Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M403948200 on July 7, 2004

J. Biol. Chem., Vol. 279, Issue 37, 38480-38485, September 10, 2004
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
279/37/38480    most recent
M403948200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jiang, X.
Right arrow Articles by Li, X.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jiang, X.
Right arrow Articles by Li, X.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Protein-DNA Array-based Identification of Transcription Factor Activities Regulated by Interaction with the Glucocorticoid Receptor*

Xin Jiang{ddagger}§, Michael Norman§, Leslie Roth{ddagger}, and Xianqiang Li{ddagger}

From the {ddagger}Panomics, Inc., Redwood City, California 94063 and §LINE, Bristol University, Bristol BS1 3NY, United Kingdom

Received for publication, April 8, 2004 , and in revised form, July 1, 2004.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
The glucocorticoid receptor (GR) regulates gene expression by binding specific sequence elements within the promoters of target genes or by cross-talk with other transcription factors (TFs). For some TFs, interaction with the GR results in alteration of DNA binding and transcriptional regulation. We used a protein-DNA array, a system that facilitates simultaneous profiling of the activities of multiple transcription factors, to systematically examine the potential cross-talk of GR{alpha} with 149 TFs. Using this array, we identified several TFs, including IRF, E47, and COUP-TF, whose DNA binding activities were modulated by GR{alpha}. We then confirmed these results with in vitro electrophoretic mobility shift assays and in vivo reporter assays. In this study, IRF and E47 were identified as participants in GR{alpha} cross-talk for the first time. This new finding expands our understanding of the functional role of GR{alpha} in the context of gene expression regulation.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Glucocorticoids, a major subclass of steroid hormones, modulate a large number of metabolic, cardiovascular, immune, and behavioral functions (1, 2). The intracellular effects of glucocorticoids are mediated by the glucocorticoid receptor (GR),1 a 94-kDa intracellular protein belonging to the phylogenetically conserved nuclear hormone receptor superfamily. The GR binds to and controls the transcriptional activity of a set of target genes (3, 4). In the absence of glucocorticoid, the GR is maintained predominantly in the cytoplasm as part of an inactive multiprotein complex that consists of the receptor, two Hsp90 molecules, one molecule each of Hsp70 and Hsp56, and an immunophilin of the FK506- and rapamycin-binding class (5). When glucocorticoid binds to GR, the receptor undergoes a change in conformation, dissociates from regulatory heat shock proteins, and is hyperphosphorylated. The activated receptor rapidly translocates to the cell nucleus, where it is able to initiate transcriptional regulation.

In the nucleus, hormone-activated GR regulates transcription via two distinct mechanisms, involving direct transcriptional regulation and indirect transcriptional regulation via cross-talk with other TFs. During direct transcriptional regulation, the GR binds as a homodimer directly to short, palindromically arranged DNA sequences located in the promoter regions of glucocorticoid-responsive genes. Binding to these sequences, known as glucocorticoid response elements, leads to transcriptional induction or repression of target genes. During indirect transcriptional cross-talk, the GR regulates gene expression by interacting with other transcription factors. This indirect mechanism has been shown to alter the transcriptional properties of both the GR and the interacting TFs. Transrepression or transactivation via protein-protein interactions with other TFs, such as NF-{kappa}B (6, 7), activator protein-1 (AP-1) (8, 9), and signal transducers and activators of transcription (STAT) (10), may be particularly important in the suppression of immune function and inflammation by glucocorticoids.

Although some cross-talk interactions cause no observable change in DNA binding activity (6–9), other interactions result in the modification of DNA binding activity of the target TF proteins (10). These latter interactions might result in a mutual transcriptional impairment or synergy of both DNA binding activities. For example, interaction between the GR and STAT5 increases the ability of STAT5 to enhance gene expression. This transcriptional synergy between STAT5 and the GR appears to result from increased DNA binding activity of STAT5 (10).

Interactions that result in altered DNA binding activities of TFs have attracted considerable attention recently, but the lack of effective methods for studying multiple TF interactions has hindered serious research efforts. Conventionally, TF activities have been analyzed in vitro by gel shift assays, also known as electrophoretic mobility shift assays (EMSAs). Unfortunately, EMSAs can detect activation of only one TF/reaction. We have recently developed a novel array technology that allows high throughput functional analysis of TFs (11, 12). This simple array-based assay can profile the activities of multiple transcription factors in a single experiment. In the present study, we used this system to identify those TFs whose DNA binding activities are regulated by the GR. By comparing array data obtained both in the presence and in the absence of GR expression and activation, we identified cross-talk between the GR and several TFs. These TFs include IRF, whose DNA binding activity was enhanced in the presence of GR, and others like COUP-TF and E47, whose DNA binding activities were repressed. We used EMSAs and luciferase reporter assays to verify our array results.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Constructs—The pCMV-GR{alpha} expression vector encoding human glucocorticoid receptor was kindly provided by E. Brad Thompson. Reporter constructs were made by replacing the NheI and BglII fragment of pMyc-TA-luc (Clontech) with the enhancer elements of GR, COUP-TF, IRF, or E47. Each reporter contains a minimal TATA box promoter, a luciferase gene, and two or three copies of each corresponding cis-element. Identical cis-element sequences were also used for the gel shift assays and array assays detailed below. A series of luciferase reporter vectors was constructed: pGRE-Luc, pIRF-Luc, pCOUP-TF-Luc, and pE47-Luc.

siRNA expression vectors were derived from PAVU6 + 27 (13). Each siRNA expression vector contained two complementary copies of a 19-nucleotide gene-specific sequence separated by a short spacer. Both the sense and antisense portions of siRNA sequences were synthesized and annealed; then the generated SalI and XbaI cohesive ends were used for cloning into PAVU6 + 27 to make E47, COUP-TF, and IRF-1 siRNA expression vectors. The siRNA insert sequences were as follows (the loop regions are in lowercase letters): E47 siRNA, GAAGGTCCGGAAGGTCCCGttcaagagaCGGGACCTTCCGGACCTTCTTTTT; COUP-TF siRNA, GTCGAGCGGCAAGCACTACttcaagagaGTAGTGCTTGCCGCTCGACTTTTT; and IRF1 siRNA, GCATGGCTGGGACATCAACttcaagagaGTTGATGTCCCAGCCATGCTTTTT.

Cell Culture and Transfection—COS-1 cells were cultured in 10-cm culture plates in Dulbecco's minimal essential Eagle's medium (Invitrogen) supplemented with 10% fetal bovine serum, 1% nonessential minimal amino acids, 100 units/ml penicillin, and 0.1 mg/ml streptomycin. Sixteen hours prior to transfection, the cells were seeded without antibiotics for transfection. Transfection was performed using LipofectAMINE 2000 reagent (Invitrogen). For all transfections, efficiency was monitored and normalized with an in situ {beta}-galactosidase staining kit (Stratagene). The transfection efficiency was estimated to be in the range of 70–90%.

To prepare nuclear extracts, COS-1 cells were plated in 10-cm culture dishes and transfected with 15 µg of GR{alpha} expression construct. After 16 h, the cells were treated with or without 10–6 M dexamethasone (DEX) for one hour. Untransfected COS-1 cells were used as a control.

To perform the reporter assay, the cells were plated in a 6-well plate and transfected with 1.5 µg of a reporter vector mixed with 1 µg of GR{alpha} expression vector. The cells transfected with the reporter vector only were used as a negative control. After exposure of transfected cells to 10–6 M DEX for 6 h, the cells were subjected to a luciferase reporter assay.

For siRNA knockdown, the cells were plated in a 6-well plate and transfected with 1.5 µg of siRNA expression vector. After 72 h, the cells were split; one portion was used for a luciferase reporter assay, and the other was used for Western blot analysis or PCR to examine the effects of siRNA on gene expression.

Protein-DNA Array Analysis and Gel Shift Assay (EMSA)—Nuclear extraction, protein-DNA array, and gel shift assays were described previously (12). For the protein-DNA assay, nuclear extracts were incubated with biotin-labeled DNA probe mix in binding buffer for 30 min at 15 °C. Protein-DNA complexes were resolved on a 2% agarose gel in 0.5x Tris-borate-EDTA and then excised from the gel. DNA probes were recovered from the protein-DNA complexes and hybridized to the array membrane.

For gel shift assays, the nuclear extracts were incubated with individual biotin-labeled probes in binding buffer for 30 min at 15 °C. The probe sequences were as follows: E47 (14), CCGGCAGGTGTCCC; CO-UP-TF (15), AGCTTGGTGTCAAAGGTCAAACTTAGCT; IRF (16), AGTACTTTCAGTTTCAT; and GR responsive element (17), GACCCTAGAGGATCTGTACAGGATGTTCTAGATCCAATTCG.

The negative control consisted of free probe (without nuclear extracts). For the competition control, we added excess unlabeled cold probes to the sample containing nuclear extract and biotin-labeled probe. The samples were separated on a 6% polyacrylamide gel in 0.5% Tris-borate-EDTA, transferred onto a nylon membrane, and fixed on the membrane by UV cross-linking. The biotin-labeled probe was detected with streptavidin-horseradish peroxidase (Pierce).

Luciferase Reporter Assay—COS-1 cells were first transfected with luciferase reporter constructs and GR{alpha} expression vector. After removing the culture medium and rinsing twice with phosphate-buffered saline, 200 µl of 1x cell lysis buffer was added to the cells, which were then shaken at room temperature for 15–20 min. The cells were dislodged by scraping or pipetting and then transferred to a 1.5-ml microcentrifuge tube before being centrifuged at 14,000 rpm at room temperature for 1 min to remove cellular debris. 10 µl of the cell extract was mixed with 50 µl of substrate (Pierce), and luminescence was measured using a luminometer.

Coimmunoprecipitation and Western Blot Analysis—Immunoprecipitation was performed using protein G Dynabeads (Dynal Biotechnology) according to the manufacturer's instructions. To stabilize interactions between GR{alpha} and other TFs, the immunoprecipitation was carried out in the presence of cis-elements. After treatment of COS-1 and GR{alpha}-transfected COS-1 cells with or without 10–6 M DEX for 6 h, the nuclear extracts were incubated with E47 probe or IRF probe for 30 min at 15 °C. The protein-DNA complexes were subsequently incubated with monoclonal GR{alpha} antibody for 2 h at4 °C and then pulled down with the cross-linked beads. Normal IgG was used as a negative control for immunoprecipitation. The protein-antibody mixture was incubated with rotation at 4 °C for 2 h. The protein-bead complexes were washed three times with 1 ml of phosphate-buffered saline, and 50 µl of Laemmli's SDS sample buffer (Bio-Rad) was added to elute the immunoprecipitated proteins. The eluted proteins were separated on a 7.5% SDS gel and electroblotted onto nitrocellulose membranes. The membrane was then incubated with a polyclonal antibody against E47 or IRF-1 (Santa Cruz). After incubation with a secondary antibody, the membrane was overlaid with luminol enhancer and substrate for 5 min. The image was acquired using a FluorChem imager (Alpha Innotech Corp). To check for siRNA-mediated inhibition of specific gene expression, whole cell lysates were subjected to Western blot analysis with E47 and IRF-1 antibodies or with nonrelevant YY1 antibody as a loading control.

RNA Preparation and RT-PCR—Total RNA was isolated from COS-1 and COUP-TF siRNA-transfected cells using Trizol Reagent (Invitrogen). cDNA was synthesized from 15 µg of total RNA with Superscript II reverse transcriptase (Invitrogen) in a final volume of 20 µl. One cycle of PCR amplification was performed at 94 °C for 60 s, followed by 30 cycles at 94 °C for 60 s, 58 °C for 60 s, and 72 °C for 60 s. The PCR reaction contained 1 µl of cDNA and 10 µM COUP-TF forward primer (CTCTATGCCGCTGCACGTGGC) and reverse primer (TAAGGCCAGTTGAAGCTGCTCCC). Primers for {beta}-actin were used as an internal control. The amplified fragments were separated by electrophoresis on a 1.2% agarose gel.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
To study cross-talk between the GR and other TFs, we employed a newly developed protein-DNA array technology. This array is a high throughput, DNA-based system that facilitates profiling of the activities of multiple TFs in one assay. There are two arrays: Array I can detect the binding of 54 TFs, and Array II can detect an additional 96 TFs. To identify TFs whose activities might be regulated by GR{alpha}, we transfected COS-1 cells, which are known to have a low endogenous level of GR (18), with pCMV-GR{alpha} or vehicle vector for 16 h. Upon treatment with 10–6 M dexamethasone, the cells were collected and nuclear extracts were prepared for analysis with protein-DNA Arrays I and II (Tables I and II list the TFs included on both arrays). As shown in Fig. 1, array analysis detected increased activity of GR{alpha}, confirming activation of GR{alpha} within the cells. Quantitative analysis of the array results indicated a 2-fold increase in GR{alpha} binding. No TF other than GR{alpha} exhibited altered DNA binding activity on array I.


View this table:
[in this window]
[in a new window]
  		TABLE I
Schematic diagram of the protein/DNA Array I

The response elements on the array are spotted in duplicate. The first row is DNA spotted normally, and the second row is DNA diluted 1:10. The right and bottom sides of the array indicate where biotinylated DNA has been spotted. Most TFs are named according to standard nomenclature. SIF, serum inducible factor.

 


View this table:
[in this window]
[in a new window]
  		TABLE II
Schematic diagram of the protein/DNA Array II

The response elements on the array are spotted in duplicate. The right and bottom sides of the array indicate where biotinylated DNA has been spotted. Most TFs are named according to standard nomenclature. ANG, angiotensinogen; IRF, insulin-responsive factor; ADRP, alcohol dehydrogenase regulatory protein; AORF, antioxidant responsive factor; ORF, osmotic response factor; L-III BP, pyruvate kinase L gene-binding protein III (hepatocyte specific); HIF-1, hypoxia-inducible factor 1; RREBP, Ras-responsive element-binding protein; XRF, xenobiotic response factor.

 



View larger version (38K):
[in this window]
[in a new window]
  		FIG. 1.
Comparison of COS-1 cells and GR{alpha}-transfected COS-1 cells with the protein-DNA array I. The array assay was performed using nuclear extracts from COS-1 cells (A) and GR{alpha}-transfected COS-1 cells (B). Both cell types were treated with 100 nM dexamethasone. The boxes represent activated GR. These results are representative of three different experiments.

 
The samples were also compared with protein-DNA Array II. On Array II, the spotting format is different from Array I; there are only two spots of immobilized DNA per cis-element, whereas Array I has four, two of which are diluted 10-fold. We found that the activities of multiple TFs on Array II were affected by GR{alpha} (Fig. 2). The most striking changes noted were increased binding of IRF and Pax4 and decreased binding of COUP-TF and E47. Quantitative analysis of the array results indicated that the DNA binding activities of all four of these TFs changed ~2-fold (although transfection efficiency in these experiments was estimated to be at least 70%, it is possible that the degree of change in DNA binding of TFs has been underestimated by admixture of nuclear extracts from the small number of untransfected cells).



View larger version (16K):
[in this window]
[in a new window]
  		FIG. 2.
Comparison of COS-1 cells and GR{alpha}-transfected COS-1 cells with the protein-DNA array II. The array procedure was performed using nuclear extracts from COS-1 cells (A) and GR{alpha}-transfected COS-1 cells (B). Both cell types were treated with 100 nM dexamethasone. The boxes represent TFs whose activities changed. The boxed TFs in order from top left to bottom right are COUP-TF, E47, IRF, and Pax4. These results are representative of three different experiments.

 
Because the protein-DNA array is a high throughput method, the results require verification by a secondary assay. EMSAs were performed with IRF, Pax4, COUP-TF, and E47 probes that were identical in sequence to the probes used in the protein-DNA array assay. After electrophoresis and membrane transfer, both complexes and probes were identified with streptavidin-horseradish peroxidase and substrate. As shown in Fig. 3, EMSA verified the increased IRF binding as well as the repression of COUP-TF and E47 binding in GR{alpha}-transfected cells. As expected, dexamethasone also produced a clear gel shift with a GR probe. Adding cold DNA to the EMSA reaction abolished the band shifts, confirming that the detection was specific. These EMSA results demonstrated that the protein-DNA array is an effective method for identifying TFs whose DNA binding activities have changed. The induction of Pax4, however, could not be verified by EMSA. This discrepancy suggests that the positive result on the array was most likely due to nonspecific binding.



View larger version (44K):
[in this window]
[in a new window]
  		FIG. 3.
EMSA analysis of TFs activated or repressed by GR{alpha}. The analysis includes COUP-TF, E47, IRF-1, and GR{alpha}. Lane 1, free probe; lane 2, COS-1 nuclear extract; lane 3, GR{alpha}-transfected COS-1 nuclear extract without DEX treatment; lane 4, GR{alpha}-transfected COS-1 nuclear extract with DEX treatment; lane 5, GR{alpha}-transfected COS-1 nuclear extract with competing unlabeled probe. The arrows indicate the shifted bands.

 
Two general mechanisms could explain GR{alpha}-mediated changes in DNA binding activities of TFs. First, mechanisms such as direct binding of GR{alpha} to specific cis-elements GR responsive element in a promoter or enhancer region of these TF genes could lead to changes in the amount of TF proteins. Second, direct or indirect interaction with the TF proteins could alter their DNA binding activity. These mechanisms are easily distinguished by Western blot analysis of COS-1 using antibodies against E47 and IRF-1. The results showed no difference in IRF-1 or E47 expression in the absence or presence of GR{alpha}, with or without DEX treatment, demonstrating that GR{alpha} does not significantly alter the expression level of IRF-1 or E47 (Fig. 4). Because no specific antibody against COUP-TF was available, the relevant study could not be carried out with this TF. As an alternative approach, we performed RT-PCR to analyze COUP-TF expression and found there was no difference between COS-1 cells, GR{alpha}-expressing COS-1 cells, or DEX-induced GR{alpha}-expressing COS-1 cells (Fig. 4). These studies demonstrated that the expression of the three TFs was unchanged by glucocorticoids, showing that GR{alpha} regulates DNA binding of IRF-1, E47, and COUP-TF through cross-talk, rather than by changing the amounts of these proteins.



View larger version (15K):
[in this window]
[in a new window]
  		FIG. 4.
Comparison of the expression of COUP-TF, E47, and IRF in COS-1, GR{alpha}-expressing COS-1 cells and DEX-induced GR{alpha}-expressing COS-1 cells. For Western blot analysis of E47 and IRF expression, nuclear extracts of COS-1 (lane 1), GR{alpha}-expressing COS-1 cells (lane 2), and DEX-induced GR{alpha}-expressing COS-1 cells (lane 3) were separated on 7.5% SDS gels. After electroblotting onto a nitrocellulose membrane, the proteins were detected with antibody against E47 or IRF, respectively. For RT-PCR analysis of COUP-TF expression, total RNA was prepared from COS-1 (lane 1), GR{alpha}-expressing COS-1 cells (lane 2), and DEX-induced GR{alpha}-expressing COS-1 cells (lane 3). Equal amounts of RNA were used for cDNA synthesis and as template for PCR amplification with specific primers. PCR products were electrophoresed on a 1% agarose gel.

 
To investigate possible protein-protein interactions between GR{alpha}, E47, and IRF-1 further, we performed Western blot analysis after immunoprecipitating GR{alpha} and associated proteins. COS-1 cells, GR{alpha}-expressing COS-1 cells, and DEX-induced GR{alpha}-expressing COS-1 cells were first subjected to immunoprecipitation with a GR{alpha}-specific antibody. The immunoprecipitates were then analyzed by Western blotting with antibodies against E47 and IRF-1. Both E47 and IRF-1 were found to be present in GR{alpha} immunoprecipitates from DEX-induced GR{alpha}-expressing COS-1 cells (Fig. 5). With extracts of COS-1 cells and GR{alpha}-expressing COS-1 cells in the absence of DEX, no interaction was detected, indicating that interactions occur in a ligand-dependent fashion. When the same assay was carried out with nonspecific IgG instead of GR-specific antibody, no interaction was detected, confirming that there is a specific interaction between GR{alpha} and the two TFs, E47 and IRF-1. Based on these results, we conclude that GR{alpha} interacts directly with E47 and IRF-1 in COS-1 cells and that these interactions affect the DNA binding behavior of these two TFs. Because of the lack of a specific antibody against COUP-TF, we could not verify its direct interaction with GR{alpha}.



View larger version (6K):
[in this window]
[in a new window]
  		FIG. 5.
Characterization of the interactions of GR{alpha} with E47 and IRF via Western blot analysis of GR coimmunoprecipitation. Immunoprecipitation of COS-1, GR{alpha}-expressing COS-1, and DEX-induced GR{alpha}-expressing COS-1 nuclear extracts was performed with a monoclonal antibody against GR{alpha} or control normal IgG, followed by "pull down" using Dynal protein G beads. The coimmunoprecipitates were analyzed by Western blot with polyclonal antibodies against E47 or against IRF1. Lane 1, DEX-induced GR{alpha}-transfected COS-1 immunoprecipitated with normal IgG; lane 2, COS-1 immunoprecipitated with GR{alpha} antibody; lane 3, GR{alpha}-expressing COS-1 immunoprecipitated with GR{alpha} antibody; lane 4, DEX-induced GR{alpha}-expressing COS-1 immunoprecipitated with GR{alpha} antibody; lane 5, whole COS-1 nuclear extract.

 
To investigate the functional implications of GR{alpha}-induced DNA-binding changes of E47, COUP-TF, and IRF-1, we made use of transcription reporter assays. Reporter constructs for E47, IRF, and COUP-TF were cotransfected with GR{alpha} into COS-1 cells, and activation of the corresponding TFs was analyzed by measuring luciferase activity. As shown in Fig. 6, GR{alpha} repressed the activity of COUP-TF more than 3-fold and that of E47 more than 2-fold. In addition, GR{alpha} enhanced the activity of IRF-1 by 45% in a DEX-dependent fashion. These results indicate that transactivation by E47, COUP-TF, and IRF-1 is altered as a result of changes in DNA binding activity initiated by GR{alpha}.



View larger version (17K):
[in this window]
[in a new window]
  		FIG. 6.
Reporter analysis of GR-mediated TF activation or repression. COS-1 cells were first transfected with GR{alpha} (GRalpha) expression vector, along with luciferase reporter constructs as indicated. After the cells were treated with or without 100 nM DEX for 6 h, luciferase assays were performed.

 
In many cases, a cis-element may bind several TFs. To confirm the identity of proteins binding to E47, COUP-TF, and IRF-1 cis-elements, we generated siRNAs to knock down each of these TFs. In response to the siRNA, expression of E47 and IRF decreased by 80–90%, as measured by Western blot analysis, and COUP-TF decreased by 90%, as measured by RT-PCR analysis (Fig. 7A). Western blot analysis of YY1, an irrelevant protein, and RT-PCR of {beta}-actin, a housekeeping gene, did not show reduced expression of either of these two proteins, confirming that inhibition by each siRNA was specific. When the expression of IRF, E47, and COUP-TF proteins was blocked by siRNAs, luciferase activities of corresponding reporters were significantly decreased (Fig. 7B), confirming that the proteins whose binding to each cis-element was modified by GR{alpha} were indeed E47, IRF, and COUP-TF.



View larger version (22K):
[in this window]
[in a new window]
  		FIG. 7.
siRNA-directed inhibition of reporter induction or repression of E47, IRF1, and COUP-TF. COS-1 cells were first transfected with siRNA vectors or mask vector and then subjected to Western blot analysis or RT-PCR (A). The inhibition was analyzed by Western blot of E47 in the presence (lane 2) or absence (lane 1) of E47 siRNA; by Western blot of IRF-1 in the presence (lane 1) or absence (lane 1) of IRF-1 siRNA; and by RT-PCR analysis of COUP-TF in the presence (lane 2) or absence (lane 1) of COUP-TF siRNA. Western blot analysis with an antibody against YY1 and RT-PCR analysis of {beta}-actin served as controls. The effect of each siRNA on each reporter was then tested (B).

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
Elucidating the mechanisms by which protein interactions regulate gene expression remains a major challenge. The glucocorticoid receptor is known to interact with a variety of TFs, thereby modulating their function and, in some cases, altering their interactions with DNA. AP-1 was the first TF shown to interact with GR (8, 19). Functionally, the consequence of the interaction between AP-1 and GR is the mutual repression of both AP-1 and GR-dependent transcription. Although initial studies suggested that the GR acted by decreasing AP-1 binding to DNA, later investigations did not support this model. Like AP-1, NF-{kappa}B is also repressed by GR (20, 21). Recent studies indicate that the mutual repression between GR and NF-{kappa}B results from direct interaction between these two proteins, also without altering the DNA binding of NF-{kappa}B.

Some GR-related interactions cause a noticeable change in DNA binding of specific TFs. For example, GR has been reported to interact with STAT5 to enhance STAT5-controlled gene expression. It is thought that the increased DNA binding activity of STAT5 resulting from this interaction provides a mechanism for the transcriptional synergy exhibited between STAT5 and the GR (10). In the present study, we found that interactions between IRF, COUP-TF, E47, and the GR all result in altered DNA binding activity. We used the protein-DNA array to profile the activity of 149 transcription factors and identified a number of TFs whose DNA binding activities were either repressed or enhanced in response to GR activation. All of the observed changes in DNA binding were shown to lead to changes in transactivation activities of these TFs. COUP-TF was first identified as a homodimer that binds to a direct repeat regulatory element in the chicken ovalbumin promoter (22). During the preparation of this manuscript, GR{alpha} was shown to interact directly with COUP-TFII both in an in vivo chromatin immunoprecipitation assay and in an in vitro immunoprecipitation assay. This study examined functional interaction of GR{alpha} and COUP-TFII using promoters responsive to each TF (mouse mammary tumour virus and cholesteroid-7-alpha-hydroxylase gene, respectively). The results suggested that COUP-TFII represses GR{alpha}-induced transactivation by attracting the silencing mediator for retinoid and thyroid hormone receptors, whereas the GR enhanced transcriptional activity of COUP-TF (23). In contrast, our study with a cis-element derived from the chicken ovalbumin promoter suggested that interaction between GR{alpha} and COUP-TF could also repress COUP-TF-induced transactivation by decreasing the protein-DNA binding activity of COUP-TF.

Transcription factor E47, a product of the E2A gene, belongs to a TF family characterized by a helix-loop-helix dimerization motif (24). E47 plays a pivotal role in activating B cell-specific genes (25), is essential to normal B-cell development, and also regulates proliferation of some non-B cells. Here, we demonstrate that GR{alpha} interacts with E47, repressing its protein-DNA binding activity. We also showed that the interaction of GR{alpha} with IRF enhanced IRF-induced transactivation by increasing IRF protein-DNA binding activity. The interferon-stimulated response element is a DNA binding sequence for the IRFs. The IRF family includes seven cellular and two viral members that exert distinct biological effects (26, 27). Among these factors, IRF-1 is the best characterized. IRF-1 acts as a transcriptional activator, is clearly involved in the control of cell growth and apoptosis, and has been proposed as a tumor suppressor. IRF plays a key role in granulocytic differentiation, and its induction by granulocytic colony-stimulating factor represents a limiting step in the early events of myeloid cell differentiation (28). These findings expand the range of potential target genes that could be regulated by the GR and provide additional evidence for a mechanism by which the GR can regulate gene expression via changes in protein-DNA binding activities of other TFs.

Previously, a lack of suitable experimental methods limited discoveries of this type of interaction. The protein-DNA array provides a much needed high throughput tool for discovering novel TF interactions. This technology enabled us to reveal a novel mechanism of GR{alpha} regulation. In addition to interacting with NF-{kappa}B, AP-1, and the TFs identified in the study, GR{alpha} has been shown to interact with other TFs, including hepatocyte nuclear factor-1 (29), CCAAT/enhancer-binding protein {alpha} (C/EBP{alpha}) (30), STAT3 and C/EBP (30, 31), STAT5 (32, 33), Spi-1 (34), GATA-1 (35), and thyroid receptor (36). However, interactions between GR{alpha} and these TFs, as well as interactions with NF-{kappa}B and AP-1, were not detected in our study. These omissions could be due to these interactions without changes in protein-DNA binding or the requirement for a specific cellular environment. Nevertheless, our strategy provided an effective method for accelerating the identification of cross-talk between TFs with changes in DNA binding activity. This study identified a number of GR cross-talk partners, providing a glimpse of an additional level of regulation of gene expression, which may help to explain many regulatory actions of glucocorticoids.


   FOOTNOTES
 
* The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

To whom correspondence should be addressed: Panomics, Inc., 2003 East Bayshore Rd., Redwood City, CA 94063. Tel.: 650-216-9736; E-mail: xjiang{at}panomics.com.

1 The abbreviations used are: GR, glucocorticoid receptor; TF, transcription factor; EMSA, electrophoretic mobility shift assay; AP-1, activator protein-1; STAT, signal transducers and activators of transcription; siRNA, small interference RNA; DEX, dexamethasone; RT, reverse transcription; IRF, interferon regulatory factor; C/EBP, CCAAT/enhancer-binding protein. Back


   ACKNOWLEDGMENTS
 
We thank Stephanie Trelogan and Andrew Bramhall for editorial support.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Chrousos, G. P. (1995) N. Engl. J. Med. 332, 1351–1362[Free Full Text]
  2. Schimmer, B. P, and Parker, K. L. (1996) in Pharmacologic Basis of Therapeutics, 9th Ed., pp. 1459–1486, McGraw Hill Inc., New York
  3. Evans, R. M. (1988) Science 240, 889–895[Abstract/Free Full Text]
  4. Mangelsdorf, D. J., Thummel, C., Beato, M., Herrlich, P., Schutz, G., Umesono, K., Blumberg, B., Kastner, P., Mark, M., and Chambon, P. (1995) Cell 83, 835–839[CrossRef][Medline] [Order article via Infotrieve]
  5. Bamberger, C. M., Schulte, H. M., and Chrousos, G. P. (1996) Endocr. Rev. 17, 245–261[Abstract/Free Full Text]
  6. Brostjan, C., Anrather, J., Csizmadia, V., Stroka, D., Soares, M., Bach, F. H., and Winkler, H. (1996) J. Biol. Chem. 271, 19612–19616[Abstract/Free Full Text]
  7. McKay, L. I., and Cidlowski, J. A. (1998) Mol. Endocrinol. 12, 45–56[Abstract/Free Full Text]
  8. Jonat, C., Rahmsdorf, H. J., Park, K. K., Cato, A. C., Gebel, S., Ponta, H., and Herrlich, P. (1990) Cell 62, 1189–1204[CrossRef][Medline] [Order article via Infotrieve]
  9. Kerppola, T. K., Luk, D., and Curran, T. (1993) Mol. Cell. Biol. 13, 3782–3791[Abstract/Free Full Text]
  10. Wyszomierski, S. L., Yeh, J., and Rosen, J. M. (1999) Mol. Endocrinol. 13, 330–343[Abstract/Free Full Text]
  11. Lam, R and Li, X. (2002) Am. Biotechnol. Lab. 20, 22–26
  12. Jiang, X., Norman, M., and Li, X. (2003) Biochim. Biophys. Acta 1642, 1–8[Medline] [Order article via Infotrieve]
  13. Paul, C. P., Good, P. D., Winer, I., and Engelke, D. R. (2002) Nat. Biotechnol. 20, 505–508[CrossRef][Medline] [Order article via Infotrieve]
  14. Schlissel, M., Voronova, A., and Baltimore, D. (1991) Genes Dev. 5, 1367–1376[Abstract/Free Full Text]
  15. Kliewer, S. A., Umesono, K., Heyman, R. A., Mangelsdorf, D. J., Dyck, J. A., and Evans, R. M. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 1448–1452[Abstract/Free Full Text]
  16. Reis, L. F., Harada, H., Wolchok, J. D., Taniguchi, T., and Vilcek, J. (1992) EMBO J. 11, 185–193[Medline] [Order article via Infotrieve]
  17. Tanaka, H., Dong, Y., Li, Q., Okret, S., and Gustafsson, J. A. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 5393–5397[Abstract/Free Full Text]
  18. Oakley, R. H., Sar, M., and Cidlowski, J. A. (1996) J. Biol. Chem. 271, 9550–9559[Abstract/Free Full Text]
  19. Schule, R., Rangarajan, P., Kliewer, S., Ransone, L. J., Bolado, J., Yang, N., Verma, I. M., and Evans, R. M. (1990) Cell 62, 1217–1226[CrossRef][Medline] [Order article via Infotrieve]
  20. Ray, A., and Prefontaine, K. E. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 752–756[Abstract/Free Full Text]
  21. Scheinman, R. I., Gualberto, A., Jewell, C. M., Cidlowski, J. A., and Baldwin, A. S., Jr. (1995) Mol. Cell. Biol. 15, 943–953[Abstract]
  22. Pastorcic, M., Wang, H., Elbrecht, A., Tsai, S. Y., Tsai, M. J., and O'Malley, B. W. (1986) Mol. Cell. Biol. 6, 2784–2791[Abstract/Free Full Text]
  23. Massimo, U., De Martino, N. B., Alesci, S., Ichijo, T., Chrousos, G. P., and Kino, T. (2004) Mol. Endocrinol. 18, 820–833[Abstract/Free Full Text]
  24. Kadesch, T. (1992) Immunol. Today 13, 31–36[CrossRef][Medline] [Order article via Infotrieve]
  25. Sloan, S. R., Shen, C. P., McCarrick-Walmsley, R., and Kadesch, T. (1996) Mol. Cell. Biol. 16, 6900–6908[Abstract]
  26. Nguyen, H., Hiscott, J., and Pitha, P. M. (1997) Cytokine Growth Factor Rev. 8, 293–312[CrossRef][Medline] [Order article via Infotrieve]
  27. Taniguchi, T., Harada, H., and Lamphier, M. (1995) J. Cancer Res. Clin. Oncol. 121, 516–520[CrossRef][Medline] [Order article via Infotrieve]
  28. Coccia, E. M., Stellacci, E., Valtieri, M., Masella, B., Feccia, T., Marziali, G., Hiscott, J., Testa, U., Peschle, C., and Battistini, A. (2001) Biochem. J. 360, 285–294[CrossRef][Medline] [Order article via Infotrieve]
  29. Suh, D. S., and Rechler, M. M. (1997) Mol. Endocrinol. 11, 1822–1831[Abstract/Free Full Text]
  30. Rudiger, J. J., Roth, M., Bihl, M. P., Cornelius, B. C., Johnson, M., Ziesche, R., and Block, L. H. (2002) FASEB J. 16, 177–184[Abstract/Free Full Text]
  31. Kordula, T., and Travis, J. (1996) Biochem. J. 313, 1019–1027[Medline] [Order article via Infotrieve]
  32. Stocklin, E., Wissler, M., Gouilleux, F., and Groner, B. (1996) Nature 383, 726–728[CrossRef][Medline] [Order article via Infotrieve]
  33. Lechner, J., Welte, T., and Doppler, W. (1997) Immunobiology 198, 112–123[Medline] [Order article via Infotrieve]
  34. Gauthier, J. M., Bourachot, B., Doucas, V., Yaniv, M., and Moreau-Gachelin, F. (1993) EMBO J. 12, 5089–5096[Medline] [Order article via Infotrieve]
  35. Chang, T. J., Scher, B. M., Waxman, S., and Scher, W. (1993) Mol. Endocrinol. 7, 528–542[Abstract/Free Full Text]
  36. Yen, P. M., Wilcox, E. C., and Chin, W. W. (1995) Endocrinology 136, 440–445[Abstract]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 Am. J. Respir. Cell Mol. Bio.Home page
O. Tliba, G. Damera, A. Banerjee, S. Gu, H. Baidouri, S. Keslacy, and Y. Amrani
Cytokines Induce an Early Steroid Resistance in Airway Smooth Muscle Cells: Novel Role of Interferon Regulatory Factor-1
Am. J. Respir. Cell Mol. Biol., April 1, 2008; 38(4): 463 - 472.
[Abstract] [Full Text] [PDF]

Home page
 Nucleic Acids ResHome page
S. Dhakshinamoorthy, S. R. Sridharan, L. Li, P. Y. Ng, L. M. Boxer, and A. G. Porter
Protein/DNA arrays identify nitric oxide-regulated cis-element and trans-factor activities some of which govern neuroblastoma cell viability
Nucleic Acids Res., August 15, 2007; (2007) gkm594v1.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
J. Zhao, R. Harper, A. Barchowsky, and Y. P. P. Di
Identification of multiple MAPK-mediated transcription factors regulated by tobacco smoke in airway epithelial cells
Am J Physiol Lung Cell Mol Physiol, August 1, 2007; 293(2): L480 - L490.
[Abstract] [Full Text] [PDF]

Home page
 Physiol. GenomicsHome page
M. A. Keller, S. Addya, R. Vadigepalli, B. Banini, K. Delgrosso, H. Huang, and S. Surrey
Transcriptional regulatory network analysis of developing human erythroid progenitors reveals patterns of coregulation and potential transcriptional regulators
Physiol Genomics, December 13, 2006; 28(1): 114 - 128.
[Abstract] [Full Text] [PDF]

Home page
 FASEB J.Home page
B.-N. Kang, K. G. Tirumurugaan, D. A. Deshpande, Y. Amrani, R. A. Panettieri, T. F. Walseth, and M. S. Kannan
Transcriptional regulation of CD38 expression by tumor necrosis factor-{alpha} in human airway smooth muscle cells: role of NF-{kappa}B and sensitivity to glucocorticoids
FASEB J, May 1, 2006; 20(7): 1000 - 1002.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Endocrinol. Metab.Home page
G.-S. Lee, K.-C. Choi, and E.-B. Jeung
Glucocorticoids differentially regulate expression of duodenal and renal calbindin-D9k through glucocorticoid receptor-mediated pathway in mouse model
Am J Physiol Endocrinol Metab, February 1, 2006; 290(2): E299 - E307.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
279/37/38480    most recent
M403948200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jiang, X.
Right arrow Articles by Li, X.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jiang, X.
Right arrow Articles by Li, X.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2004 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement