in a pH 7.5 storage buffer (20 mM HEPES, 1 mM dithiothreitol, 1 mM EDTA, and 40% glycerol) and stored at –80 °C.

DNase I Footprinting—Assays were performed as previously described (6, 16). For binding to site 2 of the glnA regulatory region, we used a 1.6-kb EcoRI-PstI fragment from pCB37, which contains sequences from –122 to –92 (16). For binding to site 2 of the glnA regulatory region in the presence of site 1, we used a 153-bp EcoRI-PstI fragment from pVW7, which contains sequences from –189 to –92 (16). For binding to the ast promoter, we used a 442-bp EcoRI-PstI fragment from pUC-astp(+), which contains sequences from +103 to –298 of the ast promoter cloned into the HincII site of pUC18 (6).

In Vitro Transcription—The basic procedures have been described (39, 40). All concentrations (for glnA and ast transcription) are final concentrations in the 25-µl reaction. Transcription from the glnA promoter was measured using pTH8, which has a T7 terminator about 300 bases downstream from the transcription start site (41). Single round in vitro transcription reaction mixtures contained, in a final volume of 25 µl, transcription buffer (50 mM Tris-HCl, pH 7.5, 100 mM KCl, 10 mM MgCl2, 1 mM dithiothreitol), 10 nM supercoiled plasmid pTH8, 1 unit of RNase inhibitor (Amersham Biosciences), 4 mM ATP, 0.5 mM GTP, 0.5 mM CTP, 0.1 mM UTP, 10 µCi [{alpha}-32P]UTP, 6 mg/ml heparin, 100 nM E. coli RNA core polymerase (Epicenter Technologies Inc.), 300 nM {sigma}54, various concentrations of NtrC, and 100 nM NtrB. The components were added in transcription buffer in the following sequence. DNA, RNase inhibitor, and RNA polymerase (core plus sigma) were incubated for 5 min at 37 °C. NtrC and NtrB were then added, and the mixture incubated for 5 min at 37 °C. ATP (4 mM) was added to phosphorylate NtrC and permit open complex formation, and the mixture incubated for 10 min. Finally, we added a 4.5-µl mixture containing heparin and the remaining nucleotides, and the resulting mixture was incubated for 10 min. The reaction was stopped by adding 25 µl of stop buffer (50 mM EDTA and 100 µg/ml bakers' yeast tRNA). The sample was extracted with phenol twice, and 40 µl was mixed with 15 µl of loading dye (95% formamide, 20 mM EDTA, 0.05% bromphenol blue, and 0.05% xylene cyanol FF). The sample was heated to 90 °C for 3 min, centrifuged briefly, and 30 µl were subjected to electrophoresis in a 5% polyacrylamide-8 M urea gel.

The protocol for transcription from the ast promoter was essentially the same as described above, except that the DNA template was plasmid pAK10 (6), arginine (5 mM) was added with the DNA, and ArgR (300 nM) was added with NtrB.

ATPase Activity—The ATPase assay was based on measurement of ADP (42). A 100-µl reaction mixture contained 50 mM Tris-HCl, pH 7.5, 100 mM KCl, 10 mM MgCl2, 1 mM dithiothreitol, 0.1 mM EDTA, 1.3 mM phosphoenolpyruvate, 35 units of lactate dehydrogenase (rabbit muscle), 50 units of pyruvate kinase (rabbit muscle), 0.2 mM NADH, and 500 nM NtrC. When appropriate, the reaction mixture also contained 25 mM of acetyl phosphate, which phosphorylates NtrC, and 10 nM of supercoiled pVW7, which contains the entire glnA promoter region. The reaction mixtures were preincubated for 10 min at 37 °C. ATP (1 mM final concentration) addition started the reaction. NADH concentration was measured spectrophotometrically at 340 nm.

In Vitro Phosphorylation and Dephosphorylation—For the phosphorylation reaction, 38 µl of solution A (40 nM NtrB, 1x transcription buffer (described above), 0.1 mg/ml of bovine serum albumin, and 12.5 µM/15 µCi of [{gamma}-32P]ATP) and 38 µl of solution B (4 µM NtrC, 1x transcription buffer, and 0.1 mg/ml of bovine serum albumin) were each preincubated for 10 min at 37 °C. These solutions were mixed and incubated for another 10 min. For the dephosphorylation reaction, 4 µl of unlabeled ATP (10 mM final concentration) were added to the reaction. 10-µl samples were taken at various times and mixed with an equal amount of stop buffer (pH 6.8) containing 10 mM EDTA, 2% SDS, 0.6% Tris-HCl, 10% glycerol, 0.1% dithiothreitol, 0.01% bromphenol blue. Total samples were loaded on a 10% polyacrylamide gel without heating, the gel placed in a phosphorimager cassette, and the bands quantified using a phosphorimager program (Molecular Dynamics).


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
Isolation and Characterization of Mutants Defective in Repressing the glnAp1 Promoter—To analyze phosphorylation-independent cooperative DNA binding, we studied a strain with NtrC-{Delta}Cen, which lacks the central domain that is required for phosphorylation-dependent oligomerization. NtrC-{Delta}Cen cannot activate transcription from the {sigma}54-dependent glnAp2 promoter, but can still repress the {sigma}70-dependent glnAp1 promoter (26). Two NtrC sites overlap the glnAp1 promoter, and NtrC-{Delta}Cen binds cooperatively (without phosphorylation) to these sites, and if it is the only form of NtrC present, then it results in glutamine auxotrophy (16). We mutated plasmid DNA coding for NtrC-{Delta}Cen, and isolated mutants with defective repression of glnAp1 by a two-step procedure (Fig. 1). First, we isolated about 1000 glutamine prototrophs. Second, to eliminate those mutants in which NtrC does not bind DNA, we screened for mutants in which NtrC-{Delta}Cen normally repressed the ntrB promoter (ntrBp). ntrBp contains a single binding site for NtrC, and, coincidently, NtrC binds with the same affinity to the two-site glnAp1 operator and the single site ntrB operator (15). To assess transcription from ntrBp, we performed qualitative {beta}-galactosidase assays from cells containing an ntrB-lacZ fusion integrated into the {lambda} attachment site. Only three prototrophic transformants had {beta}-galactosidase qualitatively similar to that found in cells with unmutagenized plasmid. Sequencing the mutated ntrC alleles indicated the following amino acid substitutions: A413V, P427L, and A437V. To further verify the mutant phenotype, we quantified expression from the glnAp1 and ntrB promoters. The three mutants had derepressed glutamine synthetase and normal {beta}-galactosidase, which was expected from the plate phenotypes (Table II).



View larger version (27K):
[in this window]
[in a new window]
  		FIG. 1.
Two-step procedure for isolating cooperative binding mutants. The strategy was based on the assumption that a cooperative binding mutant would have reduced binding to two adjacent sites of the glnAp1 operator, while maintaining normal binding to a single site of the ntrB operator. Each symbol representing NtrC (ovals or circles) indicates a monomer. Dimers bind each site, and cooperative binding is between two dimers. Dimeric NtrC without the central domain represses the glnAp1 promoter, causing glutamine auxotrophy. We selected for glutamine prototrophs, which must be the result of diminished binding. To distinguish between mutants in which NtrC fails to bind DNA and those in which NtrC binds less well cooperatively but normally to a single site (i.e. noncooperatively), we then screened for mutants with normal repression of {beta}-galactosidase activity in strains with an ntrB-lacZ fusion.

 


View this table:
[in this window]
[in a new window]
  		TABLE II
Repression of glnAp1 and ntrBp promoters by NtrC variants

Enzyme activities are expressed as percent of activity in cells without NtrC. 100% glutamine synthetase and {beta}-galactosidase were ~600 and ~800 units, respectively. The values are the averages of at least three determinations ± S.D.

 
We cloned the DNA fragment coding for the central domain back into the mutated ntrC alleles and examined the phenotype of cells with these proteins. We introduced these full-length ntrC alleles into strain XY12 (rpoN), which cannot activate glnA expression from the nitrogen-regulated glnAp2 promoter. We grew these cells in ammonia-containing minimal medium, which minimizes phosphorylation of NtrC. Cells with wild-type NtrC were glutamine auxotrophs, but cells with the mutant alleles were prototrophs. Glutamine synthetase activity indicated that the full-length variants did not repress glnAp1 as well as wild-type NtrC, while {beta}-galactosidase activity indicated that the variants and wild-type NtrC repressed ntrBp equally well (Table II). In other words, cells with the full-length variants had the same phenotype as cells with the NtrC-{Delta}Cen variants with respect to repression of the glnAp1 and ntrB promoters.

Alteration of Surface Residues of the B-helix of the C-terminal Domain—All three alterations were located in the NtrC CTD. The NtrC CTD from S. enterica, which shares 100% sequence identity with the NtrC CTD from E. coli, consists of four {alpha}-helices (27). Helices A (residues 402–414) and B (residues 421–440) participate in dimerization, while helices C (residues 446–451) and D (residues 456–468) form the DNA-binding helix-turn-helix (Fig. 2). All three altered residues were located in helices A and B. We hypothesized that surface residues in these helices, i.e. those that face away from the dimerization surface, might contribute to phosphorylation-independent cooperative DNA binding. To test this hypothesis, we changed three residues in the B helix, serine 423, arginine 431, and threonine 435, to alanine and examined the effect of these alterations. The mutations were placed in alleles that coded for full-length proteins. Cells with NtrC-S423A were glutamine auxotrophs and had wild-type levels of glutamine synthetase and {beta}-galactosidase (not shown). However, cells with NtrC-R431A and NtrC-T435A were glutamine prototrophs and had the same glutamine synthetase and {beta}-galactosidase activities found in the mutants isolated after random mutagenesis (Table II). Therefore, cells with alterations in surface residues of the CTD B-helix can result in the desired phenotype (Fig. 2).



View larger version (55K):
[in this window]
[in a new window]
  		FIG. 2.
Structure of the CTD and location of alterations that impair phosphorylation-independent cooperative DNA binding. Scheme (A) and surface representation (B) of the structure of CTD of NtrC from S. typhimurium are presented. The two monomers are shown either in magenta (front) or yellow (back). The residues with alterations are labeled with arrows and are highlighted either in blue (front) or in green (back).

 
The Binding of Purified NtrC Variants to DNA—To more directly demonstrate a defect in phosphorylation-independent cooperative DNA binding, we characterized the binding of purified NtrC-P427L, NtrC-R431A, and NtrC-T435A to DNA by quantitative DNaseI footprinting. We assayed binding to sites in the regulatory region for the glnA-ntrBC operon. Wild-type and variant NtrCs (without phosphorylation) bound equally well to a single site, site 2, of the glnA regulatory region (Fig. 3A). This is consistent with {beta}-galactosidase activity in strains with a ntrB-lacZ fusion (Table II). To assess cooperative binding, we assayed the binding to site 2 in the presence of the adjacent site 1 (Fig. 3B). 50% occupancy of site 2 required 10 nM wild-type NtrC, but 20–30 nM for the NtrC variants. Therefore, these three NtrC variants are defective in phosphorylation-independent cooperative DNA binding, which we equate with a defect in phosphorylation-independent oligomerization.



View larger version (15K):
[in this window]
[in a new window]
  		FIG. 3.
DNA binding of the NtrC variants to site 2 of the glnA regulatory region. The percentage of occupancy at site 2 of the glnAp1 promoter was calculated from DNaseI footprinting assays as described under "Experimental Procedures." A, DNA template contains only site 2. B, DNA template contains both site 1 and site 2.

 
Nitrogen Source Utilization and Ntr Gene Expression—All the mutants grew normally (no greater than 15% slower than wild type) with ammonia, alanine, glutamine, or putrescine as the nitrogen source (not shown). In contrast, mutants with NtrC-P427L or NtrC-R431A, but not other variants, grew twice as slow with arginine as the nitrogen source (Fig. 4).



View larger version (15K):
[in this window]
[in a new window]
  		FIG. 4.
Utilization of arginine as a nitrogen source. Each value is the average of three determinations with the standard error of the mean indicated.

 
We also examined expression in vivo from the following Ntr operons: astCADBE, glnA-ntrBC, glnHPQ, nac, and ygjG. glnHPQ codes for components of a high affinity glutamine transport system (43, 44); nac for a regulator of several Ntr genes (44); and ygjG for putrescine transaminase (45, 46). The promoters for these operons, except for glnA-ntrBC, were fused to lacZ and expressed on the chromosome. glnA-ntrBC expression was assessed by assay of glutamine synthetase, the product of the first gene. Expression of glnA-ntrBC, glnHPQ, and nac was normal for strains with each variant (not shown). Expression of ygjG was essentially the same for cells with wild-type NtrC, NtrC-S423A (which has no defect), NtrC-A413V, NtrC-T435A, and NtrC-A437V (Fig. 5A). Expression was modestly lower in cells with NtrC-P427L, and 2-fold lower with NtrC-R431A (Fig. 5A). These differences did not affect growth with putrescine as a nitrogen source, which was expected since the major pathway of putrescine catabolism is not under Ntr control,2 and deletion of ygjG does not significantly impair such growth (46). Expression of the ast promoter in vivo was more complex. Cells with wild-type NtrC, NtrC-S423A, NtrC-A413V, NtrC-T435A, and NtrC-A437V had essentially the same expression (Fig. 5B). However, cells with NtrC-P427L or NtrC-R431A had ~2-fold lower expression (Fig. 5B), which correlates well with growth rates.



View larger version (19K):
[in this window]
[in a new window]
  		FIG. 5.
Ntr gene expression in strain with NtrC variants. Cells were grown in glucose putrescine medium, which allows maximal induction of Ntr genes. {beta}-Galactosidase activity was measured from cells containing ygjG-lacZ (A) and astC-lacZ (B) fusions. Each value is the average of three determinations ± S.D.

 

In summary, the variants generally had little effect on nitrogen source utilization or expression of five different Ntr genes. However, the alterations in NtrC-P427L and NtrC-R431A modestly affected growth with arginine and expression of the ygjG and astCADBE operons.

Transcription of glnA and astCADBE with Purified NtrC Variants—To further confirm that the variants were not affected in their ability to activate Ntr genes, we examined transcription with purified components from promoters of the glnA-ntrBC and astCADBE operons. NtrC-P427L activated transcription from the glnAp2 promoter as well as wild-type NtrC (Fig. 6). NtrC-R431A and NtrC-T435A activated transcription slightly less well than wild-type NtrC, especially at the lower protein concentrations (Fig. 6). In contrast, all three variants were significantly impaired in their ability to initiate transcription from the ast promoter (Fig. 7). This result is not consistent with the growth of cells with NtrC-T435A, which grew normally, or cells with NtrC-P427L or NtrC-R431A, which grew only twice as slow as wild-type cells with arginine as the nitrogen source (Fig. 4).



View larger version (26K):
[in this window]
[in a new window]
  		FIG. 6.
Transcription from glnAp2 by NtrC variants in vitro. A, autoradiography of the 308-base transcript from the glnAp2 promoter. B, quantitation of the intensity of the transcripts. The intensity of the each band was quantified using a phosphorimager. The intensity of the band from the sample with 200 nM wild-type NtrC was defined as 100%.

 



View larger version (22K):
[in this window]
[in a new window]
  		FIG. 7.
Transcription from the ast promoter by NtrC variants in vitro. A, autoradiography of the 300-base transcript from the {sigma}54-dependent ast promoter. B, quantitation of the intensity of the transcripts. The intensity of the each band was quantified using a phosphorimager with the intensity of the band from the sample with 400 nM wild-type NtrC defined as 100%.

 
Characterization of NtrC-P427L—The preceding results indicate that loss of phosphorylation-independent oligomerization generally has minimal effects in vivo. Nonetheless, the diminished transcription in vitro, at least for the astCADBE operon, suggests the potential to affect Ntr gene expression. It is possible (perhaps likely) that the conditions in the reconstituted system do not accurately reflect conditions inside the cell. It is also possible that the variants are affected in properties other than phosphorylation-independent oligomerization.

To explore the latter possibility, we further characterized the properties of purified NtrC-P427L, which is modestly impaired in its ability to activate Ntr gene in vivo. Phosphorylation of NtrC is required for transcriptional activation. Purified wild-type NtrC and NtrC-P427L had identical levels of steady-state phosphorylation (not shown), and the phosphorylation was equally stable for both proteins (not shown). Phosphorylation stimulates ATPase activity, which is required for transcriptional activation. Phosphorylation stimulated ATPase activity of NtrC-P427L (Fig. 8A). Phosphorylated NtrC-P427L and wild-type NtrC had essentially identical ATPase activity (Fig. 8A). Curiously, the variant had one-third less phosphorylation-independent activity (Fig. 8A). Perhaps this activity, which is not required for transcriptional activity, depends on phosphorylation-independent oligomerization.



View larger version (14K):
[in this window]
[in a new window]
  		FIG. 8.
Properties of purified NtrC-P427L. A, ATPase activity. B, quantitative DNase I footprinting of phosphorylated NtrC to the ast promoter.

 
Phosphorylation stimulates central domain-mediated oligomerization which appears to complete the structure of the ATPase active site (24). Such oligomerization can be detected by cooperative binding to DNA, which we assessed at two Ntr promoters. Phosphorylation reduced the concentration of unphosphorylated wild-type NtrC required for 50% occupancy of site 2 of the glnA regulatory region (in the presence of site 1) from 10 (Fig. 3B) to 4.1 nM (not shown), which was expected. The phosphorylated NtrC-P427L variant bound to site 2 (with site 1) as well as phosphorylated wild-type NtrC (not shown). In other words, phosphorylation-dependent cooperative binding obscured the defect in phosphorylation-independent cooperative binding at the glnA regulatory region (Fig. 3B). The promoter of the astCADBE operon has two weak NtrC binding sites upstream of the start site of transcription. Half-maximal occupancy at this promoter requires about 10 times more phosphorylated wild-type NtrC than at the glnA promoter (6). Half-maximal occupancy required three times more phosphorylated NtrC-P427L than phosphorylated wild-type NtrC (Fig. 8B). This defect correlates reasonably well with diminished growth (Fig. 4) and astCADBE expression in vivo (Fig. 5B).

We conclude that the properties of NtrC-P427L are essentially normal, except for phosphorylation-independent cooperative DNA binding in the glnA regulatory region (Fig. 3B), phosphorylation-dependent cooperative binding to weak sites of the ast promoter (Fig. 8B), and in vitro transcription from the ast promoter (Fig. 7).


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
Structural Determinants of Phosphorylation-independent Cooperative Binding—Our genetic analysis indicates that phosphorylation-independent oligomerization (a property deduced from cooperative binding to DNA) is a function of the CTD, which establishes a third function for the ~80-residue CTD. The other two functions of the CTD are binding to DNA and dimerization. Substitutions of alanine 413, proline 427, arginine 431, threonine 435, and alanine 437 affected CTD-mediated oligomerization. Alanine 413 is located in helix A, while the other amino acids are in helix B (Fig. 2). The A413V substitution generates a side chain that may protrude into the interaction region and impair the interaction. This is insufficient to suggest that the small alanine 413 residue directly participates in the interaction. Proline 427 introduces a 14 (±3)° kink (27), which is difficult to show in a ribbon diagram. Nonetheless, the P427L substitution probably changes the direction of the B-helix after proline-427. The possible alterations in the position of several side chains may explain why the P427L substitution has the greatest effect on expression of some Ntr genes. The R431A and T435A substitutions reduce the size of the amino acid side chains. It is possible that arginine 431 and threonine 435 directly participate in oligomerization. The A437V substitution is not obviously consistent with the proposed interaction interface. However, the increased side chain length may indirectly interfere with oligomerization. Based on the locations of these residues, we propose that several outward-facing residues of helix B form a surface that interacts with an adjacent dimer (Fig. 2B). Our results do not exclude the possibility that helix A also contributes to this oligomerization.

Function of Phosphorylation-independent Cooperative Binding—The primary phenotype of strains with defective phosphorylation-independent oligomerization is derepressed transcription from the glnAp1 promoter (Table I). Such repression is only apparent in the absence of transcription from glnAp2, that is, in nitrogen sufficient environments when NtrC is not phosphorylated. This repression sets the basal level of glnA-ntrBC expression and the regulators of the Ntr response (NtrB and NtrC) during nitrogen-sufficient growth. The greater wild-type repression may impede inappropriate induction of {sigma}54-dependent Ntr genes, which may occur in environments with fluctuating nitrogen availability.

Phosphorylation-dependent cooperative binding in the glnA regulatory region completely obscured the defect in NtrC-P427L. Nonetheless, two variants had 2-fold diminished ygjG and astCADBE expression (Fig. 5, A and B). The diminished expression in vivo may reflect alterations in the structure of the multimeric activation complex. The impaired expression of the ast operon correlates well with 3-fold diminished DNA binding (Fig. 8B), but not with the dramatic effect on reconstituted transcription from the ast promoter (Fig. 7). The in vitro transcription assays were not optimized for the NtrC variants and may exaggerate the defect in DNA binding. Nonetheless, it appears that phosphorylation-independent oligomerization can modestly contribute to Ntr gene expression at promoters that bind NtrC poorly.

Fis and the NtrC CTD—The NtrC CTD is homologous to the 98-amino acid Fis (factor for inversion stimulation) (27, 47). Phylogenetic analysis implies that Fis is derived from an {alpha} proteobacterial NtrC (48). The structures of Fis and the NtrC CTD are similar with minor differences in the length of helix A, the position of proline in helix B, and the distances between the DNA-binding helix-turn-helix regions (27). Like the NtrC CTD, Fis can participate in intermolecular interactions. Fis interacts with RNA polymerase and the Hin recombinase (49, 50). Curiously, a proline to leucine alteration in helix B of Fis eliminates the Hin-mediated inversion, but has no effect on DNA binding (51). This is strikingly similar to the P427L substitution in NtrC, which eliminates the homologous intermolecular interaction, but does not affect DNA binding (to a single site). Even though the regions of Fis and NtrC involved in intermolecular interactions are not the same (50, 52), the very existence of such intermolecular interactions in Fis further confirms the assignment of such a function to the NtrC CTD.


   FOOTNOTES
 
* The work was supported by Grants MCB-0323931 from the National Science Foundation and GM47965 from the National Institutes of Health. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

§ Current address: Dept. of Microbiology, The University of Texas Southwestern Medical Center, Dallas, TX 75390-9048. Back

Current address: Dept. of Surgery, Stanford University, Stanford, CA 94305-5492. Back

|| To whom correspondence should be addressed. Tel.: 972-883-2502; Fax: 972-883-2409; E-mail: reitzer{at}utdallas.edu.

1 The abbreviations used are: Ntr, nitrogen-regulated; NTD, N-terminal domain; CTD, C-terminal domain. Back

2 B. Schneider and L. Reitzer, unpublished observation. Back



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Zimmer, D. P., Soupene, E., Lee, H. L., Wendisch, V. F., Khodursky, A. B., Peter, B. J., Bender, R. A., and Kustu, S. (2000) Proc. Natl. Acad. Sci. U. S. A. 97, 14674–14679[Abstract/Free Full Text]
  2. Reitzer, L. (2003) Annu. Rev. Microbiol. 57, 155–176[CrossRef][Medline] [Order article via Infotrieve]
  3. Reitzer, L. J., and Magasanik, B. (1986) Cell 45, 785–792[CrossRef][Medline] [Order article via Infotrieve]
  4. Hoover, T. R., Santero, E., Porter, S., and Kustu, S. (1990) Cell 63, 11–22[CrossRef][Medline] [Order article via Infotrieve]
  5. Lu, C. D., and Abdelal, A. T. (1999) J. Bacteriol. 181, 1934–1938[Abstract/Free Full Text]
  6. Kiupakis, A. K., and Reitzer, L. (2002) J. Bacteriol. 184, 2940–2950[Abstract/Free Full Text]
  7. North, A. K., Klose, K. E., Stedman, K. M., and Kustu, S. (1993) J. Bacteriol. 175, 4267–4273[Free Full Text]
  8. Bantscheff, M., Weiss, V., and Glocker, M. O. (1999) Biochemistry 38, 11012–11020[CrossRef][Medline] [Order article via Infotrieve]
  9. Stock, A. M., Robinson, V. L., and Goudreau, P. N. (2000) Annu. Rev. Biochem. 69, 183–215[CrossRef][Medline] [Order article via Infotrieve]
  10. Hastings, C. A., Lee, S. Y., Cho, H. S., Yan, D., Kustu, S., and Wemmer, D. E. (2003) Biochemistry 42, 9081–9090[CrossRef][Medline] [Order article via Infotrieve]
  11. Cho, H. S., Pelton, J. G., Yan, D., Kustu, S., and Wemmer, D. E. (2001) Curr. Opin. Struct. Biol. 11, 679–684[CrossRef][Medline] [Order article via Infotrieve]
  12. Kern, D., Volkman, B. F., Luginbuhl, P., Nohaile, M. J., Kustu, S., and Wemmer, D. E. (1999) Nature 402, 894–898[Medline] [Order article via Infotrieve]
  13. Yan, D., Cho, H. S., Hastings, C. A., Igo, M. M., Lee, S. Y., Pelton, J. G., Stewart, V., Wemmer, D. E., and Kustu, S. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 14789–14794[Abstract/Free Full Text]
  14. Weiss, V., Claverie-Martin, F., and Magasanik, B. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 5088–5092[Abstract/Free Full Text]
  15. Porter, S. C., North, A. K., Wedel, A. B., and Kustu, S. (1993) Genes Dev. 7, 2258–2273[Abstract/Free Full Text]
  16. Chen, P., and Reitzer, L. J. (1995) J. Bacteriol. 177, 2490–2496[Abstract/Free Full Text]
  17. Flashner, Y., Weiss, D. S., Keener, J., and Kustu, S. (1995) J. Mol. Biol. 249, 700–713[CrossRef][Medline] [Order article via Infotrieve]
  18. Wyman, C., Rombel, I., North, A. K., Bustamante, C., and Kustu, S. (1997) Science 275, 1658–1661[Abstract/Free Full Text]
  19. Rombel, I., Peters-Wendisch, P., Mesecar, A., Thorgeirsson, T., Shin, Y. K., and Kustu, S. (1999) J. Bacteriol. 181, 4628–4638[Abstract/Free Full Text]
  20. Weiss, D. S., Batut, J., Klose, K. E., Keener, J., and Kustu, S. (1991) Cell 67, 155–167[CrossRef][Medline] [Order article via Infotrieve]
  21. Mettke, I., Fiedler, U., and Weiss, V. (1995) J. Bacteriol. 177, 5056–5061[Abstract/Free Full Text]
  22. Wedel, A., and Kustu, S. (1995) Genes Dev. 9, 2042–2052[Abstract/Free Full Text]
  23. Morett, E., and Segovia, L. (1993) J. Bacteriol. 175, 6067–6074[Free Full Text]
  24. Lee, S. Y., De La Torre, A., Yan, D., Kustu, S., Nixon, B. T., and Wemmer, D. E. (2003) Genes Dev. 17, 2552–2563[Abstract/Free Full Text]
  25. Klose, K. E., North, A. K., Stedman, K. M., and Kustu, S. (1994) J. Mol. Biol. 241, 233–245[CrossRef][Medline] [Order article via Infotrieve]
  26. Shiau, S. P., Chen, P., and Reitzer, L. J. (1993) J. Bacteriol. 175, 190–199[Abstract/Free Full Text]
  27. Pelton, J. G., Kustu, S., and Wemmer, D. E. (1999) J. Mol. Biol. 292, 1095–1110[CrossRef][Medline] [Order article via Infotrieve]
  28. Harrod, A. C., Yang, X., Junker, M., and Reitzer, L. (2004) J. Biol. Chem. 279, 2350–2359[Abstract/Free Full Text]
  29. Park, S., Zhang, H., Jones, A. D., and Nixon, B. T. (2002) Biochemistry 41, 10934–10941[CrossRef][Medline] [Order article via Infotrieve]
  30. Park, S., Meyer, M., Jones, A. D., Yennawar, H. P., Yennawar, N. H., and Nixon, B. T. (2002) FASEB J. 16, 1964–1966[Abstract/Free Full Text]
  31. Fiedler, U., and Weiss, V. (1995) EMBO J. 14, 3696–3705[Medline] [Order article via Infotrieve]
  32. Simons, R. W., Houman, F., and Kleckner, N. (1987) Gene (Amst.) 53, 85–96[CrossRef][Medline] [Order article via Infotrieve]
  33. Haldimann, A., and Wanner, B. L. (2001) J. Bacteriol. 183, 6384–6393[Abstract/Free Full Text]
  34. Rothstein, D. M., Pahel, G., Tyler, B., and Magasanik, B. (1980) Proc. Natl. Acad. Sci. U. S. A. 77, 7372–7376[Abstract/Free Full Text]
  35. Miller, J. H. (1972) Experiments in Molecular Genetics, pp. 352–355, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
  36. Leung, D. W., Chen, E., and Goeddel, D. V. (1989) Technique 1, 11–15
  37. Sarkar, G., and Sommer, S. S. (1990) BioTechniques 8, 404–407[Medline] [Order article via Infotrieve]
  38. Moore, J. B., Shiau, S. P., and Reitzer, L. J. (1993) J. Bacteriol. 175, 2692–2701[Abstract/Free Full Text]
  39. Ninfa, A. J., and Magasanik, B. (1986) Proc. Natl. Acad. Sci. U. S. A. 83, 5909–5913[Abstract/Free Full Text]
  40. Austin, S., and Dixon, R. (1992) EMBO J. 11, 2219–2228[Medline] [Order article via Infotrieve]
  41. Hunt, T. P., and Magasanik, B. (1985) Proc. Natl. Acad. Sci. U. S. A. 82, 8453–8457[Abstract/Free Full Text]
  42. Lowry, O. H., and Passoneau, J. V. (1972) A Flexible System of Enzymatic Analysis, pp. 147–149, Academic Press, New York
  43. Nohno, T., Saito, T., and Hong, J. S. (1986) Mol. Gen. Genet. 205, 260–269[CrossRef][Medline] [Order article via Infotrieve]
  44. Reitzer, L., and Schneider, B. L. (2001) Microbiol. Mol. Biol. Rev. 65, 422–444[Abstract/Free Full Text]
  45. Samsonova, N. N., Smirnov, S. V., Altman, I. B., and Ptitsyn, L. R. (2003) BMC Microbiol. 3, 2[Medline] [Order article via Infotrieve]
  46. Pybus, C. (2002) Roles of the Omega-Transaminases of Escherichia coli in Nitrogen Metabolism and Characterization of a Putrescine Aminotransferase, M. S. thesis, Dept. of Molecular and Cell Biology, The University of Texas at Dallas, Richardson, TX
  47. Johnson, R. C., Ball, C. A., Pfeffer, D., and Simon, M. I. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 3484–3488[Abstract/Free Full Text]
  48. Morett, E., and Bork, P. (1998) FEBS Lett. 433, 108–112[CrossRef][Medline] [Order article via Infotrieve]
  49. Merickel, S. K., Haykinson, M. J., and Johnson, R. C. (1998) Genes Dev. 12, 2803–2816[Abstract/Free Full Text]
  50. McLeod, S. M., Xu, J., Cramton, S. E., Gaal, T., Gourse, R. L., and Johnson, R. C. (1999) J. Mol. Biol. 294, 333–346[CrossRef][Medline] [Order article via Infotrieve]
  51. Osuna, R., Finkel, S. E., and Johnson, R. C. (1991) EMBO J. 10, 1593–1603[Medline] [Order article via Infotrieve]
  52. Safo, M. K., Yang, W. Z., Corselli, L., Cramton, S. E., Yuan, H. S., and Johnson, R. C. (1997) EMBO J. 16, 6860–6873[CrossRef][Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 J. Bacteriol.Home page
J. S. Blevins, H. Xu, M. He, M. V. Norgard, L. Reitzer, and X. F. Yang
Rrp2, a {sigma}54-Dependent Transcriptional Activator of Borrelia burgdorferi, Activates rpoS in an Enhancer-Independent Manner
J. Bacteriol., April 15, 2009; 191(8): 2902 - 2905.
[Abstract] [Full Text] [PDF]

Home page
 J. Bacteriol.Home page
M. K. Matta, E. E. Lioliou, C. H. Panagiotidis, D. A. Kyriakidis, and C. A. Panagiotidis
Interactions of the Antizyme AtoC with Regulatory Elements of the Escherichia coli atoDAEB Operon
J. Bacteriol., September 1, 2007; 189(17): 6324 - 6332.
[Abstract] [Full Text] [PDF]

Home page
 Plant Physiol.Home page
D. Xu, X. Liu, J. Zhao, and J. Zhao
FesM, a Membrane Iron-Sulfur Protein, Is Required for Cyclic Electron Flow around Photosystem I and Photoheterotrophic Growth of the Cyanobacterium Synechococcus sp. PCC 7002
Plant Physiology, July 1, 2005; 138(3): 1586 - 1595.
[Abstract] [Full Text] [PDF]

Home page
 J. Bacteriol.Home page
M. D. Senadheera, B. Guggenheim, G. A. Spatafora, Y.-C. C. Huang, J. Choi, D. C. I. Hung, J. S. Treglown, S. D. Goodman, R. P. Ellen, and D. G. Cvitkovitch
A VicRK Signal Transduction System in Streptococcus mutans Affects gtfBCD, gbpB, and ftf Expression, Biofilm Formation, and Genetic Competence Development
J. Bacteriol., June 15, 2005; 187(12): 4064 - 4076.
[Abstract] [Full Text] [PDF]

Home page
 J. Bacteriol.Home page
Z. Zhang, G. Gosset, R. Barabote, C. S. Gonzalez, W. A. Cuevas, and M. H. Saier Jr.
Functional Interactions between the Carbon and Iron Utilization Regulators, Crp and Fur, in Escherichia coli
J. Bacteriol., February 1, 2005; 187(3): 980 - 990.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
279/35/36708    most recent
M405205200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yang, X. F.
Right arrow Articles by Reitzer, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yang, X. F.
Right arrow Articles by Reitzer, L.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2004 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement