HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 279, Issue 37, 38249-38259, September 10, 2004

This Article Abstract Full Text (PDF) All Versions of this Article: 279/37/38249    most recent M405377200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Expert-Bezançon, A. Articles by Marie, J. Search for Related Content PubMed PubMed Citation Articles by Expert-Bezançon, A. Articles by Marie, J. Social Bookmarking                      What's this?

hnRNP A1 and the SR Proteins ASF/SF2 and SC35 Have Antagonistic Functions in Splicing of -Tropomyosin Exon 6B^*

Alain Expert-Bezançon, Alain Sureau, Patrice Durosay, Roland Salesse, Herman Groeneveld, Jean Pierre Lecaer¶, and Joëlle Marie||

From the Centre de Génétique Moléculaire, CNRS UPR 2167, Laboratoire Propre Associé à l'Université Pierre et Marie Curie, 91198 Gif-sur-Yvette, France, Unité Récepteur et Communication, INRA, 78352 Jouy-en-Josas, France, and ^¶Ecole Supérieure de Physique et de Chimie Industrielles (ESPCI), 10 Rue Vauquelin, 75005 Paris, France

Received for publication, May 14, 2004 , and in revised form, June 16, 2004.

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
Mutually exclusive splicing of exons 6A and 6B from the chicken -tropomyosin gene involves numerous regulatory sequences. Previously, we identified a G-rich intronic sequence (S3) downstream of exon 6B. This element consists of six G-rich motifs, mutations of which abolish splicing of exon 6B. In this paper, we investigated the cellular factors that bind to this G-rich element. By using RNA affinity chromatography, we identified heterogeneous nuclear ribonucleoprotein (hnRNP) A1, the SR proteins ASF/SF2 and SC35, and hnRNP F/H as specific components that are assembled onto the G-rich element. By using hnRNP A1-depleted HeLa nuclear extract and add-back experiments, we show that hnRNP A1 has a negative effect on splicing of exon 6B. In agreement with in vitro data, artificial recruitment of hnRNP A1, as a fusion with the MS2 coat protein, also represses splicing of exon 6B ex vivo. In contrast, ASF/SF2 and SC35 activate splicing of exon 6B. As observed with other systems, hnRNP A1 counteracts the stimulating effect of the SR proteins. Moreover, cross-linking experiments show that both ASF/SF2 and SC35 are able to displace binding of hnRNP A1 to the G-rich element, suggesting that the binding sites for these proteins are overlapping. These data indicate that the G-rich sequence is a composite element that acts as an enhancer or as a silencer, depending on which proteins bind to them.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
Splicing is the process by which introns from premessenger RNAs are removed in eukaryotes. Pre-mRNA splicing takes place within the spliceosome, which is a large, highly dynamic complex composed of four small ribonucleoprotein particles (snRNP¹ U1, U2, U4/U6, and U5) and multiple non-snRNP factors (1, 2). One of the most intriguing questions that remains in RNA splicing is how the 5' and 3' splice sites are selected and paired together within large RNA sequences (3). This question takes on particular importance in alternative splicing, where the selection of certain splice sites is modulated depending on the developmental stage, on tissue differentiation, or on metabolic changes of the cells (3). Numerous studies have demonstrated that regulatory sequences within the pre-mRNA that lie outside the splicing signals play a crucial role in controlling the choice of splicing sites in a given cellular context (reviewed in Refs. 4 and 5).

Among these sequences are the splicing enhancers. These elements are found in a wide variety of metazoan pre-mRNAs, either within exons or introns. Purine-rich splicing enhancers (known as ESE) are a well characterized class of exonic splicing enhancers that mostly interact with specific subsets of SR proteins (reviewed in Refs. 6 and 7). SR proteins belong to a family of essential splicing factors that are highly conserved between Drosophila and mammals and that are involved in both constitutive and regulated splicing events (reviewed in Refs. 8 and 9). It has been proposed that the function of SR proteins is to stimulate the recognition of weak upstream 3' splice sites, by recruiting U2AF^65/35, or to facilitate U1 snRNP binding to the 5' splice site (reviewed in Ref. 4). It also has been proposed that ASF/SF2 bound to an ESE element antagonizes the function of hnRNP A1 bound to a juxtaposed exonic silencer element by impairing the propagation of cooperative binding of hnRNP A1 along the exon (10).

Intronic splicing enhancers are another class of elements that have been identified in numerous pre-mRNAs (reviewed in Ref. 4). Analyses of intronic splicing enhancers reveal that most of them have a multipartite structure composed of several distinct motifs that are shared by different intronic splicing enhancers. It was first noticed that there is an enrichment in G triplets and quartets downstream of 5' splice sites by computer analysis of human intronic sequences, and it was suggested that they play a role in the splicing process (11). Subsequent studies demonstrated that G-rich motifs are involved in the regulation of alternative splicing of numerous pre-mRNAs. Depending on their position within the pre-mRNA and on the proteins that bind to them, G-rich elements have been shown to function as enhancer or silencer elements. In the case of the cardiac troponin T pre-mRNA, it has been shown that multiple GGGGCUG intronic motifs are required to promote the recognition of the 6-nucleotide microexon 17 (12). It has been suggested that the binding of SF1 to these motifs extends the domain of the microexon, which facilitates exon recognition during early events of spliceosome assembly (13). The inclusion of the c-src N1 exon in neuronal cells requires an intronic regulatory element, named the downstream control element, that is made up of an array of individual motifs that bind to different proteins of the hnRNP family (14, 15). Within the downstream control element, a GGGGGCUG motif has been shown to activate splicing of the N1 exon through its interactions with hnRNP H and F (14, 16). In contrast, the GUGGG motif at the 5' end of the skeletal exon of the rat -tropomyosin pre-mRNA acts as a negative regulator through its interaction with hnRNP H (17). Several G tracts have been found in an intronic enhancer element that stimulate splicing of the thyroid hormone receptor gene (18). This element interacts with hnRNP H (18). Another class of G-rich motifs, which bears homology with the high affinity hnRNP A1 binding site UAGGGU, also is involved in the inhibition of splicing of various pre-mRNAs (19–31). In those cases, it has been shown that the repression is mediated through its interaction with hnRNP A1. Recent surveys of genomic human sequences that inhibit splicing have also identified several sequences enriched for G-triplets that are capable of promoting exon skipping (32, 33).

In a previous study, we identified an intronic G-rich element downstream of exon 6B from the chicken -tropomyosin gene that is thought to be essential for activating splicing between exons 6B and 7 (34). This sequence, called S3, contains several G triplets and quartets, which we have arbitrary divided into three elements. The RG1 element contains a GGGGCUG and an overlapping UGGGC motif. The RG2 element contains two AGGGU motifs flanking a GGGGA motif, and the RG3 element contains a UGGGGU motif (Fig. 1). Mutations of the six G motifs abolish the splicing of the intron downstream of exon 6B and inhibit spliceosomal assembly, suggesting that the G-rich element acts as an enhancer (34). In the present work, we analyze the proteins that are assembled onto the S3 G-rich sequence by RNA affinity chromatography. We identify the proteins hnRNP A/B, hnRNP F/H, ASF/SF2, and SC35 as specific proteins associated with the S3 element. Depletion and add-back experiments combined with ex vivo analysis show that hnRNP A1 inhibits splicing of exon 6B. In contrast, ASF/SF2 and SC35 activate in vitro splicing of exon 6B. We demonstrate that hnRNP A1 counteracts the stimulatory effect of ASF/SF2 and SC35. In addition, we show that both ASF/SF2 and SC35 are able to displace bound hnRNP A1 on the S3 element. These data suggest that the G-rich intronic element shares overlapping or juxtaposed motifs that act as enhancer or silencer depending on the interacting proteins.

View larger version (54K): [in this window] [in a new window]   FIG. 1. The G-rich S3 element interacts with cellular factors. A, schematic representation of the pre-mRNA pSma containing exon 6B (76 nt), exon 7 (41 nt), and the intron between them (125 nt). The S3 sequence is represented with the G motifs in boldface type. The three elements, RG1, RG2, and RG3, are indicated. The mut S3 RNA, in which the G motifs have been mutated, is noted below the wild-type sequence. B, in vitro splicing of pSma pre-mRNA in the presence of an excess of unlabeled RNA competitor. Labeled pre-mRNA was incubated under splicing conditions with 30% HeLa nuclear extract for the indicated times in the absence or in the presence of 8 and 16 pmol of S3 or mut S3 RNA competitors. The products of the splicing reaction were separated by 5% acrylamide, denaturing gel electrophoresis and quantified with a PhosphorImager. The identity of the splicing products is shown at the left. C, gel mobility assays of S3 and mut S3 RNAs with HeLa nuclear extract. Labeled RNAs were incubated under splicing conditions with 30% nuclear extract. Lanes 1 and 4, S3 and mut S3 RNA alone without extract; lanes 2 and 5, S3 and mut S3 RNA incubated with extract at 0 °C; lanes 3 and 6, S3 and mut S3 RNA incubated with extract at 30 °C for 15 min. D, competition experiments with an excess of S3 and mut S3 RNA. The S3 sequence was incubated with 30% nuclear extract (lane 2) and with either 8 pmol (lanes 3 and 5) or 16 pmol (lanes 4 and 6) of the indicated RNA competitor. Lane 1, S3 RNA alone without nuclear extract. The brackets indicate RNA-protein complexes.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

View larger version (94K): [in this window] [in a new window]   FIG. 3. hnRNP A1 interacts with the central RG2 motif. Labeled RNAs were incubated for 20 min at 30 °C with increasing concentrations of recombinant hnRNP A1. RNA-protein complexes were separated on 8% nondenaturing PAGE. A, A1 winner RNA: UAUGAUAGGGACUUAGGGUG (19). B, RG2 RNA: GCAGGGUUGAGGGGAGCAGGGUC. Both RNAs contain in addition a GAAUAC sequence derived from the polylinker.

HeLa cell nuclear extracts were purchased from A. Miller (Computer Cell Center, Mons, Belgium) and prepared as described (41, 42). Splicing reactions were performed with 20 fmol of ³²P-labeled pre-mRNA in 10-µl reactions with 30% HeLa nuclear extract, except when indicated (36). Competitor RNA and recombinant proteins were added to the splicing reaction on ice prior to adding the labeled pre-mRNA. Reaction products were analyzed on 5% denaturing polyacrylamide gels except when indicated. RNA bands were quantified using a PhosphorImager (Amersham Biosciences). Splicing efficiency was calculated as the ratio between the mRNA value and the sum of the pre-mRNA value plus the mRNA value. For each RNA, the number of uracil residues was taken into account for the calculated splicing efficiency.

RNA Mobility Shift Assays—RNA mobility shift assays were performed as described elsewhere (43). Capped RNAs (20 fmol) were incubated under standard splicing conditions with 30% HeLa nuclear extract. The protein-RNA complexes were separated by nondenaturing gel electrophoresis in 4% acrylamide gels (acrylamide/bisacrylamide, 29:1) using 0.5x TBE as the running buffer. In competition experiments, unlabeled S3 or mut S3 RNA were preincubated for 5 min at 30 °C in the presence of 30% nuclear extracts prior to the addition of labeled S3 or mut S3 RNA. For gel shift assays, GST-A1 was cleaved by thrombin (44). RNA-hnRNP A1 complexes were formed by incubating 1 µl of hnRNP A1 (0–500 nM) in 10 µl of buffer D (12 mM Hepes, pH 8, 60 mM KCl, 1 mM dithiothreitol, and 12% glycerol), 20 ng/ml acetylated bovine serum albumin, 2 units/µl RNasin, and 1 µl of labeled RNA (10 fmol) for 20 min at 30 °C. The complexes were run on a nondenaturing 8% polyacrylamide gel (acrylamide/bisacrylamide, 80:1) containing 50 mM Tris-glycine, pH 8.3. The hnRNP A1 complexes were visualized on a PhosphorImager.

RNA Affinity Chromatography, Mass Spectrometry Analysis, and Western Blotting—Coupling to streptavidin-agarose and affinity purification of protein complexes were performed as described elsewhere (45). Proteins were separated on two-dimensional gel electrophoresis. The first dimension was a nonequilibrium pH gradient gel electrophoresis (NEPHGE) using ampholytes 3.5–9.5 (46). The second dimension was a 7.5% PAGE (47). The selected proteins were visualized by silver staining or Coomassie Brilliant Blue G-250. The protein spots were excised from the gel, digested in gel with trypsin, and identified by mass spectrometry (45).

For Western blot analysis of affinity-selected proteins, 100 pmol of RNA bound to 25 µl of streptavidin-agarose beads were incubated with 500 µl of 30% HeLa nuclear extracts under splicing conditions without polyvinylalcohol and rotated 5 min at 30 °C. After washing, proteins were released from the beads by mixing twice in 66% glacial acetic acid and 33 mM MgCl₂ for 30 min at 4 °C and then proceeded as described elsewhere (45). The proteins were dissolved in 250 µl of SDS-sample buffer. Proteins were separated on a 12% SDS-polyacrylamide gel, electroblotted onto a nitrocellulose membrane, and probed with the following antibodies: anti-hnRNP A1 monoclonal antibodies 9H10 (a gift from Dr. G. Dreyfuss), anti-hnRNP F/H monoclonal antibodies 1G11 [PDB] (a gift from Dr. G. Dreyfuss), rabbit polyclonal antibodies against the C-terminal peptide of hnRNP F (a gift from Dr. Black), monoclonal antibodies against the N-terminal peptide of ASF/SF2 (a gift from Dr. J. Stévenin), monoclonal antibodies against the C-terminal peptide of SC35 (a gift from Dr. J. Stévenin), and monoclonal antibody mAb 104 monoclonal antibodies (a gift from Dr. Roth). The bands were detected with the SuperSignal West Pico detection kit (Pierce).

Protein Purification—Total SR proteins from HeLa cells were prepared as described elsewhere (48). GST-hnRNP A1 (a gift from Dr. B. Chabot) was expressed in Escherichia coli BL21 (DE3) and purified using glutathione-Sepharose beads (Amersham Biosciences) according to the protocol described by the manufacturer. The untagged hnRNP A1 expression vector (pET9d) was expressed in Escherichia coli BL21 (DE3), and the protein was purified as described (49). Recombinant proteins ASF/SF2 and SC35 expressed in baculovirus and purified from Sf9 cells were a gift from Dr. J. Stévenin (40). Recombinant GST-ASF/ SF2 RS and GST-SC35 RS proteins cloned into the pGEX vector were a gift from Dr. J. Stévenin (50).

Affinity Depletion of hnRNP A1—HnRNP A1 was depleted from HeLa nuclear extracts using a biotinylated oligonucleotide (TTAGGGTTAGGGGTTAGGGTTAGGG) coupled to streptavidin-agarose beads (50 µmol/100 µl of beads). The interaction between the oligonucleotide and the beads was for 2 h at 4 °C. After washing the beads with buffer D, 100 µl of nuclear extract were added (v/v), and the mix was rotated for 2hat4 °C. The beads were pelleted, and the supernatants were used as hnRNP A1-depleted extract. Mock-depleted nuclear extract was made in the same conditions but with the beads alone. Proteins were separated on a 10% SDS-polyacrylamide gel, transferred to a nitrocellulose membrane, and probed with monoclonal antibodies as described above.

UV Cross-linking Experiments—³²P-Uniformly labeled RNAs were synthesized with [-³²P]UTP and [-³²P]GTP as described above. 12.5 fmol of RNAs were incubated in a 12.5-µl reaction mixture containing 5% HeLa nuclear extracts under splicing conditions without polyvinyl-alcohol and the indicated amount of recombinant proteins. In competition experiments without nuclear extracts, 0.1 µg of tRNA were added as a nonspecific competitor. After a 15-min incubation at 30 °C, the samples were irradiated on ice for 15 min in a UV (254 nm) Stratalinker and treated with 1 mg/ml RNase A and 10 units of RNase T1 at 37 °C for 30 min. The cross-linked proteins were resolved on a 12% SDS-polyacrylamide gel and visualized by a PhosphorImager.

Transfections and RNA Analysis—QM7 quail myogenic cells were plated at a density of 5 x 10⁵ cells/60-mm diameter tissue culture dish in Dulbecco's modified Eagle's medium with 4500 mg/liter D-glucose supplemented with 10% fetal bovine serum and 2% chick serum. The next day, the cells were transfected with 1 µg of minigene DNA and 0.5 and 1 µg of coat or coat fusion hnRNP A1 expression vectors using FuGene 6 (Roche Applied Science) according to the manufacturer's recommendations. Forty-eight hours later, RNA was harvested from cells using Tri Reagent^TM (Sigma), treated by RQ1 DNase I, and analyzed by RT-PCR. Reverse transcription was performed with oligo(dT) and superscript II reverse transcriptase (Invitrogen) for 60 min at 42 °C. PCR was carried out with one-twentieth of the RT reaction in 50-µl reactions with 0.3 µM primers, 200 µM dNTPs, 2 µCi of [-³²P]dCTP, and 2 units of Dynazyme Taq polymerase (Finnzyme). For -tropomyosin, primers were T7 (5'-TACGACTCACTATAGGGAGAC-3'), 6A rev (5'-GCAATGAGGGATTTGAGGCTC-3'), 6B rev (5'-CAGCTCCTCCTCTAGGTCAC-3'), 6B sense (5'-TAAATGTGGTGACCTAGAGGAG-3'), and bovine growth hormone rev (5'-ACTAGAAGGCACAGTCGAGG-3'). For -actin, primers were -actin forward (5'-CATGTTTGAGACCTTCAACAC-3') and -actin reverse (5'-GTGGTGGTGAAGCTGTAGCC-3'). Cycling conditions were as follows: 94 °C for 45 s, 54 °C for 45 s, 72 °C for 45 s (22 cycles for tropomyosin minigene and 25 cycles for -actin). PCR products were resolved on 6% denaturing polyacrylamide gels and quantified using a PhosphorImager.

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
The G-rich Regulatory Sequence Interacts with Specific Proteins—In a previous paper (34), we showed that the splicing of the intron downstream of exon 6B is stimulated by a G-rich intronic element (named S3). To test whether this element interacts with specific cellular factors, we performed splicing competition experiments with a pre-mRNA containing exon 6B/intron/exon 7 (Fig. 1A, pSma). The RNA used as a competitor contained the wild-type sequence from 21 to 73 nt down-stream of exon 6B (Fig. 1A). As a control, we used an RNA (named mut S3) in which the G-rich motifs had been mutated (Fig. 1A). The addition of 16 pmol of unlabeled S3 RNA dramatically decreased exon 6B to 7 splicing (Fig. 1B). After 2 h of incubation, splicing efficiency was reduced 3-fold as compared with that without an RNA competitor (Fig. 1B). In contrast, the addition of the same amount of the mut S3 RNA had no effect on or even slightly stimulated the splicing of exon 6B to 7 (Fig. 1B). Splicing inhibition was sequence-specific, because splicing of Adeno pre-mRNA was not affected by the addition of the S3 RNA competitor (data not shown). These results suggested that the stimulatory effect on exon 6B-7 splicing was mediated by cellular factors that specifically interacted with the G-rich element. This assumption was confirmed by gel retardation assays. Incubation of the S3 RNA under splicing conditions with a 30% nuclear extract resulted in a specific high molecular weight complex that did not form with the mut S3 RNA (Fig. 1C). Assembly of this specific complex was very rapid, since it was formed in the first minutes of incubation on ice (Fig. 1C). A faster migrating complex was also observed, whose mobility was approximately the same as the complex formed with the mut S3 RNA (Fig. 1C, lanes 5 and 6). Raising the nuclear extract concentration to 60% did not modify the pattern of the protein complexes; nor did it alter their specificity (data not shown). In agreement with in vitro splicing experiments, the addition of an excess of unlabeled S3 RNA significantly reduced complex formation, whereas the addition of the same molar excess of unlabeled mut S3 RNA had no effect (Fig. 1D, compare lanes 3 and 4 with lanes 5 and 6). Altogether, these results suggested that the G-rich element interacted with cellular factors in a sequence-specific manner.

HnRNP A1 Is a Component of Regulatory Complexes That Binds to the S3 Element—To identify proteins that bind to S3, we used an RNA chromatography method. Biotinylated S3 RNA or its mutated version mut S3, were bound to streptavidin-agarose beads and incubated with 30% HeLa nuclear extracts under standard splicing conditions (45). Since specific complexes assemble very rapidly, the incubation time was for 5 min at 30 °C. After washing, the purified complexes were eluted, and the proteins were separated by two-dimensional gel electrophoresis with a nonequilibrium pH gradient in the first dimension, and the gel was then analyzed by silver staining. Fig. 2 shows that both the S3 and mut S3 RNAs were associated with various proteins. A comparison of the protein pattern revealed proteins that were specifically associated with the S3 element. Remarkably, there was a group of basic proteins with molecular mass ranging from 33 to 46 kDa (indicated by an inset in Fig. 2, left panel) that had a two-dimensional gel electrophoresis pattern that closely resembled the one reported for the hnRNP A/B group (51). Mass spectrometry analysis and immunoblotting with antibodies against the hnRNP A1 confirmed that these proteins belonged to hnRNP from A/B group. Northwestern analysis revealed that only hnRNP A1, hnRNP A2, and a third protein of 70 kDa directly contacted the S3 element (data not shown). To determine the minimal RNA motif required to bind to hnRNP A1, gel shift experiments were performed with shortened versions of the S3 sequence. The central region, named RG2, binds to hnRNP A1 to the same extent as S3 (data not shown). The RG2 motif contains two AGGGU that closely resemble the hnRNP A1 "winner" sequence identified by the SELEX approach (19). In agreement with this observation, hnRNP A1 interacted with RG2 with a high affinity, albeit lower than did the A1 "winner" sequence (Fig. 3, A and B). In addition, a protein complex that migrated more slowly was formed at the highest hnRNP A1 concentrations (Fig. 3A, RNA-protein Complex II). This complex was not formed with the A1 "winner" sequence, which excluded the possibility that the formation of this complex was due to aggregations of the hnRNP A1 molecules (Fig. 3, A and B). Altogether, these results showed that the hnRNP A1 was a specific component of the G-rich complex that assembled onto the S3 regulatory sequence.

View larger version (61K): [in this window] [in a new window]   FIG. 2. Proteins are specifically associated with the S3 sequence. Affinity-selected proteins purified from S3 (left) and mut S3 RNA (right) were separated by two-dimensional gel electrophoresis and silver-stained. The black arrows and the inset represent specific proteins assembled on the S3 RNA. The open arrow represents specific proteins associated with mut S3 RNA. Sizes of molecular mass markers are shown.

View larger version (43K): [in this window] [in a new window]   FIG. 4. Mutations in hnRNP A1 RG2 binding site represses in vitro splicing of exon 6B. A, schematic representation of pPmac pre-mRNAs containing 135 nt of the intronic sequence upstream of exon 6B, exon 6B, intron and exon 7 (36). The wild-type RG2 sequence and the two mutated sequences (mtA1 and tri-RG2) are shown below with mutated nucleotides in boldface type. B, in vitro splicing assays in 40% HeLa nuclear extracts. Labeled pre-mRNAs were incubated under splicing conditions for 30 min (lanes 1, 4, and 7), 60 min (lanes 2, 5, and 8), and 90 min (lanes 3, 6, and 9). The products of the splicing reaction were separated by 5% acrylamide, denaturing gel electrophoresis and quantified with a PhosphorImager (Amersham Biosciences). The identity of the splicing products is shown on the left.

View larger version (55K): [in this window] [in a new window]   FIG. 5. SR proteins, hnRNP A1, and hnRNP F/H bind to the S3 element. A, sequences of the different RNAs used for the RNA affinity chromatography. RNAs S3, S3 mtA1, and S3 tri-RG2 have a common GAATT sequence that is derived from transcription initiation. B, biotinylated RNAs coupled to streptavidin-agarose beads that were incubated in 30% HeLa nuclear extracts under splicing conditions. After elution, proteins were separated on a 12% SDS-PAGE and immunoblotted with antibodies against the indicated proteins. Note that membranes probed with anti-hnRNP A1 antibodies contain smaller amounts of proteins due to the high titer of antibodies. Lanes 1 and 2 contain 5 and 2.5 µg of HeLa nuclear extracts, respectively, except for membrane probed with hnRNP A1, where the amount of nuclear extracts was reduced by two. Lanes 3, 5, and 7 contain 5 µl of eluted proteins, except for membrane probed with hnRNP A1, where 2 µl were loaded. Lanes 4, 6, and 8 contain 10 µl of eluted proteins except for membrane probed with hnRNP A1, where 4 µl were loaded.

View larger version (69K): [in this window] [in a new window]   FIG. 6. Depletion of hnRNP A1 from nuclear extracts activates splicing of exon 6B. A, Western blot analysis of hnRNP A1-depleted nuclear extract. hnRNP A1 was depleted from HeLa nuclear extract by using streptavidin beads coupled to a biotinylated oligonucleotide containing four hnRNP A1 binding sites. Proteins were analyzed by Western blotting with monoclonal antibodies against hnRNP A1 (9H10) and hnRNP F/H (1G11 [PDB] ). Lanes 1 and 2, mock-depleted nuclear extracts (0.5 and 1 µl, respectively). Lanes 3 and 4, hnRNP A1-depleted extracts (0.5 and 1 µl, respectively). B, 1 µl of the same samples were also probed with monoclonal antibodies against SR proteins (monoclonal antibody 104). C, in vitro splicing of pPmac, 5–6A, and -globin transcripts in various extracts. Labeled pre-mRNAs were incubated with 40% of mock-depleted (mock) for 30, 60, and 90 min (lanes 1–3, 7–9, and 13–15) or 40% of hnRNP A1-depleted HeLa nuclear extracts (A1) for 30, 60, and 90 min (lanes 4–6, 10–12, and 16–18). The splicing products were run on a 5% polyacrylamide denaturing gel and quantified using a PhosphorImager. RNA precursors and splicing products are indicated by the schematics on both sides. D, the addition of recombinant hnRNP A1 restores splicing repression of pPmac. Labeled pre-mRNAs were incubated for 90 min with 40% of mock-depleted (lanes 1, 6, and 11) or 40% of hnRNP A1-depleted HeLa nuclear extracts (lanes 2–5, 7–10, and 12–15) in the absence (lanes 2, 7, and 12) or presence of 0.5, 0.75, and 1 µg of recombinant GST-hnRNP A1 (lanes 3–5, 8–10, and 13–15). Note that a high background is observed in D as compared with C, although the same preparation of nuclear extracts was used. This is due to freezing/unfreezing of nuclear extracts.

View larger version (39K): [in this window] [in a new window]   FIG. 7. Artificial recruitment of hnRNP A1 represses splicing of exon 6B ex vivo. A, schematic representation of reporter genes. The wild-type 980 -tropomyosin gene contains exons 5, 6A, 6B, and 7. 980-2MS2 has the RG2 motif replaced by two MS2 binding sites. Locations of primers used for RT-PCR are indicated. Schematic diagrams of amplification products are shown below. B, the two minigenes (1 µg) were co-transfected in QM7 cells with expression vectors coding for bacteriophage MS2 coat protein (lane 3, 0.5 µg; lanes 1 and 5, 1 µg) or hnRNP A1-coat fusion protein (lane 4, 0.5 µg; lanes 2 and 6, 1 µg). Spliced products were analyzed by RT-PCR using primers shown in A and separated on a 6% acrylamide denaturing gel. Quantification of the 186-bp product is indicated. -Actin expression analyzed by RT-PCR is shown below each lane.

View larger version (66K): [in this window] [in a new window]   FIG. 8. SR proteins activate in vitro splicing of pPmac transcript. A, labeled pPmac (lanes 1–8), 5–6A (lanes 9–16), and -globin (lanes 17–24) transcripts were incubated in 40% HeLa nuclear extracts in the absence (lanes 1, 9, and 17) or in the presence of 100, 200, and 300 ng of total HeLa cell SR proteins (lanes 2–4, 10–12, and 18–20) or 200 and 300 ng of recombinant ASF/SF2 (lanes 5 and 6, lanes 13 and 16, and lanes 21 and 22), or 150 and 225 ng of recombinant SC35 (lanes 7 and 8, lanes 15 and 16, and lanes 23 and 24). The star in front of the schematic lariat refers to the final lariat of 5–6A. B, splicing of mutated pPmac substrates, pmtA1 (lanes 1–5) and ptri-RG2 (lanes 6–10), in the same condition as in A, without additional factors (lanes 1 and 6) or in the presence of 200 and 300 ng of recombinant ASF/SF2 (lanes 2 and 3 and lanes 7 and 8) or 150 and 225 ng of recombinant SC35 (lanes 4 and 5 and lanes 9 and 10).

View larger version (74K): [in this window] [in a new window]   FIG. 9. Splicing activation of pPmac by ASF/SF2 and SC35 is counteracted by hnRNP A1. In vitro splicing of pPmac and 5–6A in 40% HeLa nuclear extracts supplemented with 200 ng of ASF/SF2 (lanes 2–4 and 9–11) or 150 ng of SC35 (lanes 5–7 and 12–14) in the absence (lanes 2, 5, 9, and 12) or in the presence of 500 and 750 ng of recombinant GST-A1 (lanes 3 and 4, lanes 6 and 7, lanes 10 and 11, and lanes 13 and 14). Lanes 1 and 8, without additional factors. The products of the splicing reaction were separated by 7% acrylamide, denaturing gel electrophoresis and quantified with a PhosphorImager.

View larger version (68K): [in this window] [in a new window]   FIG. 10. ASF/SF2 RS and SC35 RS can displace bound hnRNP A1 to S3. A, binding of ASF/SF2 RS, SC35 RS and hnRNP A1 to S3. Labeled S3 RNA was incubated with 5% nuclear extract and increasing amounts of the indicated recombinant proteins. After UV cross-linking, samples were treated with RNase and analyzed on a 12% SDS-PAGE. Lane 1, without additional factors. Lanes 2–4 contained 100, 200, and 500 ng of SC35 RS, respectively. Lanes 5–7 contained 100, 200, and 500 ng of ASF/SF2 RS. Lanes 8–10 contained 140, 280, and 500 ng of hnRNP A1. Positions of endogenous hnRNP F/H and recombinant proteins were indicated. B, competition for RNA binding between ASF/SF2 RS, SC35 RS, and hnRNP A1 in the presence of nuclear extracts. Labeled S3 RNA was treated as in A. Lane 1, without additional factors. Lanes 2–8 contained 560 ng of hnRNP A1. Lanes 3–5 contained 125, 250, and 500 ng of SC35 RS. Lanes 6–8 contained 500, 750, and 1000 ng of ASF/SF2 RS. C, ASF/SF2 RS and SC35 RS compete with hnRNP A1 for RNA binding; same as in B, but without nuclear extracts. Lanes 1–8 contained 560 ng of hnRNP A1. Lanes 3–5 contained 100, 200, and 500 ng of SC35 RS, and lanes 6–8 contained 100, 200, and 500 ng of ASF/SF2 RS.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

The existence of several hnRNP A1 binding sites seems to be a common feature of numerous splicing events regulated by hnRNP A1 (21, 24, 26, 27, 54). In the case of the alternative splicing of hnRNP A1 pre-mRNA, it has been proposed that interactions between multiple hnRNP A1 molecules bound to introns flanking the alternative exon allow loop formation that prevents internal 5' splice site selection and promotes the skipping of the alternative exon (21, 55). Splicing repression of exon 6B might conform to this general rule. Consistent with this view, examination of the RNA sequence revealed a UAGAGG motif in the beginning of exon 6B that strongly interacts with hnRNP A1 (data not shown). We are currently testing whether hnRNP A1 bound to exon 6B is involved in splicing repression. The mechanism by which hnRNP A1 mediates silencing is presently unknown. In the case of splicing of hnRNP A1 pre-mRNA, the shift toward distal 5' selection does not seem to be associated with modifications in the U1 snRNP occupancy at the competing 5' splice sites (20). However, in our system, previous studies have shown that the repression of the pPmac transcript is associated with a decrease of A complex formation and a reduction of U1 snRNP interaction on exon 6B 5' splice site (56). Interestingly, this repression is dependent on an RNA secondary structure around exon 6B (36, 57). Thus, it may be possible that the folding of RNA is stabilized by hnRNP A1 interactions, which in turn interferes with U1 snRNP binding. In addition to its role in 5' splice site selection, hnRNP A1 also is involved in the regulation of 3' splice site usage (10, 22, 24, 27, 30, 31, 58). In the well characterized 3' splice site regulation of HIV tat exon 3, it has been proposed that a repressive wave is initiated at a high affinity hnRNP A1 binding site that propagates along the exon to inhibit splicing of the upstream intron (10). In that model, it was shown that binding of ASF/SF2 to an ESE prevents the propagation of hnRNP A1 along the exon and blocks splicing silencing (10). During the course of this study, we identified ASF/SF2 and SC35 as components of the protein complex that is bound to the RG2 motif. Each of the SR proteins activates splicing of exon 6B. This effect is mediated at the least through their interactions with the RG2 motif, because mutations mtA1 and tri-RG2 strongly decrease splicing activation (Fig. 6). However, additional SR binding sites cannot be totally excluded. Two putative ASF/SF2 binding sites (TAGAGG and AGGAGGA), which overlap with hnRNP A1 binding site on exon 6B, can be identified by ES-Efinder (52). Mutations of these motifs decrease in vitro splicing of the pPmac construct (data not shown). Further experiments are required to elucidate the role of these motifs in splicing of exon 6B. We also reported, as it was observed in other systems, that splicing activation by SR proteins was counterbalanced by hnRNP A1. In addition, by using UV-cross-linking experiments, we demonstrated that SR proteins were able to displace hnRNP A1 bound to the S3 element. Interestingly, ASF/SF2 and SC35 that lack the RS domain are still able to block binding of hnRNP A1 to the S3 element, which suggests that binding sites for all of these proteins are closely linked (Fig. 10). Consistent with this hypothesis, mutational analyses were unsuccessful in separating the binding sites for ASF/SF2, SC35, and hnRNP A1. Overlapping binding sites for the SR proteins and hnRNP A1 seem to be a common feature encountered in several alternative splicing models (27, 28, 58). In the case of HIV, 3' splice site selection of A7 involved the AUA(GAA)₃ Janus regulatory element, which is made up of overlapping binding sites for ASF/SF2 and hnRNP A1. The authors proposed that the binding of ASF/SF2 to this element disrupted hnRNP A1 protein-protein interactions, and this leads to the decompaction of the RNA structure (27). Our system presents some resemblance to HIV; it contains an RNA secondary structure and several hnRNP A1 binding sites that are overlapping with ASF/SF2 and SC35. Thus, it is tempting to speculate that the SR proteins might function similarly to destabilize the RNA structure.

Western blots of affinity-selected proteins have identified hnRNP F/H as a component of the complexes assembled onto the S3 element (Fig. 5B). The S3 element contains several G-triplets, and, in particular, it contains in the middle of the RG2 region a GGGA motif that has been identified as a core sequence needed for binding to the hnRNP H family (53). The mutation of tri-RG2 that interrupts the G-triplet does not impair the ability of hnRNP F/H to bind to the S3 element (Fig. 5). However, disruption of the consecutive G residues does abolish the hnRNP F/H interactions, which suggests that the RG2 motif is a true binding site for the hnRNP F/H proteins (data not shown). Additional hnRNP F/H binding sites also have been identified in the RG1 motif (data not shown). Inside this motif is the sequence GGGGCUG that closely resembles the hnRNP F/H binding site present in the downstream control element of c-src (15). Cross-linking experiments show that, in addition to hnRNP A1, ASF/SF2 and SC35 also compete with hnRNP F/H. This finding suggests that these proteins might play an important role in the regulation of exon 6B (Fig. 10). In several systems, these proteins were shown to promote or to repress splicing (14, 16, 17, 59–61). It has been shown that hnRNP H activates the inclusion of the tev-specific exon 6D of HIV-1 (59). Interestingly, a SC35 binding site in close proximity was proposed to help in the recruitment of hnRNP H. Another example where binding sites for hnRNP F/H and SR proteins are in close proximity was provided by the exonic enhancer of the N1 exon of c-src (28). It is interesting to note that hnRNP A1 has been also found associated with the exonic enhancer. Thus, it appears that the peculiar arrangement of overlapping binding sites having positive or negative effects depends on which proteins bind to them, and this plays an important role in the regulation of numerous splicing events. This creates an exquisite system of regulation of splicing events that can respond to small variations in the relative concentration of regulatory factors. Further experiments will be needed to elucidate the role of the hnRNP F/H protein family and to understand how all these regulatory proteins communicate with each other to regulate splicing of exon 6B.

	FOOTNOTES

 
^* This work was supported by CNRS, Association Française contre les Myopathies (AFM), Ligue Nationale Contre le Cancer (LNCC), and Association pour la Recherche sur le Cancer (ARC). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

^|| To whom correspondence should be addressed. Tel.: 16-9823800; Fax: 16-9823877; E-mail: marie{at}cgm.cnrs-gif.fr.

¹ The abbreviations used are: snRNP, small nuclear ribonucleoprotein; GST, glutathione S-transferase; RT, reverse transcription; hnRNP, heterogeneous nuclear ribonucleoprotein; nt, nucleotide(s).

² A. Expert-Bezançon, A. Sureau, P. Durosay, R. Salesse, H. Groeneveld, J. P. Lecaer, and J. Marie, unpublished data.

	ACKNOWLEDGMENTS

 
We gratefully acknowledge Drs. G. Dreyfuss, D. Black, M. Roth, R. Gattoni, and J. Stévenin for the kind gifts of antibodies. We also thank Drs. B. Chabot for providing the pGEX-A1 plasmid, A. Kraïner for the pET9d-hnRNP A1 plasmid, and Richard Breathnach for the MS2 expression vectors. We are grateful to Drs. R. Gattoni and J. Stévenin for the generous gifts of recombinant SR proteins. We thank J. Banroques, Y. d'Aubenton-Carafa, D. Libri, and J. Saulière for fruitful discussions and advice during the course of the study. We especially thank K. Tanner for carefully reading the manuscript.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 

1. Moore, M. J., Query, C. C., and Sharp, P. A. (1993) in The RNA World (Gesteland, R. F., and Atkins, J. F., eds) Vol. 13, pp. 303–357, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
2. Neubauer, G., King, A., Rappsilber, J., Calvio, C., Watson, M., Ajuh, P., Sleeman, J., Lamond, A., and Mann, M. (1998) Nat. Genet. 20, 46–50[CrossRef][Medline] [Order article via Infotrieve]
3. Black, D. L. (1995) RNA 1, 763–771[Medline] [Order article via Infotrieve]
4. Black, D. L. (2003) Annu. Rev. Biochem. 72, 291–336[CrossRef][Medline] [Order article via Infotrieve]
5. Smith, C. W., and Valcarcel, J. (2000) Trends Biochem. Sci. 25, 381–388[CrossRef][Medline] [Order article via Infotrieve]
6. Blencowe, B. J. (2000) Trends Biochem. Sci. 25, 106–110[CrossRef][Medline] [Order article via Infotrieve]
7. Fu, X. D. (1995) RNA 1, 663–680[Medline] [Order article via Infotrieve]
8. Graveley, B. R. (2000) RNA 6, 1197–1211[CrossRef][Medline] [Order article via Infotrieve]
9. Hastings, M. L., and Krainer, A. R. (2001) Curr. Opin. Cell Biol. 13, 302–309[CrossRef][Medline] [Order article via Infotrieve]
10. Zhu, J., Mayeda, A., and Krainer, A. R. (2001) Mol. Cell 8, 1351–1361[CrossRef][Medline] [Order article via Infotrieve]
11. Engelbrecht, J., Knudsen, S., and Brunak, S. (1992) J. Mol. Biol. 227, 108–113[CrossRef][Medline] [Order article via Infotrieve]
12. Carlo, T., Sterner, D. A., and Berget, S. M. (1996) RNA 2, 342–353[Abstract]
13. Carlo, T., Sierra, R., and Berget, S. M. (2000) Mol. Cell. Biol. 20, 3988–3995[Abstract/Free Full Text]
14. Chou, M.-Y., Rooke, N., Turck, C., and Black, D. L. (1999) Mol. Cell. Biol. 19, 69–77[Abstract/Free Full Text]
15. Markovtsov, V., Nikolic, J. M., Goldman, J. A., Turck, C. W., Chou, M. Y., and Black, D. L. (2000) Mol. Cell. Biol. 20, 7463–7479[Abstract/Free Full Text]
16. Min, H., Chan, R. C., and Black, D. L. (1995) Genes Dev. 9, 2659–2671[Abstract/Free Full Text]
17. Chen, C. D., Kobayashi, R., and Helfman, D. M. (1999) Genes Dev. 13, 593–606[Abstract/Free Full Text]
18. Hastings, M. L., Wilson, C. M., and Munroe, S. H. (2001) RNA 7, 859–874[Abstract]
19. Burd, C. G., and Dreyfuss, G. (1994) EMBO J. 13, 1197–1204[Medline] [Order article via Infotrieve]
20. Chabot, B., Blanchette, M., Lapierre, I., and La Branche, H. (1997) Mol. Cell. Biol. 17, 1776–1786[Abstract]
21. Blanchette, M., and Chabot, B. (1999) EMBO J. 18, 1939–1952[CrossRef][Medline] [Order article via Infotrieve]
22. Caputi, M., Mayeda, A., Krainer, A. R., and Zahler, A. M. (1999) EMBO J. 18, 4060–4067[CrossRef][Medline] [Order article via Infotrieve]
23. Del Gatto-Konczak, F., Olive, M., Gesnel, M.-C., and Breathnach, R. (1999) Mol. Cell. Biol. 19, 251–260[Abstract/Free Full Text]
24. Tange, T. O., Damgaard, C. K., Guth, S., Valcarcel, J., and Kjems, J. (2001) EMBO J. 20, 5748–5758[CrossRef][Medline] [Order article via Infotrieve]
25. Matter, N., Marx, M., Weg-Remers, S., Ponta, H., Herrlich, P., and Konig, H. (2000) J. Biol. Chem. 275, 35353–35360[Abstract/Free</