Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M404927200 on June 15, 2004

J. Biol. Chem., Vol. 279, Issue 35, 36828-36840, August 27, 2004
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
279/35/36828    most recent
M404927200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lau, P.
Right arrow Articles by Muscat, G. E. O.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lau, P.
Right arrow Articles by Muscat, G. E. O.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

ROR{alpha} Regulates the Expression of Genes Involved in Lipid Homeostasis in Skeletal Muscle Cells

CAVEOLIN-3 AND CPT-1 ARE DIRECT TARGETS OF ROR*

Patrick Lau{ddagger}§, Susan J. Nixon{ddagger}, Robert G. Parton{ddagger}||**, and George E. O. Muscat{ddagger}§||{ddagger}{ddagger}

From the {ddagger}Institute for Molecular Bioscience, §Division of Molecular Genetics and Development, Centre for Microscopy and Microanalysis, School of Biomedical Sciences, University of Queensland, St. Lucia, Queensland 4072, Australia

Received for publication, May 4, 2004 , and in revised form, June 8, 2004.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The staggerer mice carry a deletion in the ROR{alpha} gene and have a prolonged humoral response, overproduce inflammatory cytokines, and are immunodeficient. Furthermore, the staggerer mice display lowered plasma apoA-I/-II, decreased plasma high density lipoprotein cholesterol and triglycerides, and develop hypo-{alpha}-lipoproteinemia and atherosclerosis. However, relatively little is known about ROR{alpha} in the context of target tissues, target genes, and lipid homeostasis. For example, ROR{alpha} is abundantly expressed in skeletal muscle, a major mass peripheral tissue that accounts for ~40% of total body weight and 50% of energy expenditure. This lean tissue is a primary site of glucose disposal and fatty acid oxidation. Consequently, muscle has a significant role in insulin sensitivity, obesity, and the blood-lipid profile. In particular, the role of ROR{alpha} in skeletal muscle metabolism has not been investigated, and the contribution of skeletal muscle to the ROR–/– phenotype has not been resolved. We utilize ectopic dominant negative ROR{alpha} expression in skeletal muscle cells to understand the regulatory role of RORs in this major mass peripheral tissue. Exogenous dominant negative ROR{alpha} expression in skeletal muscle cells represses the endogenous levels of ROR{alpha} and -{gamma} mRNAs and ROR-dependent gene expression. Moreover, we observed attenuated expression of many genes involved in lipid homeostasis. Furthermore, we show that the muscle carnitine palmitoyltransferase-1 and caveolin-3 promoters are directly regulated by ROR and coactivated by p300 and PGC-1. This study implicates RORs in the control of lipid homeostasis in skeletal muscle. In conclusion, we speculate that ROR agonists would increase fatty acid catabolism in muscle and suggest selective activators of ROR may have therapeutic utility in the treatment of obesity and atherosclerosis.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Members of the nuclear hormone receptor (NR)1 superfamily bind specific DNA elements and function as transcriptional regulators (1, 2). This group includes the "orphan NRs," which have no known ligands in the "classical sense." The orphan receptor, ROR/RZR (retinoic acid receptor-related orphan receptor), is closely related to Rev-erbA{alpha}, RVR/Rev-erb{beta}/BD73, and the Drosophila orphan receptor, E75A, particularly in the DNA-binding domain and the putative ligand-binding domain. ROR, Rev-erbA{alpha}, and RVR bind as monomers to an asymmetric (A/T)6RGGTCA motif. ROR functions as a constitutive transactivator of gene expression, and in contrast, Rev-erbA{alpha} and RVR do not activate transcription, mediate transcriptional repression, and can repress constitutive trans-activation from this motif by ROR{alpha} (3–9).

Three ROR/RZR genes have been identified; ROR{alpha} encodes four ROR{alpha} isoforms {alpha}1, {alpha}2, {alpha}3, and RZR{alpha}, which are alternatively spliced products of the ROR{alpha} gene and are predominantly expressed in blood, brain, skeletal muscle, and fat cells (8, 10). ROR{beta}/RZR{beta} is expressed specifically in the brain (11), and ROR{gamma} is found at high levels in skeletal muscle (12–14).

Genetic studies have implicated ROR{alpha} in the regulation of lipid homeostasis. For example, analysis of ROR{alpha} function has been assisted by a natural mutation in an obese mouse strain called staggerer (sg/sg). The mutation produces a dominant negative ROR{alpha} that results in a functional knockout phenotype. In accordance with the wide expression pattern of ROR{alpha}, staggerer mice show symptoms of ataxia and cerebellar dysfunction, susceptibility to atherosclerosis and hypo-{alpha}-lipoproteinemia, vascular dysfunction, muscular irregularities, osteoporosis, and severe immune abnormalities. In the context of lipid homeostasis, the staggerer mice exhibit an aberrant blood lipid profile with lower circulating plasma levels of HDL-C, apolipoprotein (apo) CIII, and plasma triglycerides. Decreases in specific lipoprotein compartments, namely apoAI, the major constituent of HDL, and apoAII, leads to a pronounced hypo-{alpha}-lipoproteinemia (16). Accordingly, it has been shown that ROR{alpha} regulates the expression of apoAI and apoCIII in cell culture (16, 17). Susceptibility to atherosclerosis in this animal model is linked to a complex phenotype that includes aberrant vascular physiology, lipid profiles, and hypersensitive inflammatory responses.

Studies examining motor capabilities and coordination in staggerer mice have shown a reduction of muscular strength in these mice (18). Furthermore, the studies of Lau et al. (19) demonstrated that ROR{alpha} potentiates skeletal muscle myogenesis, and the comments in a review by Jarvis et al. (20) suggest that staggerer mice have skeletal muscle irregularities.

The association between ROR{alpha}, lipid homeostasis, and skeletal muscle is not surprising. ROR{alpha} is abundantly expressed in skeletal muscle, which is one of the most metabolically demanding tissues that relies heavily on fatty acids as an energy source and accounts for 75% of glucose disposal. Moreover, this suggests that muscle has an important role in obesity, which is primarily controlled by increased food intake or decreased energy expenditure. However, the fundamental role of ROR{alpha} in skeletal muscle cholesterol, lipid, glucose, and energy homeostasis has not been examined. Moreover, the contribution of skeletal muscle, a major mass tissue, to the ROR knockout phenotype has not been resolved.

The involvement of ROR{alpha} in the progression of atherosclerosis identifies ROR{alpha} as a therapeutic target in the treatment of cardiovascular disease. In addition, skeletal muscle is rapidly emerging as a critical target tissue in the battle against obesity, type II diabetes, dyslipidemia, syndrome X, and atherosclerosis. NRs in skeletal muscle, for example liver X receptor (LXR), peroxisome proliferator-activated receptors (PPAR) {alpha}, {beta}/{delta}, and {gamma}, have been shown to be involved in enhancing insulin-stimulated glucose disposal rate, decreasing triglycerides and increasing lipid catabolism, cholesterol efflux, and plasma HDL-C levels (21–23). Hence, orphan NRs that regulate lipid and glucose metabolism, cholesterol homeostasis, energy expenditure, and thermogenesis in skeletal muscle have enormous pharmacological utility for the treatment of dyslipidemia and syndrome X.

We hypothesize that ROR{alpha} regulates lipid, glucose, and energy homeostasis in this major mass lean tissue. This hypothesis was addressed by examining the effect of ectopically expressing the staggerer form of ROR{alpha} in muscle cells and by investigating the subsequent effect on gene expression involved in lipid metabolism. Our investigation reveals that ROR has a central role in the regulation of lipid metabolism in muscle cells. Moreover, we suggest that the atherogenic and dyslipidemic phenotype of the staggerer mouse is related to aberrant ROR{alpha} function in skeletal muscle.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Cell Culture—Mouse myogenic C2C12 cells were cultured in growth medium (DMEM supplemented with 10% Serum Supreme (BioWhittaker, Edward Keller Pty. Ltd., Hallam, Victoria, Australia)) in 6% CO2. Myoblasts were differentiated into post-mitotic multinucleated myotubes by 1–5 days of serum withdrawal (i.e. cultured in DMEM supplemented with 2% horse serum). Cells were harvested at indicated time points, usually 120 h (5 days) after the mitogen withdrawal, unless indicated differently. African green monkey kidney COS-1 cells were grown in DMEM supplemented with 10% heat-inactivated fetal calf serum.

Transient Transfections—Each well of a 24-well plate of COS-1 cells (~60% confluence) was transfected with a total of ~0.6–0.8 µg of DNA per well by using the liposome-mediated transfection procedure as described previously (19). Cells were transfected using an N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium methylsulfate and Metafectene (Biontex Laboratories GmbH, Munich, Germany) liposome mixture in 1x HBS (HEPES-buffered saline (42 mM HEPES, 275 mM NaCl, 10 mM KCl, 0.4 mM Na2HPO4, 11 mM dextrose (pH 7.1)). The DNA/N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium methylsulfate/Metafectene mixture was added to the cells in 0.5–0.6 ml of DMEM supplemented with 5% charcoal-stripped fetal calf serum. 16–24 h later, the culture medium was changed, and the cells were subsequently harvested for the assay of luciferase activity 24–48 h after the transfection period as described previously. Fold activation is expressed relative to LUC activity obtained after cotransfection of the reporter and pSG5 vector only, arbitrarily set at 1. The mean fold activation values and standard deviations were derived from a minimum of two independent experiments composed of six replicates. CAT assays were described previously (19). Transient transfections were performed at least twice in sextuplicate.

C2C12 Stable Transfection—Myogenic C2C12 cells, cultured in growth medium, were cotransfected with pSG5-ROR{Delta}DE (and pCMV-NEO at a 20:1 ration of expression vector/NEO vector) by the liposome-mediated procedure in duplicate. The cells were then grown for another 24 h to allow cell recovery and neomycin resistance expression before G418 selection. After 10–14 days selection with 450 µg/ml G418 (Invitrogen) in culture medium, the two independent polyclonal pools (>100 colonies per pool) of stable transfectants were cultured and maintained on 200 µg/ml G418 medium.

RNA Extraction—Total RNA was extracted from C2C12 using TRI-Reagent (Sigma), according to manufacturer's protocol. RNA for quantitative real time (Q-RT)-PCR, was further purified by using RNeasy (Qiagen, Clifton Hill, Victoria, Australia), according to manufacturer's instructions. This was followed by DNase treatment with DNA-free (Ambion, Austin, TX.)

Q-RT-PCR—RNA was normalized using UV spectrophotometry and agarose gel electrophoresis. Complementary DNA was synthesized from 7 µg of total RNA by Superscript3, according to the manufacturer's instruction (Invitrogen). Target cDNA levels were analyzed by Q-RT-PCR in 25-µl reactions containing either 1x SYBR green (ABI, Warrington, UK) or Taqman PCR master mix (ABI, Branchburg, NJ), 200 nM each forward and reverse primers or Assay on Demand Taqman primers (ABI, Foster City, CA) and cDNA (0.6% of the starting 7 µg of RNA) by using an ABI Prism 7000 Sequence Detector system. PCR was conducted over 45 cycles of 95 °C for 15 s and 60 °C for a 1-min two-step thermal cycling preceded by an initial 95 °C for 10 min for activation of Amplitaq Gold DNA polymerase.

Primers—The Mus musculus primer sequences (forward and reverse, respectively) used are as follows: ABCA1, GCTCTCAGGTGGGATGCAG and GGCTCGTCCAGAATGACAAC; 18 S, GATCCATTGGAGGGCAAGTCT and CCAAGATCCAACTACGAGCTTTTT; A8/G1, CTGAGGGATCTGGGTCTGA and CCTGATGCCACTTCCATGA; ACS4, GGTTTGGTAACAGATGCCTTCAA and CCCATACATTCGCTCAATGTCTT; ADRP, CCCTGGTTCTAAGAAGCTGCTTT and GGCCAGATGACCCCTTTTG; AdipoR1, ACGTTGGAGAGTCATCCCGTAT and CTCTGTGTGGATGCGGAAGAT; AdipoR2, TCCCAGGAAGATGAAGGGTTTAT and TTCCATTCGTTCGATAGCATGA; apoE, GCTGTTGGTCACATTGCTGA and TGCCACTCGAGCTGATCTG; {beta}-actin, GCTCTGGCTCCTAGCACCAT and CCACCGATCCACACAGAGTAC; CD36, GGCCAAGCTATTGCGACAT and CAGATCCGAACACAGCGTAGA; CAV-3, CTGCCCCCAGGACTATCAAC and TTCCAGATCCGTGTGCTCTTC; CPT1b, ATCATGTATCGCCGCAAACT and CCATCTGGTAGGAGCACATGG; FABP3, CCCCTCAGCTCAGCACCAT and CAGAAAAATCCCAACCCAAGAAT; FAS, CGGAAACTTCAGGAAATGTCC and TCAGAGACGTGTCACTCCTGG; GAPDH, GTGTCCGTCGTGGATCTGA and CCTGCTTCACCACCTTCTTG; Glut4n ATGGCTGTCGCTGGTTTCTC and ACCCATACGATCCGCAACAT; Glut5, CTTGCCTTTACCGGGTTGAC and CATCTGGTCTTGCAGCAACTCT; MyoG, CCTTAAAGCAGAGAGCATCC and GGAATTCGAGGCATAATATGA; LPL, CCAATGGAGGCACTTTCCA and TGGTCCACGTCTCCGAGTC; mROR{alpha}, CAATGCCACCTACTCCTGTCC and GCCAGGCATTTCTGCAGC; PGC-1, CGATGTGTCGCCTTCTTGCT and CGAGAGCGCATCCTTTGG; Rev-erb, CCACACCGCTGGGAGAGT and GCCCTGGCGTAGACCATTC; RVR, GGAAACACTCATCCGTGCACTA and ATCGAAGATCTGGCAACTTTAGAA; SCD-1, TGTACGGGATCATACTGGTTCC and CCCGGCTGTGATGCC; SCD-2, ACTGTGACTCAAGTTCAACTCTTGAAA and TGCCCACAAATTGAGGATAGC; and SREBP-1c, CGTCTGCACGCCCTAGG and CTGGAGCATGTCTTCAAATGTG; TNNI1, GCCTATGCGCACACCTTTG and CGGGTACCATAAGCCCACACT; TNNI2, AAATGTTCGAGTCTGAGTCCTAACTG and GCCAAGTACTCCCAGACTGGAT; UCP-2, GTTCCTCTGTCTCGTCTTGC and GGCCTTGAAACCAACCA; and UCP-3, TGACCTGCGCCCAGC and CCCAGGCGTATCATGGCT.

Human ROR{alpha}-specific primers contain 3 of 5 base difference at the 3' end of the reverse primer relative to mouse primers. hROR{alpha}: CAATGCCACCTACTCCTGTCC and CTACGGCAAGGCATTTCTGTAAT. GAPDH and 18 S were used for normalization between samples for quantitation. Assay on Demand primers were used for Taqman real time PCR (ABI, Foster City CA) m+hROR (Mm00443103_m1); ROR{gamma} (Mm00441139_m1); FABP4 (Mm00445880_m1); GAPDH (Mm99999915_g1); 18 S rRNA (Hs99999901_s1).

Plasmids—Human pSG5-ROR{alpha}1 has been previously described (19). ROREx5-tk-LUC containing five copies of RORE (TATATCAAGGTCAT) was cloned into pTKLuc as described by Medvedev et al. (24). mPCP-2x4-tk-LUC containing four copies of mouse Pcp-2 RORE (GTTATAGTAACTGGGTCAGGGGACT) was cloned into pTKLuc as described by Matsui (25). The inserted sequences in the TKLuc clones were confirmed by big dye terminator version 3.1 cycle sequencing (ABI, Foster City, CA). The CPT-1 promoter (–1025/–12) was kindly provided by D. P. Kelly (26); cDNA-GRIP1/SRC2 and cDNA-p300 have been described previously (27). CDNA4-PGC-1 was kindly provided by Spiegelman and co-workers (28). 2.6-kb mouse caveolin-3 promoter was isolated from a BAC clone 23N20 (Incyte Genetics) and cloned into a HindIII site of pGL3basic. Deletion constructs of the Cav-3 promoter were obtained using native restriction sites or by PCR with Pfu DNA polymerase. The DNA sequences of these constructs were confirmed by cycle sequencing (Applied Biosystems). GLUT4-pGL2 was obtained by PCR cloning of a mouse skeletal muscle genomic DNA into pGL2basic. The DNA sequence containing a 2.2-kb sequence upstream of the transcription start site was confirmed by cycle sequencing. pGEX-ROR{alpha}1 was described previously (19); GAL4-ROR constructs were cloned in-frame into the multiple cloning site of vector pGAL0 and confirmed by dideoxy sequencing (Amersham Biosciences).

Site-directed Mutagenesis—pGL3-Cav3Luc (–2595/+35) was mutated by QuickChange PCR site-directed mutagenesis (Stratagene) according to the manufacturer's instructions. 125 ng of oligonucleotides containing GG to TT mutation and its complementary strand (see sequences below) were added to a PCR containing 50 ng of pGL3-Cav3Luc (–2595/+35), dNTP, 1x Pfu buffer, and Pfu or Pfu ultra. After restriction digestion with DpnI, the reaction was transformed into DH5{alpha}. The colonies were screened, and the sequence was confirmed by cycle sequencing after DNA extraction. The oligonucleotides to mutate the mouse caveolin-3 promoter are as follows: Cav-3 mut2 oligos, GAGGATACAATCTCGTGTCAAATACTCACCCGCCCCG and CGGGGCGGGTGAGTATTTGACACGAGATTGTATCCTC; and the Cav-3 mut6 oligos, CATGCGGCTCCCAGTGAAAGACTTCCTCCTCTCGAG and CTCGAGAGGAGGAAGTCTTTCACTGGGAGCCGCATG.

Oligonucleotide Probes and EMSA—Double-stranded oligonucleotide probes used in EMSA and for cold competition are as follows: RORE, 5'-TCGACTCGTATATCAAGGTCAAGCGTG-3' (8); mouse pcp-2, 5'-GTTATAGTAACTGGGTCAGGGGACTC-3' (25); Cav-3 m1, CTGAGAACTACGTCATGGCCTTTG; Cav-3 m2, CTCGTGTCACCTACTCACCCG; Cav-3 m3, CTGCTCCAAGGCACAGGAGAGCAGAGC; Cav-3 m4, AGCAGAGCAAGGTCTTTGTCCCTTTGGTGTC; Cav-3 m5, CATGGACAAGGTAAAGGGGAGGCTTATAACTG; and Cav-3 m6, CCAGTGACCGACTTCCTCCTCT.

GST-ROR{alpha}1 was prepared as previously described (19, 52). 100 ng of double-stranded oligonucleotide was radiolabeled with 5 µl of [{gamma}-32P]ATP and T4 polynucleotide kinase and purified by 6% TBE-PAGE.

EMSAs were carried out as described previously with modifications (52, 55). 0.4 µg of GST-ROR{alpha}1 protein in Dignam buffer C (0.1 M NaCl, 20 mM HEPES (pH 7.9), 2 mM EDTA, 1 mM dithiothreitol, and 1x complete protease inhibitor (Roche Applied Science)) was incubated with 1 µg of poly(dI-dC)·(dI-dC), 4 µg of bovine serum albumin, 1x complete protease inhibitor (Roche Applied Science), 300 cps of gel-purified 32P double-stranded radioactive probe end-labeled by T4 polynucleotide kinase, 12% glycerol, 0.6 mM dithiothreitol, and 1x binding buffer (53) on ice for 30 min before gel separation. Cold competition studies were carried out by coincubation with 100–300 ng of double-stranded unlabeled probe.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
ROR{alpha} and -{gamma} mRNA Expression Are Induced during Myogenic Differentiation—ROR{alpha} and -{gamma} mRNAs are expressed in skeletal muscle tissue. To elucidate the functional role of ROR{alpha} in skeletal muscle, we initially investigated the expression of ROR{alpha} mRNA relative to the 18 S rRNA in the mouse C2C12 myoblast cell line. This skeletal muscle cell line has proven to be a reliable system to study skeletal muscle lipid homeostasis in cell culture (21–23).

Proliferating C2C12 myoblasts can be induced to biochemically and morphologically differentiate into post-mitotic multinucleated myotubes by serum withdrawal in culture over a 48–96-h period. This transition from a non-muscle phenotype to a contractile phenotype is associated with the repression of non-muscle proteins and the activation/expression of a structurally diverse group of genes responsible for contraction and to cope with the extreme metabolic demands on this organ (Fig. 1A).



View larger version (53K):
[in this window]
[in a new window]
  		FIG. 1.
ROR mRNA expression in skeletal muscle cells. A, schematic illustration of the cell culture model. Proliferating myoblasts are cultured in DMEM supplemented with 10% serum supreme. Myoblasts were differentiated into post-mitotic multinucleated myotubes by 1–5 days of serum withdrawal (i.e. cultured in DMEM supplemented with 2% horse serum). B–J, Q-RT-PCR analysis of ROR{alpha} and -{gamma} mRNA expression during skeletal myogenesis. Total RNA was extracted from C2C12 proliferating myoblasts (PMB), confluent myoblasts (CMB), and myotube (MT) after 2 days of serum withdrawal (MT2) and myotubes after 5 days of serum withdrawal (MT5), and 7 µg of each sample was reverse-transcribed to cDNA. Subsequently, 0.6% of the cDNA was analyzed by Q-RT-PCR (see "Materials and Methods"). B, Q-RT-PCR analysis of mROR{alpha} levels. C, Northern analysis of ROR{alpha} mRNA levels as reported previously (19). Q-RT-PCR analyses of mROR{gamma} mRNA levels (D); mRNA levels (MyoG) (E); {beta}-actin mRNA levels (F); troponin I slow/type 1 (TNNI1) mRNA levels (G); troponin I fast/type II (TNNI2) mRNA levels (H); RVR mRNA levels (I); and Rev-erb{alpha} mRNA levels (J). (Primer sequences and experimental conditions for Q-RT-PCR are described under "Materials and Methods.") Levels of 18 S were measured in all samples, and the results were normalized and presented as number of target transcripts per 18 S transcript. For example {beta}-actin is equivalently expressed to 18 S.

 
By using the GenBankTM sequences of ROR{alpha} and -{gamma}, we designed specific primers for the amplification of mouse ROR by quantitative real time PCR from total RNA isolated from proliferating and differentiated C2C12 cells (Fig. 1A). Total poly(A)+ RNA was isolated from proliferating myoblasts (PMB), confluent myoblasts (CMB), and post-mitotic myotubes after 2 and 5 days (MT2 and MT5) of serum withdrawal and examined by real time PCR and "Northern blot" analysis.

We observed that ROR{alpha} and -{gamma} are expressed in proliferating myoblasts; however, these transcripts are induced 2.5–4-fold, relative to 18 S rRNA and GAPDH mRNA (data not shown), as the cells exit the cell cycle and fuse to form differentiated multinucleated myotubes that have acquired a muscle-specific phenotype (Fig. 1, B and D). ROR{alpha} is seen transcribed as a double band (Fig. 1C) in C2C12 as described in differentiated P19 cells (3). Concomitant with this increase in ROR encoding mRNAs was the striking induction of myogenin mRNA (Fig. 1E), which encodes the hierarchical bHLH regulator, and repression of the cytoskeletal non-muscle {beta}-actin mRNA (Fig. 1F), which confirmed that these cells had terminally differentiated. Moreover, we observed the induction of the slow and fast isoforms of the contractile protein, troponin I (Fig. 1, G and H). These data demonstrated that the ROR{alpha} and -{gamma} mRNA transcripts were expressed in C2C12 cells, and expression is increased upon myotube formation.

Induction of ROR{alpha} and -{gamma} mRNAs correlated with the repression of the mRNAs encoding the closely related but opposingly acting Rev-erb{alpha} and {beta}(RVR) orphan nuclear receptors (Fig. 1, I and J), which are abundantly expressed in proliferating myogenic cells but are repressed during myogenic differentiation. This is in concordance with previous observations (50, 51).

Ectopic ROR{Delta}E Expression Represses Endogenous Levels of ROR{alpha} and -{gamma} and Attenuates ROR-dependent Gene Expression—To understand the biological role of ROR{alpha} in skeletal muscle lipid homeostasis and to identify the metabolic target(s) of this orphan receptor in muscle cells, we proceeded to examine the effect of attenuating ROR function in C2C12 cells.

In order to perturb ROR function and to disrupt ROR-mediated gene expression, we utilized the ROR{Delta}DE plasmid. This construct encodes amino acids 1–235 but lacks the entire E region and part of the hinge/D region of ROR{alpha}. This was chosen because McBroom et al. (30) reported that deletion of this region preserved DNA binding but destroyed trans-activation and operated in a dominant negative manner. Furthermore, the "staggerer" phenotype in mice is because of a frameshift mutation in ROR{alpha} (29), which produces a similar nonfunctional C-terminal domain. Finally, we noted that GAL4 hybrid analysis indicated that the ROR{alpha} activation domain was located downstream of amino acid position 235 (Fig. 2A). Moreover, in concordance with this observation, we demonstrated that ROR{Delta}DE (ROR{alpha}1-(1–235)) ablated the ROR-mediated trans-activation of the synthetic (ROREx5) and native (mPCP-2 x 4) ROR-dependent response elements linked to the basal tk-LUC reporter (Fig. 2, B and C). Also shown is the opposingly acting RVR/rev-erb {beta} orphan that does not trans-activate the ROREs. Moreover, the ROR{Delta}DE repressed the ROR-mediated trans-activation of the synthetic heterologous RORE-tk-LUC reporter in a dose-dependent manner, similar to the orphan receptor RVR (Fig. 2, D and E). This demonstrated that this construct, as expected from studies on the staggerer form of ROR and other forms of ROR that lack the entire E region and parts of the hinge, attenuated ROR-dependent gene expression.



View larger version (28K):
[in this window]
[in a new window]
  		FIG. 2.
ROR{alpha}-(1–235)/ROR{Delta}DE attenuates ROR-dependent gene expression. A, diagrammatic representation of ROR{alpha} and the Gal4-ROR chimeric constructs. Each well of a 6-well plate of COS-1 cells (~60% confluence) was cotransfected with 1.0 µg of the Gal4-ROR chimera and 3.0 µg of the GAL reporter G5EIb-CAT by the liposome-mediated transfection procedure as described under "Materials and Methods." Briefly, the DNA/liposome mix was added to the cells in 3 ml of DMEM supplemented with 5% charcoal-stripped fetal calf serum. 16–24 h later, the culture medium was changed, and the cells were subsequently harvested for the assay of CAT enzyme activity 24–48 h after the transfection period. Fold activation is expressed relative to CAT activity obtained after cotransfection of the Gal4 DNA-binding domain alone, arbitrarily set at 1. The mean fold activation values and S.D. (bars) were derived from a minimum of two independent triplicate experiments. B, each well of a 24-well plate of COS-1 cells (~60% confluence) was cotransfected with either 0.33 µg of the synthetic reporter, ROREx5-tk-LUC (the RORE sequences are described under "Materials and Methods"). Additionally, either 0.32 µg of pSG5, 0.16 µg each of pSG5-RORa and pSG5, 0.16 µg each of pSG5-RORa1 and pSG5-ROR{Delta}DE, or 0.16 µg each of pSG5-RORa and pSG5-RVR (i.e. a total of ~0.65 µg of DNA per well) used the liposome-mediated transfection procedure as described in A. Fold activation is expressed relative to LUC activity obtained after cotransfection of the reporter, and pSG5 vector only was arbitrarily set at 1. The mean fold activation values and S.D. (bars) were derived from a minimum of two independent experiments composed of six replicates. C, identical to B, except the native reporter, mPCP-2x4-tk-LUC, has been utilized. D and E, COS-1 cells were transiently transfected as above with 0.32 µg of the synthetic reporter, ROREx5-tk-LUC. The control transfection (C), arbitrarily set to 1, also contained 0.32 µg of the pSG5 vector alone. All the other transfections contained 0.16 µg of pSG5-RORa1 per well of a 24-well plate. Additionally, the three denoted transfections were cotransfected with increasing amounts (0.04, 0.08, and 0.16 µg) of pSG5-ROR{Delta}DE (D) and pSG5-RVR (E), respectively. The vector pSG5 was used to standardize the quantity of DNA to a total of ~0.65 µg of DNA per well. Fold activation is expressed relative to luciferase activity obtained after cotransfection of the reporter with the pSG5 vector alone, arbitrarily set at 1. The mean luciferase fold activation values and S.D. (bars) were derived from a minimum of 2–3 independent experiments composed of six replicates.

 
We stably (and independently) cotransfected two populations of C2C12 cells with ROR{Delta}DE and pCMV-NEO expression vectors. Stable ROR{Delta}DE transfectants were isolated as two independent polyclonal pools of G418-resistant colonies (composed of >20 individually resistant colonies). The C2:ROR{Delta}DE cells were transfected with pSG5-ROR{Delta}DE (i.e. amino acids 1–235). The two polyclonal pools of C2-ROR{alpha}1-(1–235) cells abundantly expressed the ectopic/exogenous human transcript relative to GAPDH and 18 S rRNA controls. This was demonstrated rigorously by quantitative real time PCR with primers that specifically detect the human-specific transcript expressed from the expression vector (Fig. 3, A and B) and Northern analysis (Fig. 3C). Furthermore, the total pool size of ROR{alpha} mRNA increased ~2–3-fold when measured by real time PCR with primers that detected both mouse and human transcripts (Fig. 3D). Most interestingly, we observed by real time PCR and Northern analysis that the endogenous levels of the mouse ROR{alpha} mRNA transcripts were reduced in both polyclonal pools of the C2-ROR{alpha}1-(1–235) cells (Fig. 3, E and F) relative to the wild type levels. The down-regulation of the endogenous ROR{alpha} transcripts is not surprising. During myogenesis mRNA pool sizes in muscle tissue are under strict control (31), and mechanisms exist that sense total output from exogenous and endogenous genes (32). Furthermore, exogenous expression of a number of different contractile protein transgenes in the mouse (e.g. myosin light chain 2 and troponin I fast, skeletal, and cardiac actin) results in the decline in the expression of the corresponding endogenous gene (32–36). Finally, we observed that ectopic expression of the ROR{alpha}{Delta}DE in muscle C2 cells completely ablated ROR{gamma} mRNA expression (Fig. 3G).



View larger version (24K):
[in this window]
[in a new window]
  		FIG. 3.
Q-RT-PCR analyses of the ROR{Delta}DE stably transfected C2C12 cell line. Q-RT-PCR analysis of endogenous and exogenous/ectopic ROR mRNA expression in two independent populations of native/wild type (wt) differentiated mouse C2C12 cells and two independent polyclonal pools of the C2C12 cells were stably transfected with the dominant negative human RORa1{Delta}DE expression vector after 5 days of serum withdrawal. These cells were denoted as wild type C2s and C2:ROR{Delta}DE, respectively. A, Q-RT-PCR analysis of the dominant negative human ROR{alpha} (hROR) mRNA expression in the two independent populations of wild type mouse C2C12 cells, and the two independently transfected polyclonal pools of the C2:ROR{Delta}DE cells relative to the GAPDH control. B, Q-RT-PCR analysis of hROR{alpha} mRNA expression relative to the 18 S rRNA control. C, Northern analysis of the dominant negative human ROR{alpha} mRNA as reported previously (19). Total RNA from proliferating myoblasts (PMB) and myotubes after 2 days of serum withdrawal (MT2) was isolated from wild type and stably transfected cells. Subsequently, RNA was Northern-blotted and hybridized with a 32P-labeled human ROR probe and an oligo that recognizes the 18 S rRNA. D, Q-RT-PCR analysis of total mouse + human ROR{alpha} mRNA levels (m+hROR) using primers that recognize the mouse and human RORs. E, Q-RT-PCR analysis of mouse ROR{alpha} (mROR) that measure the levels of the endogenous ROR mRNA levels. F, Northern analysis of the endogenous mouse ROR{alpha} as reported previously. G, Q-RT-PCR analysis of mouse ROR{gamma} that measure the levels of the endogenous ROR mRNA levels. Specific primer sequences and PCR conditions are described under "Materials and Methods."

 
In conclusion, the cell lines ectopically expressed a dominant negative ROR{alpha} expression vector that compromises ROR function and ROR-dependent gene expression. Moreover, ROR{alpha} mRNA expression is attenuated, and ROR{gamma} mRNA expression is ablated.

ROR Regulates Lipid Homeostasis; Dominant Negative ROR Activity Represses the Expression of Genes Involved in Lipid Absorption, Utilization, and Efflux—We investigated the expression of the genes involved in skeletal muscle lipid and carbohydrate metabolism (see Table I) in the wild type and the ROR{Delta}DE-expressing C2C12 cells. This in vitro cell culture system has been used to investigate the regulation of cholesterol homeostasis and lipid metabolism by LXR agonists (22). Muscat et al. (22) demonstrated that the selective and synthetic liver X receptor (LXR) agonist, T0901317, induced similar effects on mRNAs encoding the ATP-binding cassette A1/G1 (ABCA1/G1), apolipoprotein E (apoE), stearoyl-CoA desaturase-1 (SCD-1), sterol regulatory element binding protein-1c (SREBP-1c), etc. in differentiated C2C12 myotubes and M. musculus quadriceps skeletal muscle tissue. Moreover, treatment of these cells with PPAR{alpha} and -{delta} agonists and an analysis of critical genes (>12) involved in lipid and carbohydrate metabolism revealed similar responses to quadriceps tissue from agonist-treated C57BL/6J mice (21–23). The physiological validation of the cell culture model with respect to lipid homeostasis in the mouse corroborates the utility of this model system. This evidence, coupled to the flexibility and utility of cell culture in terms of manipulation, RNA extraction, and target validation provides an ideal platform to identify the ROR{alpha}-dependent regulation of genes involved in metabolism. In addition and more importantly, we have demonstrated this cell line expresses ROR{alpha} and -{gamma} receptors and that the stable cell line produced by ectopic ROR{Delta}E overexpression has compromised endogenous ROR{alpha}/{gamma} expression and function.


View this table:
[in this window]
[in a new window]
  		TABLE I
Key target genes in this study

 
We isolated total RNA from the native (wild type) and ROR{Delta}DE-differentiated myotubes, and we analyzed the expression levels of several myogenic mRNAs by quantitative real time PCR. We demonstrated as reported previously (19) that these cells retain the potential to differentiate (although the initial rate is impaired slightly), exit the cell cycle, and express all genes associated with contraction and lipid metabolism (data not shown). This suggests that ectopic ROR{Delta}DE expression does not significantly affect proliferation, cell cycle withdrawal, differentiation, and/or phenotypic acquisition of these skeletal muscle cells.

Subsequently, we utilized quantitative real time PCR to investigate the expression pattern of genes involved in fatty acid and lipid absorption (fatty acid translocase (FAT/CD36), fatty acid binding proteins 3 and 4 (FABP3 and -4), triglyceride hydrolysis (lipoprotein lipase (LPL)), and fatty acid oxidation (muscle-type carnitine palmitoyltransferase-1 (M-CPT-1), acyl-CoA synthetase-4 (ACS-4), adiponectin receptors 1 and 2), glucose/fructose absorption, and utilization (glucose transporters 4, and 5 (GLUT4 and -5)), in total RNA isolated from C2C12 and C2:ROR{Delta}E myotubes differentiated for 5 days.

In the context of lipid and fatty acid uptake, we observed significant repression of the mRNAs encoding fatty acid translocase (FAT/CD36), and fatty acid binding protein 3 (FABP3), with only minor changes observed for fatty acid binding protein 4 (FABP4) in the ROR{Delta}E-expressing cell line, respectively (Fig. 4, A–C).



View larger version (53K):
[in this window]
[in a new window]
  		Fig. 4.
Expression profiling of mRNAs involved in metabolism by Q-RT-PCR analyses of the wild type native C2C12 cells and the C2:ROR{Delta}DE stably transfected cells. Q-RT-PCR analysis of endogenous mRNA expression encoding enzymes/proteins involved in lipid homeostasis, energy expenditure, etc. (described in Table I) in two independent populations of native/wild type (wt) differentiated mouse C2C12 cells, and two independent polyclonal pools of the C2C12 cells stably transfected with the dominant negative human RORa1{Delta}DE expression vector, after 5 days of serum withdrawal are shown. These cells were denoted as wt C2s, and C2:ROR{Delta}DE, respectively. Levels of 18 S were measured in all samples; the results were normalized and presented as the number of target transcripts per 18 S transcript. For example, {beta}-actin is equivalently expressed to 18 S. A–C, Q-RT-PCR analysis of mRNA expression encoding proteins/enzymes involved in lipid absorption that are completely described in Table I. A, fatty acid translocase (CD36/FAT); B, fatty acid binding protein 3 (FABP3); and C, FABP4. D and E, Q-RT-PCR analysis of mRNA expression encoding proteins/enzymes involved in glucose uptake that are completely described in Table I. D, GLUT4; E, GLUT5. F–K, Q-RT-PCR analysis of mRNA expression encoding proteins/enzymes involved in lipid catabolism that are completely described in Table I. F, LPL; G, CPT-1; H, ACS-4; I and J, adiponectin receptors 1 and 2 (adipoR1 and R2); K, PGC-1. L and M, Q-RT-PCR analysis of mRNA expression encoding proteins/enzymes involved in energy expenditure that are completely described in Table I. L, UCP-2; M, UCP-3. N–R, Q-RT-PCR analysis of mRNA expression encoding proteins/enzymes involved in lipid efflux and storage that are completely described in Table I. N, ABCA1; O, ABCA8/G1; P, apoE; Q, Cav-3; R, ADRP. S–V, Q-RT-PCR analysis of mRNA expression encoding proteins/enzymes involved in lipogenesis that are completely described in Table I. S, SREBP-1c; T, SCD-1; U, SCD-2; V, FAS. W–Z, Aii, and Bii, Q-RT-PCR analysis of mRNA expression encoding proteins associated with differentiation of the C2:ROR{Delta}DE cell line, i.e. MyoG, {beta}-actin, TNNI1, and TNNI2. W, MyoG; X, {beta}-actin; Y, MyoG; Z, {beta}-actin; Aii, TNNI1; Bii, TNNI2.

 
The transcripts encoding lipoprotein lipase, M-CPT-1, and acyl-CoA synthetase-4 (ACS-4), which are involved in triglyceride-hydrolysis, fatty acid-oxidation, and preferential fuel utilization, were significantly repressed ~5–7-fold in the RNA isolated from the cell line overexpressing ROR{Delta}E (Fig. 4, F–H). The significance of the repression is highlighted by the observation that expression of PPAR-{gamma} coactivator-1 (PGC-1) mRNA (Fig. 4K), myogenin (myoG) mRNA (Fig. 4W) (which encodes the hierarchical bHLH regulator), and {beta}-actin mRNA(Fig. 4X) was reduced ~2-fold. Moreover, the changes observed are not due to the effects of ROR{Delta}E expression on differentiation. Over a 5-day period the cell line retained the potential to differentiate as measured by the induction and activation of myoG (Fig. 4Y), troponin I slow ((TNNI1) Fig. 4A(ii)), troponin I fast ((TNNI2) (Fig. 4B(ii)), and repression of {beta}-actin (Fig. 4Z) mRNA expression, respectively, after serum withdrawal.

Most interestingly, the adiponectin receptors 1 and 2 that mediate increased AMP kinase levels, as well as fatty acid oxidation and glucose uptake by adiponectin, were significantly repressed (Fig. 4, I and J). This correlates with the significant repression of glucose transporter 4 (GLUT4) mRNA expression but not glucose transporter 5 (GLUT5) mRNA (Fig. 4, D and E). However, we note that these cell lines express very low levels of the glucose transporters 4/5 (GLUT4/5) transcripts.

Subsequently, we examined the expression of genes involved in fatty acid and lipid absorption, lipid and cholesterol efflux (ATP binding cassette A1 and G1 (ABCA1/G1) and apoE), lipid storage, homeostasis (adipophilin/adipocyte differentiation-related protein (ADRP) and caveolin-3 (Cav-3)), lipogenesis ((SREBP-1c), fatty-acid synthase (FAS), stearoyl-CoA desaturase-1 and -2 (SCD-1 and -2; Fig. 4B and Fig. 4E)), and energy expenditure (uncoupling protein-1, -2, and -3 (UCP-1, -2, and -3)).

In the two polyclonal populations of cells expressing ROR{Delta}E dramatic repression, we observed dramatic reduction in the expression of mRNAs encoding ATP-binding cassette A1 (ABCA1) and apoE but minor/subtle changes in ATP-binding cassette A8/G1 (ABCA1/G1) levels (Fig. 4, N–P). Most interestingly, we observed significantly decreased levels of the mRNA encoding caveolin-3 (Cav-3) (Fig. 4Q), the major structural protein of caveolae in skeletal muscle, which has been implicated in cholesterol homeostasis. Similarly, we observed reduced expression of ADRP mRNA, a protein involved in lipid droplet formation. (Fig. 4R). The mRNAs encoding the hierarchical regulator of lipogenesis, SREBP-1c (Fig. 4S), and the lipogenic genes (SCD-1 and -2 and FAS) (Fig. 4, T–V) were all notably reduced in the ROR{Delta}DE-expressing cell lines. Furthermore, the mRNAs encoding UCP-2 and -3, which encode uncoupling proteins involved in energy uncoupling/expenditure and preferential lipid utilization, were significantly repressed by the expression of ectopic dominant negative ROR{alpha} (Fig. 4, L and M).

Finally, the expression of the closely related but opposingly acting orphan receptors, Rev-erb{alpha} and Rev-erb{beta}/RVR, was further repressed by ROR{Delta}E expression (Fig. 5, A and B). This was expected as ROR{alpha} has been demonstrated to regulate the Rev-erb{alpha} gene.



View larger version (18K):
[in this window]
[in a new window]
  		FIG. 5.
Q-RT-PCR analyses of orphan nuclear receptor expression in the hROR{Delta}DE stably transfected C2C12 cell line. Q-RT-PCR analysis of endogenous mRNAs encoding the closely related Rev-erb and RVR orphan nuclear receptors in two independent populations of native/wild type (wt) differentiated mouse C2C12 cells and two independent polyclonal pools of the C2C12 cells stably transfected with the dominant negative human ROR{Delta}DE expression vector, after 5 days of serum withdrawal, are shown. These cells were denoted as wt C2s and C2:ROR{Delta}DE, respectively. Q-RT-PCR analyses of RVR mRNA expression (A) and Rev-erb{alpha} mRNA expression (B) in wt C2s and C2:ROR{Delta}DE cells. Specific primer sequences and conditions for RVR and Rev-erb Q-RT-PCR are described under "Materials and Methods." Levels of 18 S were measured in all samples, and the results are presented as number of target transcripts per 18 S transcript. For example {beta}-actin is equivalently expressed to 18 S.

 
PGC-1 Efficiently Coactivates the Synthetic and Native RORE Heterologous Reporter Genes—We then investigated the ability of ROR to activate the synthetic and wild type ROR-dependent reporter in COS-1 cells and the ability of the cofactors p300, SRC-2/GRIP-1, and PGC-1 to coactivate ROR-dependent activation of gene expression. We utilized the synthetic ROREx5-tk-LUC reporter that contains five copies of a consensus binding site (24) and the native mPCP-2x4-tk-LUC containing four copies of the mouse Purkinje cell protein-2 RORE motif (25) cloned upstream of the heterologous herpes simplex virus thymidine kinase (tk) promoter linked to the luciferase reporter gene, respectively. As shown, ROR{alpha} expression efficiently activated the expression of the synthetic (Fig. 6A) and native RORE (Fig. 6B)-containing reporters in COS-1 cells several hundredfold. In contrast, ROR{alpha} relatively insignificantly (i.e. <10-fold) regulated the basal tk-LUC-backbone, lacking the RORE (Fig. 6C).



View larger version (22K):
[in this window]
[in a new window]
  		FIG. 6.
PGC-1 acts as a transcriptional coactivator for ROR-mediated activation of the heterologous synthetic and native RORE reporter genes. A, each well of a 24-well plate of COS-1 cells (~60% confluence) was cotransfected with 0.33 µg of the synthetic reporter (i.e. the ROREx5-tk-LUC containing five copies of the TATATCAAGGTCAT sequence), 0.33 µg of either pSG5 or pSG5-ROR{alpha}1, and 0.1 µg of pcDNA expression vectors encoding p300, SRC-2/GRIP-1, and PGC-1 (i.e. a total of ~0.7 µg of DNA per well) by using the liposome-mediated transfection procedure as described previously. Fold activation is expressed relative to LUC activity obtained after cotransfection of the reporter and vector only, arbitrarily set at 1. The mean fold activation values and S.D. (bars) were derived from a minimum of two independent experiments composed of six replicates. B, each well of a 24-well plate of COS-1 cells (~60% confluence) was cotransfected with 0.33 µg of the native reporter (i.e. the mouse PCP-2x4-tk-LUC contains four copies of the native sequence GTTATAGTAACTGGGTCAGGGGACT), 0.33 µg of either pSG5 or pSG5-ROR{alpha}1, and 0.1 µg of pcDNA expression vectors encoding p300, SRC-2/GRIP-1, and PGC-1.(i.e. a total of ~0.7 µg DNA per well) using the liposome-mediated transfection procedure as described. C, each well of a 24-well plate of COS-1 cells (~60% confluence) was cotransfected with 0.33 µg of the tk-LUC vector, 0.33 µg of either pSG5 or pSG5-ROR{alpha}1, and 0.1 µg of pcDNA expression vectors encoding p300, SRC-2/GRIP-1, and PGC-1 (i.e. a total of ~0.7 µg of DNA per well) by using the liposome-mediated transfection procedure as described previously and above.

 
Furthermore, we observed that ROR{alpha}-dependent activation of the synthetic RORE was significantly enhanced by the coactivator, PGC-1, relative to p300 and SRC-2/GRIP-1. Similarly, ROR-dependent activation of the native RORE was most efficiently coactivated by PGC-1, relative to p300 and SRC-2/GRIP-1. In summary, we demonstrate that PGC-1 expression selectively coactivates ROR{alpha}-mediated activation of the heterologous synthetic and native RORE-tk-LUC reporters.

M-CPT-1 and Cav-3 Genes Are Primary Targets of ROR{alpha} in Skeletal Muscle—We further explored the molecular basis of ROR-mediated gene activation in skeletal muscle cells by evaluating whether direct or indirect mechanisms mediated the observed changes in mRNA levels in the ROR{Delta}DE cells. We investigated the responsiveness of the promoters of selected target genes to ROR{alpha} coexpression in a cell-based reporter assay.

We transiently transfected COS-1 cells with the regulatory sequences of selected target genes, including ABCA1 (22), CD36/FAT (37), LPL (38), M-CPT-1 (26), Cav-3, GLUT4, and UCP-2 (39), cloned in front of the pGL2/3 basic luciferase backbone, and we examined the response after cotransfection of ROR{alpha} in the presence and absence of p300, SRC-2/GRIP-1, and PGC-1.

Most interestingly, the M-CPT-1 promoter (and not several other promoters including GLUT4), which contains 1025 bp upstream of the start of translation, was efficiently activated by ROR expression (Fig. 7A). Moreover, we observed that p300 and PGC-1 significantly enhanced the transactivation of the M-CPT-1 (Fig. 7B). The transcriptional coactivators p300 and PGC-1 are expressed in skeletal muscle and have been demonstrated to potentiate myogenesis, mitochondrial biogenesis, oxidative metabolism, fiber type transitions (fast (type II) to slow (type I)), and thermogenesis. Furthermore, we observed similar ROR-dependent activation and cofactor preference with a VP16-ROR{alpha} chimera (Fig. 7C). Most interestingly, the p-mCav3–2595-LUC promoter that encompasses 2595 bp immediately upstream of the murine Cav-3 transcription start site (that drives the expression of the muscle-specific caveolin-3 gene) was also efficiently activated by ROR{alpha} expression (Fig. 8A).



View larger version (24K):
[in this window]
[in a new window]
  		FIG. 7.
The M-CPT-1 promoter is directly activated by ROR and coactivated by p300 and PGC-1. A, each well of a 24-well plate of COS-1 cells (~60% confluence) was cotransfected with either 0.33 µg of pGL2-basic, pGL2-MCPT1(–1025/–12), or pGL2-GLUT4, and 0.33 µg of either pSG5 or pSG5-ROR{alpha}1 (i.e. a total of ~0.66 µg of DNA per well) by using the liposome-mediated transfection procedure as described previously and above (Fig. 6A). B, each well of a 24-well plate of COS-1 cells (~60% confluence) was cotransfected with 0.33 µg of pGL2-MCPT1(–1025/–12), 0.33 µg of either pSG5 or pSG5-ROR{alpha}1, and 0.1 µgof pcDNA expression vectors encoding p300, SRC-2/GRIP-1, and PGC-1 (i.e. a total of ~0.7 µg of DNA per well) using the liposome-mediated transfection procedure as described. C, each well of a 24-well plate of COS-1 cells (~60% confluence) was cotransfected with 0.33 µg of pGL2-MCPT1(–1025/–12), 0.33 µg of either VP16 vector alone or the VP16-ROR{alpha}1 chimera, and 0.1 µg of pcDNA expression vectors encoding p300, SRC-2/GRIP-1, and PGC-1.(i.e. a total of ~0.66 µg of DNA per well) by using the liposome-mediated transfection procedure as described.

 



View larger version (48K):
[in this window]
[in a new window]
  		FIG. 8.
The caveolin-3 promoter is directly activated by ROR{alpha} and coactivated by p300 and SRC-2. A, each well of a 24-well plate of COS-1 cells (~60% confluence) was cotransfected with either 0.33 µg of pGL3-basic and a series of mouse pGL3-mCav3 promoter deletions –2595/+35 (2595), –988/+35 (988), –654/+35 (654), –477/+35 (477), –279/+35 (279), and 0.33 µg of either pSG5 or pSG5-ROR{alpha}1 (i.e. a total of ~0.66 µg of DNA per well) using the liposome-mediated transfection procedure as described above. B, each well of a 24-well plate of COS-1 cells (~60% confluence) was cotransfected with 0.33 µg of pGL3-mCav3-LUC (–2595/+35), 0.33 µg of either pSG5 or pSG5-ROR{alpha}1, and 0.1 µg of pcDNA expression vectors encoding p300, SRC-2/GRIP-1, and PGC-1.(i.e. a total of ~0.7 µg of DNA per well) by using the liposome-mediated transfection procedure as described above. C, sequence of putative RORE motifs (in boldface) identified in the mouse caveolin-3 promoter. TT below the line denotes mutagenesis of the bases above from GG to TT by QuickChange site-directed mutagenesis referred to in F. D, EMSA analysis examining the differential interaction of the six putative RORE motifs in the caveolin-3 promoter (denoted as Cav-3 motifs (m) 1–6) with GST-ROR{alpha}1. 300 cps of PAGE-purified, 32P-end radiolabeled Cav-3 m1–6 were incubated with 0.4 µg of GST-ROR{alpha}1 protein before PAGE separation. The mPCP-2 radiolabeled probe was used as a positive control (see "Materials and Methods"). E, EMSA analysis examining the ability of the six putative m1–6 ROREs (at 10- and 30-fold excess) to efficiently compete the mPCP-2·ROR complex. 32P-Radiolabeled mouse PCP-2 RORE probe was coincubated with 0.4 µg of GST-ROR{alpha}1 protein, and 100 and 300 ng of unlabeled putative Cav-3 m1–6 ROREs before PAGE separation. Cold mPCP-2 and synthetic ROREs were used as the control competitors (see "Materials and Methods"). F, each well of a 24-well plate of COS-1 cells (~60% confluence) was cotransfected with 0.4 µg of pGL3-mCav3-LUC (–2595/+35) or pGL3-mCav3-LUC (–2595/+35) carrying the GG to TT mutations in motifs 2 and 6 (see C) in the presence 0.1 µg of pcDNA or pcDNA-p300 and 0.16 µg of pSG5 or pSG5-ROR{alpha}1 as described under "Materials and Methods."

 
In an attempt to further elucidate which sequences were necessary for the trans-activation of the mCav-3-LUC promoter by ROR{alpha}, we utilized a series of 5' unidirectional deletions in the mCav-3 promoter. Several deletion constructs were produced, namely p-mCav3–988-LUC, p-mCav3–654-LUC, p-mCav3–477-LUC, and p-mCav3–279-LUC, which contained 988, 654, 477, and 279 nucleotides, respectively, of 5'-flanking sequences cloned upstream of the luciferase reporter in pGL2-Basic. By transfecting the full-length and deleted promoters in the absence/presence of the ROR{alpha} expression vector in COS-1 cells, we could demonstrate that the sequences between nucleotide position –2595 and –988 were necessary for ROR{alpha}-dependent activation (Fig. 8A). Moreover, we observed that p300 and SRC-2/GRIP-1 significantly enhanced the transactivation of the mCav-3 promoter. (Fig. 8B).

To define rigorously the molecular basis of direct ROR action, we focused on one of the promoters that we defined as a primary ROR target gene. We selected and scanned the mouse caveolin-3 promoter by the Mat inspector program to identify putative AGGTCA nuclear receptor binding motifs. We observed six putative ROR monomeric binding motifs m1–m6, located between nucleotide positions –2498/–2474, 2378/–2357, –1739/–1713, –1720/–1690, –1587/–1556, and –1005/–984, respectively (Fig. 8C). These motifs to varying degrees could be accommodated by the asymmetric (A/T)6RGGTCA ROR recognition motif and were located in the delimited region between nucleotide positions –2595 and –988 that were necessary for ROR{alpha}-dependent activation.

Subsequently, we examined the ability of the motifs 1–6 to interact with GST-ROR, and we observed that motifs 2 and 4–6 bound ROR with different efficiencies in an EMSA assay, relative to our control ROR recognition motif, the mouse PCP-2 RORE (Fig. 8D). However, we observed that only the m2 and m6 (and the synthetic RORE), but not the m1 and M3–M5 motifs) efficiently competed against the efficient GST-ROR-mPCP-2 RORE interaction (Fig. 8E). This suggested that either motif 2 or 6 mediated ROR activation of the mouse caveolin-3 gene. Hence, we independently mutated the GG nucleotide in the nuclear receptor half-sites to TT in the m2 and m6 putative ROREs within the native caveolin-3 promoter, and we examined the ability of ROR (in the presence of the cofactor p300) to trans-activate the caveolin-3 promoter. We observed that the mutation of motif 6 in the mouse caveolin-3 promoter compromised the ability of ROR to trans-activate the promoter (Fig. 8F). This was also consistent with the analysis of several additional 5' unidirectional deletion mutants of the caveolin-3 promoter between –2595 and –984 that were examined (data not shown).

In summary, these transfections demonstrated that ROR{alpha} directly regulates the CPT-1 and Cav-3 genes that potentially encode proteins involved in {beta}-oxidation and cholesterol homeostasis. Moreover, we defined the specific sequences in a muscle-specific gene (i.e. caveolin-3) that mediated the direct regulation of expression by ROR. This suggests that ROR{alpha} has a central role in the regulation of lipid homeostasis.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
Genetic, molecular, and biochemical studies have demonstrated that NR1F1 (ROR{alpha})-deficient mice develop severe atherosclerosis, low HDL-C, hypo-{alpha}-lipoproteinemia, muscular atrophy, and heightened inflammatory responses. Moreover, NR1F1 regulates the expression of apolipoprotein CIII, a component of HDL and very low density lipoprotein that plays a role in regulation of triglyceride levels and lipoprotein lipase activity. Furthermore, ROR{alpha} potentiates the acquisition of the skeletal muscle phenotype.

The expression of ROR{alpha} in skeletal muscle, a peripheral lean tissue that has a significant role in energy consumption, glucose disposal, and free fatty acid uptake prompted us to investigate the regulatory role of ROR{alpha} in skeletal muscle cells, with respect to gene expression involved in metabolism. Our study demonstrates that ROR{alpha} regulates the expression of genes involved in lipid absorption, {beta}-oxidation, cholesterol efflux, and energy expenditure in skeletal muscle cells. The observed changes in gene expression in skeletal muscle are consistent with the phenotype in this animal model.

The natural ROR{alpha} mouse mutant, called staggerer (sg/sg), is susceptible to high fat diet-induced atherosclerosis, with atherosclerotic lesions in the aorta and the large and small coronary arteries. In the context of this investigation, the staggerer mice exhibit an aberrant blood lipid profile with lower circulating plasma levels of HDL-C (associated with decreased plasma apoA-I and apoA-II), reduced apoCIII, and plasma triglycerides. Decreases in specific lipoprotein compartments, namely apoAI, the major constituent of HDL, and apoAII, leads to a pronounced hypo-{alpha}-lipoproteinemia (16). Accordingly, it has been shown that ROR{alpha} regulates the expression of apoAI and apoCIII in cell culture (16, 17). Further studies in staggerer mice correlate atherogenic susceptibility in this animal model to a complex phenotype that includes aberrant vascular physiology, lipid profiles, and inflammatory responses. However, the contribution of skeletal muscle (atrophied in the ROR{alpha} sg/sg mice) and other putative target tissues to the staggerer phenotype has not been resolved. Finally, ROR{alpha} target genes and the mechanism of action in this metabolically demanding major mass lean tissue remained unclear.

The study by Mamontova et al. (40) demonstrated the ROR{alpha} sg/sg mice have lowered plasma HDL cholesterol. We demonstrate that the muscle cells with attenuated ROR{alpha} expression and function display decreased ABCA1 mRNA expression. Furthermore, we demonstrated that muscle-specific caveolin-3 mRNA expression is compromised in the cell line expressing ROR{Delta}DE. In addition, we demonstrated that the caveolin-3 gene is a direct ROR{alpha} target in muscle cells. Whereas caveolin-3 has not been directly linked to lipid regulation, studies of the non-muscle caveolin family member, caveolin-1, have suggested a role for caveolins in cholesterol transport to extracellular cholesterol acceptors such as HDL; increased caveolin-1 expression increases cholesterol efflux to extracellular acceptors. Furthermore, apoA-I and cholesterol acceptor availability regulates caveolin-1 expression (41, 42). Nonstriated muscle caveolins have also been linked to other aspects of lipid regulation; caveolin-1 and -2 associate with lipid droplets in a fatty acid-regulated fashion in cultured cells and in vivo (43). Moreover, caveolin-1 null mice are resistant to diet-induced obesity (44) and show defective lipid droplet formation in a model system (56). Recent studies (45) showed that caveolin-1 expression increases, and caveolin-2 expression decreases, in white adipose tissue from rodents on a high fat diet. The studies presented here linking ROR{alpha} to the regulation of caveolin-3 and ADRP mRNA expression raises the intriguing possibility that, like the non-muscle caveolins, caveolin-3 may play a role in lipid regulation. This is consistent with studies showing that a caveolin-3 mutant associates with lipid droplets and can perturb the cellular balance of neutral lipids and free cholesterol in cultured cells (43, 46).

We further observed in the cell line expressing ectopic dominant negative ROR{alpha} that expression of genes involved in lipid absorption, lipid catabolism, lipogenesis, and energy expenditure was significantly repressed. This provides further evidence that ROR{alpha} is a critical regulator of lipid homeostasis. Moreover, the repression of SREBP-1c expression and its target genes (for example, FAS, SCD-1, and -2) in the muscle cell line expressing the truncated ROR{alpha}, similar in size and function to the form in the staggerer mouse, is consistent with the reduced plasma triglycerides observed in this animal model. In addition the staggerer mouse has lower apoCIII expression in the liver, which affects lipoprotein metabolism.

The neural degeneration and motor and coordination (i.e. spatial memory) abnormalities in staggerer mice are consistent with the aberrant lipid metabolism observed. Defects in {beta}-oxidation and lipid turnover are associated with neurologic disease (47).

We demonstrate that ROR{alpha} has a significant role in the regulation of the mRNAs encoding the uncoupling proteins (UCP-2 and -3, mitochondrial proton carriers) that control metabolic efficiency, energy expenditure, and thermogenesis by uncoupling an oxidation/respiration-induced proton gradient from ATP synthesis. The repression of UCP mRNA expression correlates and is in concordance with the decreased mRNA expression of genes involved in absorption and utilization of lipids and fatty acids. For example, reduced lipoprotein lipase activity in skeletal muscle results in decreased UCP-3 mRNA expression, consistent with the hypothesis that it regulates the flux of lipid substrates across the mitochondria. Moreover, inhibition of fatty acid oxidation leads to reduced UCP-2 and -3 mRNA expression in slow twitch oxidative muscle fibers. staggerer mice are lean despite their hyperphagia (like Cav-1 mice). The lean phenotype may correlate with the decreased levels of SCD-1 and -2 mRNA observed, although increased brown adipose tissue activity may account for this phenotype.

In addition, we demonstrate that M-CPT-1, an established target for PPAR{alpha} in cardiac muscle (26, 48, 49) and PPAR{beta}/{delta} in skeletal muscle cells, is also directly regulated by ROR{alpha} and coactivated by p300 and PGC-1. Moreover, it suggests crosstalk may occur between PPAR and ROR{alpha} signaling in a tissue-specific manner.

The fact that ROR{alpha} is involved in all of these processes highlights the crucial role of ROR{alpha} in lipid homeostasis and identifies ROR{alpha} as a promising therapeutic target in the treatment of dyslipidemia. Skeletal muscle is rapidly emerging as a critical target tissue in the battle against obesity, type II diabetes, dyslipidemia, syndrome X, and atherosclerosis. For example, NRs in skeletal muscle, such as LXR, PPAR{alpha}, -{beta}/{delta}, and -{gamma}, have been shown to be involved in enhancing the insulin-stimulated glucose disposal rate, decreasing triglycerides, and increasing lipid catabolism, cholesterol efflux, and plasma HDL-C levels (21–23). Hence, orphan NRs (for example ROR) that regulate lipid and carbohydrate metabolism, energy expenditure, and thermogenesis in skeletal muscle have enormous pharmacological utility for the treatment of dyslipidemia and syndrome X. In conclusion, we suggest that ROR in skeletal muscle cells programs a cascade of gene expression designed to regulate lipid homeostasis. We hypothesize that ROR{alpha} is a critical regulator of lipid and energy homeostasis in this major mass of lean tissue. Moreover, we suggest that the atherogenic and dyslipidemic phenotype of the staggerer mouse is related to aberrant ROR{alpha} function in skeletal muscle. Finally, we surmise that ROR agonists may have therapeutic utility in the treatment of hypercholesterolemia, atherosclerosis, and obesity.


   FOOTNOTES
 
* This work was supported in part by a National Health and Medical Research Council of Australia project grant. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

|| Principal Research Fellow of the National Health and Medical Research Council of Australia. Back

** Supported by the National Health and Medical Research Council of Australia and the National Heart Foundation of Australia. Back

{ddagger}{ddagger} To whom correspondence should be addressed. Tel.: 61-7-3346-2039; E-mail: g.muscat{at}imb.uq.edu.au.

1 The abbreviations used are: NR, nuclear hormone receptor; HDL, high density lipoprotein; LXR, liver X receptor; PPAR, peroxisome proliferator-activated receptor; DMEM, Dulbecco's modified Eagle's medium; LUC, luciferase; Q-RT, quantitative real time; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; oligo, oligonucleotide; EMSA, electrophoretic mobility shift analysis; GST, glutathione S-transferase; SREBP, sterol regulatory element binding protein; LPL, lipoprotein lipase; FABP, fatty acid binding protein; FAS, fatty-acid synthase; tk, thymidine kinase; CAT, chloramphenicol acetyltransferase; ADRP, adipophilin/adipocyte differentiation-related protein; Cav, caveolin. Back



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Green, S., and Chambon, P. (1988) Trends Genet. 4, 309–314[CrossRef][Medline] [Order article via Infotrieve]
  2. Evans, R. M. (1988) Science 240, 889–895[Abstract/Free Full Text]
  3. Adelmant, G., Begue, A., Stehelin, D., and Laudet, V. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 3553–3558[Abstract/Free Full Text]
  4. Bonnelye, E., Vanacker, J. M., Desbiens, X., Begue, A., Stehelin, D., and Laudet, V. (1994) Cell Growth Differ. 5, 1357–1365[Abstract]
  5. Retnakaran, R., Flock, G., and Giguere, V. (1994) Mol. Endocrinol. 8, 1234–1244[Abstract/Free Full Text]
  6. Forman, B. M., Chen, J., Blumberg, B., Kliewer, S. A., Henshaw, R., Ong, E. S., and Evans, R. M. (1994) Mol. Endocrinol. 8, 1253–1261[Abstract/Free Full Text]
  7. Dumas, B., Harding, H. P., Choi, H. S., Lehmann, K. A., Chung, M., Lazar, M. A., and Moore, D. D. (1994) Mol. Endocrinol. 8, 996–1005[Abstract/Free Full Text]
  8. Giguere, V., Tini, M., Flock, G., Ong, E., Evans, R. M., and Otulakowski, G. (1994) Genes Dev. 8, 538–553[Abstract/Free Full Text]
  9. Harding, H. P., and Lazar, M. A. (1993) Mol. Cell. Biol. 13, 3113–3121[Abstract/Free Full Text]
  10. Beckerandre, M., Andre, E., and Delamarter, J. F. (1993) Biochem. Biophys. Res. Commun. 194, 1371–1379[CrossRef][Medline] [Order article via Infotrieve]
  11. Carlberg, C., Vanhuijsduijnen, R. H., Staple, J. K., Delamarter, J. F., and Beckerandre, M. (1994) Mol. Endocrinol. 8, 757–770[Abstract/Free Full Text]
  12. Hirose, T., Smith, R. J., and Jetten, A. M. (1994) Biochem. Biophys. Res. Commun. 205, 1976–1983[CrossRef][Medline] [Order article via Infotrieve]
  13. Ortiz, M. A., Piedrafita, F. J., Pfahl, M., and Maki, R. (1995) Mol. Endocrinol. 9, 1679–1691[Abstract/Free Full Text]
  14. Carlberg, C., and Wiesenberg, I. (1995) J. Pineal Res. 18, 171–178[Medline] [Order article via Infotrieve]
  15. Vosper, H., Khoudoli, G. A., Graham, T. L., and Palmer, C. N. (2002) Pharmacol. Ther. 95, 47–62[CrossRef][Medline] [Order article via Infotrieve]
  16. Raspe, E., Duez, H., Gervois, P., Fievet, C., Fruchart, J. C., Besnard, S., Mariani, J., Tedgui, A., and Staels, B. (2001) J. Biol. Chem. 276, 2865–2871[Abstract/Free Full Text]
  17. Vu-Dac, N., Gervois, P., Grotzinger, T., De Vos, P., Schoonjans, K., Fruchart, J. C., Auwerx, J., Mariani, J., Tedgui, A., and Staels, B. (1997) J. Biol. Chem. 272, 22401–22404[Abstract/Free Full Text]
  18. Steinmayr, M., Andre, E., Conquet, F., Rondi-Reig, L., Delhaye-Bouchaud, N., Auclair, N., Daniel, H., Crepel, F., Mariani, J., Sotelo, C., and BeckerAndre, M. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 3960–3965[Abstract/Free Full Text]
  19. Lau, P., Bailey, P., Dowhan, D. H., and Muscat, G. E. (1999) Nucleic Acids Res. 27, 411–420[Abstract/Free Full Text]
  20. Jarvis, C. I., Staels, B., Brugg, B., Lemaigre-Dubreuil, Y., Tedgui, A., and Mariani, J. (2002) Mol. Cell. Endocrinol. 186, 1–5[CrossRef][Medline] [Order article via Infotrieve]
  21. Tanaka, T., Yamamoto, J., Iwasaki, S., Asaba, H., Hamura, H., Ikeda, Y., Watanabe, M., Magoori, K., Ioka, R. X., Tachibana, K., Watanabe, Y., Uchiyama, Y., Sumi, K., Iguchi, H., Ito, S., Doi, T., Hamakubo, T., Naito, M., Auwerx, J., Yanagisawa, M., Kodama, T., and Sakai, J. (2003) Proc. Natl. Acad. Sci. U. S. A. 100, 15924–15929[Abstract/Free Full Text]
  22. Muscat, G. E., Wagner, B. L., Hou, J., Tangirala, R. K., Bischoff, E. D., Rohde, P., Petrowski, M., Li, J., Shao, G., Macondray, G., and Schulman, I. G. (2002) J. Biol. Chem. 277, 40722–40728[Abstract/Free Full Text]
  23. Dressel, U., Allen, T. L., Pippal, J. B., Rohde, P. R., Lau, P., and Muscat, G. E. (2003) Mol. Endocrinol. 17, 2477–2493[Abstract/Free Full Text]
  24. Medvedev, A., Yan, Z. H., Hirose, T., Giguere, V., and Jetten, A. M. (1996) Gene (Amst.) 181, 199–206[CrossRef][Medline] [Order article via Infotrieve]
  25. Matsui, T. (1997) Genes Cells 2, 263–272[Abstract]
  26. Brandt, J. M., Djouadi, F., and Kelly, D. P. (1998) J. Biol. Chem. 273, 23786–23792[Abstract/Free Full Text]
  27. Chen, S. L., Dowhan, D. H., Hosking, B. M., and Muscat, G. E. (2000) Genes Dev. 14, 1209–1228[Abstract/Free Full Text]
  28. Puigserver, P., Wu, Z., Park, C. W., Graves, R., Wright, M., and Spiegelman, B. M. (1998) Cell 92, 829–839[CrossRef][Medline] [Order article via Infotrieve]
  29. Hamilton, B. A., Frankel, W. N., Kerrebrock, A. W., Hawkins, T. L., FitzHugh, W., Kusumi, K., Russell, L. B., Mueller, K. L., van Berkel, V., Birren, B. W., Kruglyak, L., and Lander, E. S. (1996) Nature 379, 736–739[CrossRef][Medline] [Order article via Infotrieve]
  30. McBroom, L. D., Flock, G., and Giguere, V. (1995) Mol. Cell. Biol. 15, 796–808[Abstract]
  31. Wade, R., Sutherland, C., Gahlmann, R., Kedes, L., Hardeman, E., and Gunning, P. (1990) Dev. Biol. 142, 270–282[CrossRef][Medline] [Order article via Infotrieve]
  32. Lloyd, C., Schevzov, G., and Gunning, P. (1992) J. Cell Biol. 117, 787–797[Abstract/Free Full Text]
  33. Brennan, K. J., and Hardeman, E. C. (1993) J. Biol. Chem. 268, 719–725[Abstract/Free Full Text]
  34. Dunwoodie, S. L., Joya, J. E., Arkell, R. M., and Hardeman, E. C. (1994) J. Biol. Chem. 269, 12212–12219[Abstract/Free Full Text]
  35. Shani, M. (1986) Mol. Cell. Biol. 6, 2624–2631[Abstract/Free Full Text]
  36. Shani, M., Dekel, I., and Yoffe, O. (1988) Mol. Cell. Biol. 8, 1006–1009[Abstract/Free Full Text]
  37. Shore, P., Dietrich, W., and Corcoran, L. M. (2002) Nucleic Acids Res. 30, 1767–1773[Abstract/Free Full Text]
  38. Homma, H., Kurachi, H., Nishio, Y., Takeda, T., Yamamoto, T., Adachi, K., Morishige, K., Ohmichi, M., Matsuzawa, Y., and Murata, Y. (2000) J. Biol. Chem. 275, 11404–11411[Abstract/Free Full Text]
  39. Kizaki, T., Suzuki, K., Hitomi, Y., Taniguchi, N., Saitoh, D., Watanabe, K., Onoe, K., Day, N. K., Good, R. A., and Ohno, H. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, 9392–9397[Abstract/Free Full Text]
  40. Mamontova, A., Seguret-Mace, S., Esposito, B., Chaniale, C., Bouly, M., Delhaye-Bouchaud, N., Luc, G., Staels, B., Duverger, N., Mariani, J., and Tedgui, A. (1998) Circulation 98, 2738–2743[Abstract/Free Full Text]
  41. Hailstones, D., Sleer, L. S., Parton, R. G., and Stanley, K. K. (1998) J. Lipid Res. 39, 369–379[Abstract/Free Full Text]
  42. Bist, A., Fielding, P. E., and Fielding, C. J. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 10693–10698[Abstract/Free Full Text]
  43. Pol, A., Martin, S., Fernandez, M. A., Ferguson, C., Carozzi, A., Luetterforst, R., Enrich, C., and Parton, R. G. (2004) Mol. Biol. Cell 15, 99–110[Abstract/Free Full Text]
  44. Razani, B., Combs, T. P., Wang, X. B., Frank, P. G., Park, D. S., Russell, R. G., Li, M., Tang, B., Jelicks, L. A., Scherer, P. E., and Lisanti, M. P. (2002) J. Biol. Chem. 277, 8635–8647[Abstract/Free Full Text]
  45. Lopez, I. P., Milagro, F. I., Marti, A., Moreno-Aliaga, M. J., Martinez, J. A., and De Miguel, C. (2004) Biochem. Biophys. Res. Commun. 318, 234–239[CrossRef][Medline] [Order article via Infotrieve]
  46. Pol, A., Luetterforst, R., Lindsay, M., Heino, S., Ikonen, E., and Parton, R. G. (2001) J. Cell Biol. 152, 1057–1070[Abstract/Free Full Text]
  47. Forss-Petter, S., Werner, H., Berger, J., Lassmann, H., Molzer, B., Schwab, M. H., Bernheimer, H., Zimmermann, F., and Nave, K. A. (1997) J. Neurosci. Res. 50, 829–843[CrossRef][Medline] [Order article via Infotrieve]
  48. Huss, J. M., Levy, F. H., and Kelly, D. P. (2001) J. Biol. Chem. 276, 27605–27612[Abstract/Free Full Text]
  49. Barger, P. M., Brandt, J. M., Leone, T. C., Weinheimer, C. J., and Kelly, D. P. (2000) J. Clin. Investig. 105, 1723–1730[Medline] [Order article via Infotrieve]
  50. Burke, L., Downes, M., Carozzi, A., Giguere, V., and Muscat, G. E O. (1996) Nucleic Acids Res. 24, 3481–3489[Abstract/Free Full Text]
  51. Downes, M., Carozzi, A. J., and Muscat, G. E. O. (1995) Mol. Endocrinol. 9, 1666–1678[Abstract/Free Full Text]
  52. Dowhan, D. H., Downes, M., Sturm, R. A., and Muscat, G. E. (1994) Endocrinology 135, 2592–2607
  53. Preitner, N., Damiola, F., Lopez-Molina, L., Zakany, J., Duboule, D., Albrecht, U., and Schibler, U. (2002) Cell 110, 251–260[CrossRef][Medline] [Order article via Infotrieve]
  54. Yamauchi, T., Kamon, J., Ito, Y., Tsuchida, A., Yokomizo, T., Kita, S., Sugiyama, T., Miyagishi, M., Hara, K., Tsunoda, M., Murakami, K., Ohteki, T., Uchida, S., Takekawa, S., Waki H., Tsuno, N. H., Shibata, Y., Terauchi, Y., Froguel, P., Tobe, K., Koyasu, S., Taira, K., Kitamura, T., Shimuzu, T., Nagai, R., and Kadowaki, T. (2003) Nature 423, 762–769[CrossRef][Medline] [Order article via Infotrieve]
  55. Curlewis, J. D., Tam, S. P., Lau, P., Kusters, D. H., Barclay, J. L., Anderson, S. T., and Waters, M. J. (2002) Endocrinology 143, 3984–3993[Abstract/Free Full Text]
  56. Cohen, A. W., Razani, B., Schubert, W., Williams, T. M., Wang, X. B., Iyengar, P., Brasaemle, D. L., Scherer, P. E., and Lisanti, M. P. (2004) Diabetes 53, 1261–1270[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 EndocrinologyHome page
M. Barnea, Z. Madar, and O. Froy
High-Fat Diet Delays and Fasting Advances the Circadian Expression of Adiponectin Signaling Components in Mouse Liver
Endocrinology, January 1, 2009; 150(1): 161 - 168.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Endocrinol.Home page
S. Hummasti and P. Tontonoz
Adopting New Orphans into the Family of Metabolic Regulators
Mol. Endocrinol., August 1, 2008; 22(8): 1743 - 1753.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
P. Lau, R. L. Fitzsimmons, S. Raichur, S.-C. M. Wang, A. Lechtken, and G. E. O. Muscat
The Orphan Nuclear Receptor, ROR{alpha}, Regulates Gene Expression That Controls Lipid Metabolism: STAGGERER (SG/SG) MICE ARE RESISTANT TO DIET-INDUCED OBESITY
J. Biol. Chem., June 27, 2008; 283(26): 18411 - 18421.
[Abstract] [Full Text] [PDF]

Home page
 Diabetes and Vascular Disease ResearchHome page
H. Duez and B. Staels
The nuclear receptors Rev-erbs and RORs integrate circadian rhythms and metabolism
Diabetes and Vascular Disease Research, June 1, 2008; 5(2): 82 - 88.
[Abstract] [PDF]

Home page
 Hum Mol GenetHome page
L. Love-Gregory, R. Sherva, L. Sun, J. Wasson, T. Schappe, A. Doria, D.C. Rao, S. C. Hunt, S. Klein, R. J. Neuman, et al.
Variants in the CD36 gene associate with the metabolic syndrome and high-density lipoprotein cholesterol
Hum. Mol. Genet., June 1, 2008; 17(11): 1695 - 1704.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
M. A. Pearen, S. A. Myers, S. Raichur, J. G. Ryall, G. S. Lynch, and G. E. O. Muscat
The Orphan Nuclear Receptor, NOR-1, a Target of {beta}-Adrenergic Signaling, Regulates Gene Expression that Controls Oxidative Metabolism in Skeletal Muscle
Endocrinology, June 1, 2008; 149(6): 2853 - 2865.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
D. Zhou, R. Shen, J. J. Ye, Y. Li, W. Tsark, D. Isbell, P. Tso, and S. Chen
Nuclear Receptor Coactivator PNRC2 Regulates Energy Expenditure and Adiposity
J. Biol. Chem., January 4, 2008; 283(1): 541 - 553.
[Abstract] [Full Text] [PDF]

Home page
 Physiol. GenomicsHome page
H. S. Kang, M. Angers, J. Y. Beak, X. Wu, J. M. Gimble, T. Wada, W. Xie, J. B. Collins, S. F. Grissom, and A. M. Jetten
Gene expression profiling reveals a regulatory role for ROR{alpha} and ROR{gamma} in phase I and phase II metabolism
Physiol Genomics, October 19, 2007; 31(2): 281 - 294.
[Abstract] [Full Text] [PDF]

Home page
 Physiol. GenomicsHome page
J. J. McCarthy, J. L. Andrews, E. L. McDearmon, K. S. Campbell, B. K. Barber, B. H. Miller, J. R. Walker, J. B. Hogenesch, J. S. Takahashi, and K. A. Esser
Identification of the circadian transcriptome in adult mouse skeletal muscle
Physiol Genomics, September 11, 2007; 31(1): 86 - 95.
[Abstract] [Full Text] [PDF]

Home page
 Arterioscler. Thromb. Vasc. Bio.Home page
D. F. Reilly, E. J. Westgate, and G. A. FitzGerald
Peripheral Circadian Clocks in the Vasculature
Arterioscler. Thromb. Vasc. Biol., August 1, 2007; 27(8): 1694 - 1705.
[Abstract] [Full Text] [PDF]

Home page
 J Mol EndocrinolHome page
S. Raichur, P. Lau, B. Staels, and G. E O Muscat
Retinoid-related orphan receptor {gamma} regulates several genes that control metabolism in skeletal muscle cells: links to modulation of reactive oxygen species production
J. Mol. Endocrinol., July 1, 2007; 39(1): 29 - 44.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
A.-C. Durieux, A. Amirouche, S. Banzet, N. Koulmann, R. Bonnefoy, M. Pasdeloup, C. Mouret, X. Bigard, A. Peinnequin, and D. Freyssenet
Ectopic Expression of Myostatin Induces Atrophy of Adult Skeletal Muscle by Decreasing Muscle Gene Expression
Endocrinology, July 1, 2007; 148(7): 3140 - 3147.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
M. A. Pearen, J. G. Ryall, M. A. Maxwell, N. Ohkura, G. S. Lynch, and G. E. O. Muscat
The Orphan Nuclear Receptor, NOR-1, Is a Target of {beta}-Adrenergic Signaling in Skeletal Muscle
Endocrinology, November 1, 2006; 147(11): 5217 - 5227.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
D. M. Presman, E. Hoijman, N. R. Ceballos, M. D. Galigniana, and A. Pecci
Melatonin Inhibits Glucocorticoid Receptor Nuclear Translocation in Mouse Thymocytes
Endocrinology, November 1, 2006; 147(11): 5452 - 5459.
[Abstract] [Full Text] [PDF]

Home page
 DevelopmentHome page
L. Palanker, A. S. Necakov, H. M. Sampson, R. Ni, C. Hu, C. S. Thummel, and H. M. Krause
Dynamic regulation of Drosophila nuclear receptor activity in vivo
Development, September 15, 2006; 133(18): 3549 - 3562.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
S. A. Myers, S.-C. M. Wang, and G. E. O. Muscat
The Chicken Ovalbumin Upstream Promoter-Transcription Factors Modulate Genes and Pathways Involved in Skeletal Muscle Cell Metabolism
J. Biol. Chem., August 25, 2006; 281(34): 24149 - 24160.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Cell Physiol.Home page
A. G. Smith and G. E. O. Muscat
Orphan nuclear receptors: therapeutic opportunities in skeletal muscle
Am J Physiol Cell Physiol, August 1, 2006; 291(2): C203 - C217.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Pharmacol.Home page
R. S. Savkur, K. S. Bramlett, K. R. Stayrook, S. Nagpal, and T. P. Burris
Coactivation of the Human Vitamin D Receptor by the Peroxisome Proliferator-Activated Receptor {gamma} Coactivator-1 {alpha}
Mol. Pharmacol., August 1, 2005; 68(2): 511 - 517.
[Abstract] [Full Text] [PDF]

Home page
 Arterioscler. Thromb. Vasc. Bio.Home page
S.-O. Olofsson
ApoA-V: The Regulation of a Regulator of Plasma Triglycerides
Arterioscler. Thromb. Vasc. Biol., June 1, 2005; 25(6): 1097 - 1099.
[Full Text] [PDF]

Home page
 Arterioscler. Thromb. Vasc. Bio.Home page
A. Genoux, H. Dehondt, A. Helleboid-Chapman, C. Duhem, D. W. Hum, G. Martin, L. A. Pennacchio, B. Staels, J. Fruchart-Najib, and J.-C. Fruchart
Transcriptional Regulation of Apolipoprotein A5 Gene Expression by the Nuclear Receptor ROR{alpha}
Arterioscler. Thromb. Vasc. Biol., June 1, 2005; 25(6): 1186 - 1192.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
M. A. Maxwell, M. E. Cleasby, A. Harding, A. Stark, G. J. Cooney, and G. E. O. Muscat
Nur77 Regulates Lipolysis in Skeletal Muscle Cells: EVIDENCE FOR CROSS-TALK BETWEEN THE {beta}-ADRENERGIC AND AN ORPHAN NUCLEAR HORMONE RECEPTOR PATHWAY
J. Biol. Chem., April 1, 2005; 280(13): 12573 - 12584.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
S. N. Ramakrishnan, P. Lau, L. J. Burke, and G. E. O. Muscat
Rev-erb{beta} Regulates the Expression of Genes Involved in Lipid Absorption in Skeletal Muscle Cells: EVIDENCE FOR CROSS-TALK BETWEEN ORPHAN NUCLEAR RECEPTORS AND MYOKINES
J. Biol. Chem., March 11, 2005; 280(10): 8651 - 8659.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
279/35/36828    most recent
M404927200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lau, P.
Right arrow Articles by Muscat, G. E. O.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lau, P.
Right arrow Articles by Muscat, G. E. O.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2004 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement