Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M313441200 on July 22, 2004

J. Biol. Chem., Vol. 279, Issue 39, 40494-40504, September 24, 2004
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
279/39/40494    most recent
M313441200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Goraya, T. A.
Right arrow Articles by Cooper, D. M. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Goraya, T. A.
Right arrow Articles by Cooper, D. M. F.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Sustained Entry of Ca2+ Is Required to Activate Ca2+-Calmodulin-dependent Phosphodiesterase 1A*

Tasmina A. Goraya, Nanako Masada, Antonio Ciruela, and Dermot M. F. Cooper{ddagger}

From the Department of Pharmacology, University of Cambridge, Tennis Court Rd., Cambridge, CB2 1PD, United Kingdom

Received for publication, December 9, 2003 , and in revised form, July 20, 2004.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Regulation of adenylyl cyclases (ACs) by Ca2+ requires capacitative Ca2+ entry (CCE) (Cooper, D. M. F. (2003) Biochem. J. 375, 517–529), but whether Ca2+-sensitive phosphodiesterases (PDEs) are similarly discriminating has never been addressed. In the present study, a variety of conditions were devised to manipulate [Ca2+]i so that we could ask whether PDE1 selectively responds to different modes of elevating [Ca2+]i, viz. Ca2+ released from intracellular stores and various modes of Ca2+ entry. In 1321N1 human astrocytoma cells, the endogenous PDE1 (identified as PDE1A by reverse transcriptase-PCR) was largely insensitive to Ca2+ released from carbachol-sensitive stores but was robustly stimulated by a similar rise in [Ca2+]i due to carbachol-induced Ca2+ influx. Gd3+, which effectively blocked thapsigargin-induced CCE and its effect on PDE1A, also inhibited the activation of PDE1A by carbachol-induced Ca2+ entry. However, non-selective ionomycin-mediated Ca2+ entry also activated PDE1A, so that, unlike Ca2+-sensitive ACs, PDE1A cannot discriminate between the different sources of Ca2+ entry. Fractionation of the cells revealed that the Ca2+-calmodulin-stimulated PDE activity was not present at the plasma membrane but was associated with the cytosol and the organellar compartments of the cell. Therefore, the apparent disparity between PDE1A and ACs is likely to be the consequence of their differential subcellular localization. Nevertheless, in a physiological context, where artificial modes of elevating [Ca2+]i are not available, as with ACs, a dependence on CCE would be evident, and it would be the duration of this influx of Ca2+ that would determine how long PDE1A was activated.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
A rise in [Ca2+]i1 leads to an inhibition of cAMP accumulation in a variety of cell types (1–8). In some cases, the inhibition of cAMP accumulation is exerted on Ca2+-inhibitable adenylyl cyclases (ACs) (1–3, 5–7), whereas in others the effect may be mediated by Ca2+-calmodulin-dependent phosphodiesterases (PDE1) (4, 8). ACs are extremely discriminating in terms of the source of the Ca2+ to which they respond (9). In non-excitable cells, Ca2+-sensitive ACs respond only to CCE (9), whereas other modes of elevating [Ca2+]i, including release from intracellular stores (6, 7, 10) and ionophore- (6, 7, 10) or arachidonic acid-mediated Ca2+ entry (11), are ineffective. This dependence, along with other evidence, suggests that Ca2+-sensitive ACs and CCE channels must be functionally co-localized and that cellular strategies are in place to ensure their association (12, 13). By contrast, although type I PDEs (PDE1) are known to be markedly stimulated by Ca2+ acting via calmodulin in vitro, little if anything is known about the mode of [Ca2+]i rise to which they will respond in the intact cell.

In the human astrocytoma cell line 1321N1, the activation of receptors that stimulate the formation of inositol 1,4,5-trisphosphate (InsP3) substantially inhibits cAMP accumulation (8, 14, 15). Complete reversal of the inhibition by PDE1-specific inhibitors is consonant with the agonist-evoked rise in [Ca2+]i-activating PDE1 and hence increasing the rate of cAMP hydrolysis (16). Indeed, these early studies established that PDE1 activity is markedly increased when Ca2+ is introduced into the extracellular medium (14, 15). Therefore, PDE1 does seem to be regulated by [Ca2+]i, but the source of the Ca2+ to which PDE1 responds and whether PDE1 is as discriminating as Ca2+-sensitive ACs has never been addressed.

In the present study, we first characterized the various modes by which [Ca2+]i could be elevated in 1321N1 cells. We then established a variety of conditions to manipulate [Ca2+]i so that we could ask whether PDE1 discriminates between Ca2+ signaling pathways, viz. Ca2+ released from intracellular stores, and the different modes of Ca2+ entry. We also established by RT-PCR that PDE1A was the only PDE1 isoform expressed in these cells. Furthermore, we compared the effect of Ca2+ entry following stimulation with the muscarinic agonist carbachol (CCh) or non-selective entry mediated by the ionophore, ionomycin, and the triggering of CCE by the sarco(endo)plasmic reticulum Ca2+-ATPase inhibitor, thapsigargin, on isoproterenol-evoked cAMP accumulation. Our findings establish that Ca2+ entry is the major stimulus for PDE1A in 1321N1 cells, but unlike Ca2+-sensitive ACs, PDE1A does not discriminate between different modes of Ca2+ entry. We wondered whether the lack of selectivity for the source of Ca2+ entry was related to the subcellular distribution of PDE1A. Following fractionation of the cells, we found that Ca2+-calmodulin-stimulated PDE activity was detected in the cytosol and the non-plasma membrane organellar compartments of the cell. Therefore, it would appear that the more diffuse subcellular organization of PDE1A renders it susceptible to non-selective Ca2+ entry. Nevertheless, under physiological conditions, CCE is the dominant Ca2+ entry pathway in these cells and the dependence of PDE1A activation on CCE would be evident.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Materials—Bovine serum albumin (BSA; fraction V), calmodulin (bovine brain), cAMP, carbachol (CCh), forskolin, gadolinium (III) chloride, 3-isobutyl-1-methylxanthine (IBMX), (±)-isoproterenol, 8-methoxymethyl 3-isobutyl-1-methylxanthine (MMX), oligonucleotide primers, Ro20-1724, rolipram, TaqDNA polymerase, and tissue culture media were from Sigma (Poole, UK). 5'-AMP, 2-aminoethoxydiphenylborate (2-APB), ionomycin, and thapsigargin (Tg) were obtained from Calbiochem. Fura-2AM was obtained from Molecular Probes (Leiden, The Netherlands). [Adenine-U-14C]cAMP, [2-3H]adenine, [2,8-3H]cAMP, and [{alpha}-32P]ATP were purchased from Amersham Biosciences. A Total RNA Isolation kit was from Promega (Southampton, UK) and Superscript II enzyme from Invitrogen.

Cell Culture—1321N1 human astrocytoma cells (European Collection of Cell Cultures, Porton Down, UK) were grown in Dulbecco's modified Eagle's medium supplemented with fetal bovine serum (10%) and L-glutamine (2 mM) and maintained at 37 °C in a humidified atmosphere (95% air: 5% CO2). Because the efficacy of muscarinic agonists to inhibit isoproterenol-evoked cAMP accumulation in 1321N1 cells is considerably less in 1- to 3-day cultures compared with that in cells cultured for 4–12 days (15), all experiments were carried out using cells that had been subcultured for 5–7 days prior to use.

Measurement of [Ca2+]i in Cell Populations—[Ca2+]i was measured in Fura-2-loaded cells using a PerkinElmer Life Sciences LS50B spectrofluorometer. Briefly, cells were plated onto 100-mm diameter Petri dishes and grown for 5–7 days until ~80% confluent. The cells were then incubated (1 h, 20 °C) in Krebs-buffered saline (KBS: 120 mM NaCl, 4.75 mM KCl, 1.44 mM MgSO4, 1.1 mM CaCl2, 11mM D-glucose, 25 mM HEPES, pH 7.4) containing 1 mg/ml BSA and 2 µM Fura-2AM. The medium was replaced with KBS in the absence of Fura-2AM for a further 1 h to allow for de-esterification. Following loading and deesterification, the cells were detached from the Petri dish with phosphate-buffered saline (PBS: 12.1 mM Na2HPO4, 4mM KH2PO4, and 130 mM NaCl, pH 7.4) containing 0.03% EDTA. Cells were centrifuged (195 x g, 5 min) and resuspended in KBS (1 x 107 cells/ml). Prior to experiments, 4 x 106 cells were resuspended in 3 ml of nominally Ca2+-free KBS (KBS without added Ca2+) and transferred to a stirred cuvette at 30 °C. After a 1-min equilibrium interval, test substances were added from 1000-fold stock solutions. Fluorescence ratios (F340/F380) were corrected for autofluorescence by the addition of 1 µM ionomycin and 1 mM MnCl2 and calibrated to [Ca2+]i using a data table prepared using standard Ca2+ solutions (Calcium Calibration kit with 1 mM MgCl2; Molecular Probes).

Measurement of Intracellular cAMP Accumulation—Intracellular cAMP levels were measured as previously described by Evans et al. (17) with some modifications. 1321N1 cells were incubated in Dulbecco's modified Eagle's medium (2 h, 37 °C) supplemented with [2-3H]adenine (1 µCi/ml) to label the ATP pool. The cells were washed and incubated (30 °C, 10 min) with KBS. After further washing, cells were incubated in either nominally Ca2+-free KBS or Ca2+-free KBS (nominally Ca2+-free KBS supplemented with 1 mM EGTA) with test reagents. The assays were terminated by aspirating the medium and replacing it with ice-cold 10% trichloroacetic acid. Unlabeled cAMP (100 µl, 10 mM), ATP (10 µl, 65 mM), and [{alpha}-32P]ATP (~3,000 cpm) were added to measure the recovery of cAMP and ATP. After centrifugation (16,089 x g, 6 min), the [{alpha}-32P]ATP and [2,8-3H]cAMP content of the supernatant was determined by anion exchange chromatography using the standard Dowex/alumina protocol (18).

Preparation of Membranes from 1321N1 Cells for Adenylyl Cyclase Assay—1321N1 cells that were grown for 5 days in 75-cm2 flasks were detached with PBS containing 0.03% w/v EDTA and centrifuged at 195 x g for 5 min. The supernatant was removed, and the pellet was resuspended in 2 ml of hypotonic buffer (HB buffer: 2 mM MgCl2, 1 mM EDTA, 50 mM Tris-HCl, 1 mM 4-(2-aminoethyl)benzensulfonyl fluoride, 1mM benzamidine, 1 µg of DNase I, pH 7.4), and the cells were lysed by repeatedly passing the cell suspension through a 21-gauge needle. After centrifugation (195 x g, 5 min) and further dissociation, the lysate was centrifuged at 17,257 x g (15 min, 4 °C). The supernatant was removed, and the pellet (crude membrane fraction) was resuspended in 250–500 µl of assay buffer (assay buffer: 40 mM Tris-HCl, 800 µM EGTA, 0.25% w/v BSA, pH 7.4) and stored in liquid nitrogen until required.

Measurement of Adenylyl Cyclase Activity—Adenylyl cyclase activity was measured as previously described (2). Briefly, 1321N1 membranes (4 µg of protein) were incubated (20 min, 30 °C) in the presence of 12 mM phosphocreatine, 1.4 mM MgCl2, 40 µM GTP, 100 µM cAMP, 100 µM ATP, 25 units/ml creatine kinase, 70 mM Tris-Cl, 500 µM IBMX, and 1 µCi [{alpha}-32P]ATP with 10 µM forskolin and 10 µM isoproterenol and Ca2+ (see under "Determination of Free Ca2+ Concentrations" below). Reactions were terminated by the addition of 100 µl ice-cold stopper buffer (43.9 mM ATP, 3.19 mM cAMP, and 1% w/v SDS). [2,8-3H]cAMP (~3000 cpm) was added as a recovery marker, and the amount of [32P]cAMP that was formed was quantified as previously described (18).

Cell Fractionation—1321N1 cells were grown for 5 days in 150-mm diameter dishes and then detached with PBS containing 0.03% w/v EDTA and centrifuged at 195 x g for 5 min. The pellet was resuspended in 1 ml of assay buffer (50 mM Tris-HCl, pH 7.4) supplemented with 1 mM phenylmethylsulfonyl fluoride, 1 mM benzamidine, 2 mM 4-(2-aminoethyl)benzensulfonyl fluoride, 1 mM EDTA, 130 µM bestatin, 14 µM E-64, 1 µM leupeptin, 0.3 µM aprotinin, and 1 µg of DNase I. The cells were then lysed by repeatedly passing the cell suspension through a 21-gauge needle. Unbroken cells and nuclei were removed from the lysate by low speed centrifugation (195 x g, 5 min, 4 °C). The supernatant was removed and centrifuged (17,257 x g, 15 min, 4 °C) to pellet the crude membrane fraction (containing plasma membranes) (19), and the resulting supernatant ("crude cytosolic" fraction) was either used immediately or fractionated further before use. To separate the cytosol from the non-plasma membrane organellar components of the cell, the "crude cytosolic" fraction was centrifuged at high speed (105,000 x g, 60 min, 4 °C) (20). The final supernatant was designated as the cytosolic fraction and the pellet as the organellar fraction (21). All final fractions were suspended in an equal total volume of 50 mM Tris-HCl supplemented with 0.2% w/v BSA and 4 mM dithiothreitol (pH 7.4) and used immediately. The protein content was determined by using the bicinchoninic acid method (22).

Measurement of Cyclic Nucleotide Phosphodiesterase Activity—Phosphodiesterase activity was measured as described by Shahid and Nicholson (23) with some modifications. Briefly, equal volumes of subcellular fractions were incubated (15 min, 30 °C) with 5 nCi of [2,8-3H]cAMP, 4 µM unlabeled cAMP, 3 mM MgCl2, 1 mM 5'-AMP, 0.24 µM calmodulin, 200 µM EGTA, and various Ca2+ concentrations (see under "Determination of Free Ca2+ Concentrations" below) in 50 mM Tris-HCl (pH 7.4) in a final volume of 200 µl. Reactions were terminated by heating the assay mixture at 100 °C for 3 min. [Adenine-U-14C]cAMP (~3000 dpm) was added to each sample to measure the recovery of [2,8-3H]cAMP from alumina columns (23). The amount of [2,8-3H]cAMP that was hydrolyzed was quantified by expressing the corresponding [2,8-3H]cAMP counts following recovery from the columns as a function of the total [2,8-3H]cAMP added to each assay tube. Blank values were obtained by using previously boiled preparations. There was no significant difference between the decrease in the amount of cAMP detected with boiled enzymes and when no protein was added. The amount of cAMP that was hydrolyzed was expressed as either picomoles of cAMP/min/mg of protein or picomoles of cAMP/min/µl of fraction.

Determination of Free Ca2+ Concentrations—Free Ca2+ concentrations were calculated as previously described (24). Briefly, this involved an iterative computing program that solved equations that described the complexes formed within a mixture composed of the assay buffer components (see under "Measurement of Adenylyl Cyclase Activity" and "Measurement of Phosphodiesterase Activity" above). Final assay mixture concentrations of free Ca2+ (in the presence of 200 µM EGTA) are shown.

Reverse Transcriptase-PCR—Total RNA was extracted from 1.5 x 106 1321N1 cells using the SV total RNA isolation kit (Promega). RNA (1 µg) was reverse-transcribed by Superscript II enzyme with 0.5 µg of oligo(dT)16. The reaction mixture was incubated at 42 °C for 50 min, followed by a further incubation at 70 °C for 15 min. PCR was performed using 10 ng of cDNA, 10 pmol of each of the two specific primers, 1.5 mM MgCl2, 0.2 mM dNTPs, and 2.5 units of TaqDNA polymerase. The specific primers were CCATTTTCCCCACTTTGTGATCG, an N-terminal primer common to all PDE1 isoforms; TCCACCTCTCTTTGTTCTGC, a C-terminal primer specific for PDE1A; CGTCAATGGACATCTGGTTGG, a C-terminal primer specific for PDE1B; and TTCTCCTCTTTGGGTACCTTGGC, a C-terminal primer specific for PDE1C. The amplification profile consisted of heating the mixture at 94 °C for 30 s, annealing at 55 °C for 30 s, and extension at 72 °C for 30 s, for 30 cycles (an initial heating to 94 °C for 3 min was performed). To ensure the fidelity of mRNA extraction and reverse transcription, the cDNA was subjected to PCR amplification with oligonucleotide primers specific for the constitutively expressed gene {beta}-actin.

Statistical Analysis—Results are shown as the means ± S.E. of the mean (means ± S.E.) of at least three individual experiments. Statistical significance was assessed by using paired Student's t test, where p ≤ 0.05 was considered significant.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
CCh Mediates a Ca2+-dependent Decrease in Isoproterenol-evoked cAMP Accumulation—Stimulation of endogenous {beta}-adrenoceptors in 1321N1 cells with isoproterenol evoked a concentration-dependent increase in cAMP accumulation (EC50 = 8.7 ± 0.1 nM, n = 3) (Fig. 1A, inset). The time course for cAMP accumulation after stimulation with a maximal concentration of isoproterenol (10 µM) in the presence and absence of CCh (1 mM) was examined (Fig. 1A). In Ca2+-free conditions, isoproterenol stimulated a time-dependent increase in cAMP accumulation that reached a maximum level after 10 min. A similar profile was observed in cells that were co-stimulated with isoproterenol and CCh in Ca2+-free conditions or isoproterenol alone in the presence of 3 mM Ca2+. However, co-stimulation with isoproterenol (10 µM) and CCh (1 mM) in Ca2+-containing medium produced two notable effects. First, there was a significant decrease in the amount of cAMP detected after each time interval compared with that evoked by isoproterenol alone, and second, the time required to achieve a maximal cAMP response was reduced from 10 to 2 min (Fig. 1A).



View larger version (16K):
[in this window]
[in a new window]
  		FIG. 1.
CCh-mediated inhibition of isoproterenol-evoked cAMP accumulation requires extracellular Ca2+. A, cells were incubated in Ca2+-free KBS with either isoproterenol alone (10 µM; filled circles) or with isoproterenol in the presence of CCh (1 mM; filled squares) for the time intervals indicated. The effect of adding 3 mM CaCl2 to the extracellular medium is shown by the open symbols. Results represent the means ± S.E. of eight independent experiments. Inset, concentration dependence of isoproterenol-evoked cAMP accumulation (mean ± S.E., n = 4), where C represents the basal cAMP level. B, cells were pre-treated with ionomycin (10 µM, 10 min) in Ca2+-free KBS and then stimulated (5 min) with either 10 µM isoproterenol alone or in the presence of 1 mM CCh. The results show the increase in the cAMP level above basal and are expressed as the means ± S.E. of four independent experiments. Control cells were incubated in Ca2+-free KBS for 10 min prior to the addition of 10 µM isoproterenol.

 
To confirm that the effect of CCh on isoproterenol-evoked cAMP accumulation was indeed Ca2+-dependent, cells were depleted of Ca2+ by pre-treatment with ionomycin in the absence of extracellular Ca2+. This has the effect of causing extrusion of Ca2+ from intracellular stores out of the cell. Under such circumstances, it was possible to isolate any potential action of CCh on isoproterenol-evoked cAMP accumulation that was independent of Ca2+ mobilization from Ca2+-dependent effects. Because the removal of both extracellular and intracellular sources of Ca2+ eliminated the inhibitory effect of CCh on isoproterenol-evoked cAMP accumulation (Fig. 1B), it is possible to conclude that the observed inhibition of cAMP accumulation by CCh is a consequence of a rise in [Ca2+]i.

The relative effects of what was assumed to be Ca2+ release from InsP3-sensitive stores and Ca2+ entry on isoproterenol-evoked cAMP accumulation were compared as a function of the total inhibition evoked by CCh, i.e. that attributable to the increase in [Ca2+]i due to release plus entry in the presence of extracellular Ca2+. Of the total inhibition of the cAMP response by CCh, 22 ± 6% (n = 25) (viz. in the absence of extracellular Ca2+) was dependent on Ca2+ released from intracellular stores and 78 ± 6% (n = 25) on Ca2+ influx.

The extrusion of cAMP from the cell may provide a theoretical means (in addition to phosphodiesterases) whereby an intracellular cAMP signal may be rapidly diminished (25). Although the identity of the cAMP transporters remains unclear (25), we considered the possibility that the rise in [Ca2+]i evoked by CCh could enhance the extrusion of cAMP from the cell. It turned out that, in the presence of 3 mM Ca2+, the amount of cAMP detected in the extracellular medium following exposure to isoproterenol (10 µM) and CCh (1 mM) was 11.88 ± 3.27% (n = 4) of the total cAMP level compared with 7.96 ± 1.10% (n = 4) with isoproterenol alone. Obviously, changes in this small fraction of the total cAMP cannot account for the present effects of CCh on isoproterenol-evoked cAMP accumulation.

Characterization of Adenylyl Cyclase in 1321N1 Cells—The regulation of adenylyl cyclases (ACs) by elevated [Ca2+]i provides a means whereby Ca2+ can modulate the cAMP pathway at the earliest opportunity. Of the 10 known isoforms of AC, five are either stimulated or inhibited by physiological increases in [Ca2+]i (9). AC1, AC3, and AC8 are activated by Ca2+ in a calmodulin-dependent manner, whereas AC5 and AC6 are Ca2+-inhibitable, but calmodulin-independent (9). Therefore, a possible explanation for the inhibitory effect of CCh on isoproterenol-evoked cAMP accumulation (Fig. 1A) could be the inhibition of AC activity by Ca2+. To address this issue, the sensitivity of ACs to Ca2+ was measured using membranes prepared from 1321N1 cells. AC activity in 1321N1 membranes was inhibited by Ca2+ in a concentration-dependent manner (IC50 = 273 ± 25 nM, n = 3), which was unaffected by calmodulin (IC50 = 279 ± 80 nM, n = 3) (Fig. 2). Thus 1321N1 cell membranes express either AC5 or AC6 adenylyl cyclase. However, inhibition of adenylyl cyclase cannot play any role in the inhibition of cAMP accumulation observed in the present studies, because the inhibition is eliminated in the presence of PDE inhibitors (see below); a situation that does not arise when direct inhibition of adenylyl cyclase occurs in intact cells (2, 7).



View larger version (18K):
[in this window]
[in a new window]
  		FIG. 2.
Adenylyl cyclase activity in 1321N1 cells is inhibited by Ca2+. Membranes prepared from 1321N1 cells were assayed for adenylyl cyclase activity in the presence of the concentrations of Ca2+ shown. Membranes were assayed with 10 µM forskolin, 10 µM isoproterenol, and 100 µM ATP in either the absence (filled circles) or presence (open circles) of 1 µM calmodulin. The results show the means ± S.E. of three independent experiments.

 
The Activation of PDE1A by Ca2+ Entry Underlies the Mechanism for the Inhibition of Isoproterenol-evoked cAMP Accumulation—Of the 11 known members of the PDE family (26), only PDE1 (27) and PDE4 (28) are directly regulated by a rise in [Ca2+]i. However, the mechanisms whereby Ca2+ regulates these enzymes are different: PDE1 is directly activated following the binding of Ca2+-calmodulin (29), whereas intracellular Ca2+ facilitates the association of PDE4A1 with the Golgi membrane (28) without affecting its activity (30). Indirect effects of Ca2+ (e.g. protein kinase C) on other Ca2+-insensitive PDEs may also account for the enhanced cAMP hydrolysis in the presence of CCh.

Three forms of PDE have been identified in 1321N1 cells: PDE1, a Ro20-1724-sensitive PDE (presumably PDE4) and a putative cGMP-stimulated PDE (16). Therefore, we employed selective PDE inhibitors to identify the PDE species that might mediate the inhibitory effect of CCh on isoproterenol-evoked cAMP accumulation (Fig. 3). The PDE1-specific inhibitor MMX (31, 32) reversed the inhibitory effects of CCh on isoproterenol-evoked cAMP accumulation in a concentration-dependent manner (EC50 = 20.1 ± 4.2 µM, n = 6) (Fig. 3A). This EC50 value corresponds to the reported IC50 value for the inhibition of PDE1 by MMX (32). The non-selective PDE inhibitor, IBMX (31), also completely reversed the inhibitory effect of CCh on isoproterenol-evoked cAMP accumulation (Fig. 3B). The PDE4-specific inhibitors, rolipram (33, 34) and Ro20-1724 (33, 34), increased the amount of cAMP detected after stimulation with isoproterenol alone (1.49 ± 0.12- and 1.56 ± 0.09-fold (n = 4), respectively); however, neither inhibitor attenuated the inhibition of cAMP accumulation by CCh (Fig. 3B). Furthermore, because 50 µM MMX (a concentration that selectively inhibits PDE1 (32, 35)) was as effective as 50 µM IBMX at reversing CCh-mediated inhibition of the cAMP response, we can conclude that the inhibitory effect of CCh is mediated by PDE1.



View larger version (15K):
[in this window]
[in a new window]
  		FIG. 3.
PDE1 mediates the effect of CCh on isoproterenol-evoked cAMP accumulation. A, concentration-dependent reversal of the effect of CCh (1 mM) on isoproterenol (10 µM, 5 min)-evoked cAMP accumulation (mean ± S.E., n = 6) by MMX. The results show the increase in cAMP accumulation after subtraction of the responses to isoproterenol in the presence of CCh. The results are expressed as a percentage of the response to isoproterenol alone. B, the increase in the intracellular cAMP level evoked by either isoproterenol alone (10 µM, 5 min; solid bars) or in the presence of CCh (1 mM; open bars) is shown after pre-treatment with IBMX (50 µM, 10 min), MMX (50 µM, 10 min), rolipram (Roli; 10 µM, 10 min), and Ro20-1724 (Ro20; 10 µM, 10 min). A and B, cells were stimulated in nominally Ca2+-free KBS supplemented with 3 mM CaCl2. The results show the means ± S.E. of four independent experiments. Asterisks denote a statistical difference between responses to isoproterenol alone and isoproterenol in the presence of CCh (p ≤ 0.05).

 
PDE2 is the only PDE directly activated by cGMP (26) and is the most likely candidate for the third PDE identified in 1321N1 cells (16). Although protein kinase C phosphorylates and activates PDE2 (36), in fact, stimulation of protein kinase C enhances cAMP accumulation in 1321N1 cells independently of PDE (37). Therefore, cGMP-stimulated PDE plays little or no role in controlling intracellular cAMP signals in these cells. We conclude that the inhibitory effect of CCh on cAMP accumulation is a direct effect of intracellular Ca2+ on PDE1, and any indirect effects of the rise in [Ca2+]i on other PDEs is highly unlikely. This issue is tackled more directly in the cell fractionation studies described later (see Fig. 8).



View larger version (16K):
[in this window]
[in a new window]
  		FIG. 8.
Subcellular localization of PDE1A. Crude cytosolic and membrane fractions prepared from 1321N1 cells were assayed for PDE activity in the presence of the concentrations of Ca2+ shown. The fractions were assayed with 4 µM cAMP, 3 mM MgCl2, 200 µM EGTA, and 0.24 µM calmodulin. A, the concentration-dependent stimulation of PDE activity in the crude cytosolic fraction by Ca2+ (mean ± S.E., n = 5). B and C, the increase in PDE activity evoked by Ca2+ in crude cytosolic (B) and crude membrane (C) fractions in the absence (solid bars) and presence (open bars) of 50 µM MMX. Results show the means ± S.E. of three independent experiments.

 
To identify the subtype of PDE1 that was expressed in 1321N1 cells, RT-PCR was performed using total RNA and isoform-specific primers for the PDE1A, PDE1B, and PDE1C genes and a primer that was common to all PDE1s. Of the three PDE1 isoforms (26), only PDE1A mRNA was detected in 1321N1 cells (Fig. 4). Therefore, the observed inhibitory effect of Ca2+ entry on isoproterenol-evoked cAMP accumulation is mediated by PDE1A.



View larger version (42K):
[in this window]
[in a new window]
  		FIG. 4.
RT-PCR of PDE1 subtypes from total RNA prepared from 1321N1 cells. RT-PCR was performed as described under "Experimental Procedures." The results shown are typical of three individual experiments.

 
PDE1A Is Activated by Capacitative Ca2+ Entry—The experiments described hitherto have inferred that Ca2+ entry plays a role in activating PDE1 in 1321N1 cells, but without measuring [Ca2+]i, it is not possible to address the mechanism with any precision. When [Ca2+]i is monitored it is possible to manipulate and isolate various modes of [Ca2+]i rise and determine their significance for the regulation of PDE1. Consequently, in the following series of experiments we established conditions where known modes of Ca2+ rises were triggered, and we then applied those conditions to measurements of cAMP accumulation.

Thapsigargin (Tg) is used to manipulate CCE, because it inhibits sarco(endo)plasmic reticulum Ca2+-ATPases of InsP3-sensitive Ca2+ stores, allowing them to be emptied independently of receptor activation (38). By unmasking the basal leak of Ca2+ from InsP3-sensitive stores, Tg (1 µM, 15 min) evoked a slow and transient increase in [Ca2+]i (Fig. 5A). The subsequent addition of 3 mM Ca2+ to the extracellular medium resulted in a substantial, concentration-dependent CCE (39) (Fig. 5A). Furthermore, Gd3+ (10 µM) and 2-APB (100 µM), two known inhibitors of CCE (40, 41), inhibited Tg-induced Ca2+ entry by 89 ± 2% (n = 16) and 86 ± 5% (n = 10), respectively (Fig. 5, B and C), confirming that depleting intracellular stores with Tg triggers CCE in these cells.



View larger version (28K):
[in this window]
[in a new window]
  		FIG. 5.
Capacitative Ca2+ entry activates PDE1. A–C, after a 1-min equilibrium period in nominally Ca2+-free KBS, cells were incubated with thapsigargin (Tg; 1 µM, 15 min) to empty their intracellular Ca2+ stores before the addition of Ca2+ to the medium. A, capacitative Ca2+ entry after addition of 3 mM (a), 1 mM (b), 300 µM (c), and 0 mM (d) CaCl2. B and C, thapsigargin-treated cells were incubated (5 min) with either 10 µM Gd3+ (B) or 100 µM 2-APB (C) prior to the addition of 3 mM CaCl2. A–C, representative traces from at least three independent experiments. D, experiments performed under the identical conditions as that shown in A–C, showing the effects of CCE on the amount of cAMP detected after stimulation (5 min) with 10 µM isoproterenol. The effects of thapsigargin pre-treatment, Gd3+ (10 µM), IBMX (50 µM), and MMX (50 µM) on isoproterenol-evoked cAMP accumulation are also shown. Where indicated, IBMX and MMX were present 10 min before and throughout the experiment. Results represent the means ± S.E. of four individual experiments. The asterisk denotes a statistically significant difference from the response to isoproterenol alone (p ≤ 0.05).

 
In excitable cells, a major mode of Ca2+ entry is through voltage-gated Ca2+ channels (42). To evaluate whether voltagegated Ca2+ channels might represent an additional route for Ca2+-mediated regulation of PDE1A in 1321N1 cells, we looked for Ca2+ influx in the presence of depolarizing concentrations of KCl (20–60 mM). Not even the highest concentration of KCl could trigger Ca2+ entry (data not shown), which concurs with the reported absence of voltage-gated Ca2+ entry channels in 1321N1 cells (43, 44). Therefore, this issue cannot be resolved with this model system.

The effect of CCE on isoproterenol-evoked cAMP accumulation was examined under analogous experimental conditions as those used for the Ca2+ measurements described above (Fig. 5D). Incubating the cells with Tg (1 µM, 15 min) alone did not significantly affect isoproterenol-evoked cAMP accumulation in 1321N1 cells (Fig. 5D). However, the addition of 3 mM Ca2+ after 15-min incubation with Tg significantly reduced the isoproterenol-evoked cAMP response (51 ± 5%, n = 4), an effect that was abolished by preincubating cells with low concentrations of IBMX (50 µM, 10 min), MMX (50 µM, 10 min), or Gd3+ (10 µM, 5 min) (Fig. 5D). These results show that Ca2+ influx through CCE channels can enhance the hydrolysis of cAMP by activating PDE1A.

Characterization of CCh-induced Ca2+ Entry and Its Effect on PDE1A—Recently, the physiological role of CCE has been brought into question by some reports suggesting that arachidonic acid-dependent "non-capacitative Ca2+ entry" (NCCE) is a dominant Ca2+ entry pathway that is preferentially activated by physiological concentrations of agonists (41, 45, 46). The activation of muscarinic M3 receptors leads to the formation of InsP3 and diacylglycerol via phospholipase C. Diacylglycerol may be further metabolized to produce arachidonic acid. Even though arachidonic acid-dependent NCCE has only been demonstrated in a few cell types (41, 46), it seemed reasonable to entertain the possibility that CCh might activate both NCCE and CCE in 1321N1 cells.

In nominally Ca2+-free medium, CCh (1 mM) evoked a transient increase in [Ca2+]i (1143 ± 152 nM, n = 5), which rapidly returned to its basal level (t1/2 = 24 ± 2s, n = 5) (Fig. 6A). The subsequent addition of Ca2+ to the medium, triggered a second Ca2+ signal that represented Ca2+ entry. The peak increase in [Ca2+]i that followed Ca2+ entry was 712 ± 109 nM (n = 5). The Ca2+ signal attributable to Ca2+ entry did not return to the basal level, but achieved a steady state at an elevated [Ca2+]i. The rate at which the Ca2+ signal reached the steady-state was significantly longer for the Ca2+entry phase than that of the release phase (half-time, t1/2 = 93 ± 29s, n = 5).



View larger version (15K):
[in this window]
[in a new window]
  		FIG. 6.
CCh activates PDE1 through capacitative Ca2+ entry. A, after a 1-min equilibrium period in nominally Ca2+-free KBS, cells were stimulated with 1 mM CCh (15 min) before the addition of 3 mM CaCl2 into the extracellular medium. The upper trace shows the rise in [Ca2+]i under control conditions, and the lower trace shows the response after 5-min incubation with 10 µM Gd3+ prior to the addition of CaCl2. Similar results were obtained from three independent experiments. B, following an experimental procedure that was analogous to that shown in A, cells were first stimulated with CCh (1 mM, 15 min) in nominally Ca2+-free KBS then isoproterenol (10 µM, 5 min) in the presence and absence of 3 mM CaCl2. The effect of pre-treatment with 10 µM Gd3+ on the inhibition of isoproterenol-evoked cAMP accumulation by CCh-induced Ca2+ entry is also shown. Results show the means ± S.E. of eight independent experiments. The asterisk denotes a significant difference from the response to isoproterenol alone (p ≤ 0.05).

 
The effects of the CCE blocker, Gd3+, on Ca2+ entry induced by 1 mM CCh is shown in Fig. 6A. Preincubating cells (5 min) with 10 µM Gd3+ inhibited CCh-induced Ca2+ entry by 86 ± 2% (n = 5) (cf., Fig. 5B). Therefore, the inhibition of isoproterenol-evoked cAMP accumulation by CCh shown in Fig. 2 can be interpreted to be the consequence of CCh-induced CCE activating PDE1A. This, however, does not exclude the possibility that, at lower concentrations of CCh, NCCE could regulate the activity of PDE1A.2 To address this issue, we examined the nature of the Ca2+ influx that was promoted by low concentrations of CCh (10–30 µM) in the presence of 100 µM 2-APB. A short incubation (5 min) with 100 µM 2-APB reduced the Ca2+ entry that followed the application of 10–30 µM CCh (data not shown). This blocking effect of 2-APB on Ca2+ entry triggered by low concentrations of CCh indicates that NCCE does not occur in 1321N1 cells.

A Generalized Rise in [Ca2+]i Can Activate PDE1A—To determine whether a similarly intimate relationship existed between PDE1A and CCE in 1321N1 cells, as between Ca2+-sensitive ACs and CCE, we compared the effects of Tg-induced CCE with a generalized ionophore-mediated Ca2+ entry on PDE1 activity. At submicromolar concentrations, ionomycin selectively permeabilizes intracellular membranes (47) facilitating the flux of Ca2+ from organelles into the cytosol to trigger CCE. However, at higher concentrations, ionomycin also permeabilizes the plasma membrane to divalent cations (48) to cause a generalized increase in [Ca2+]i that is independent of Ca2+ entry channels and which cannot be blocked by CCE channel blockers.

Ionomycin (10 µM, 15 min) evoked a dramatic increase in [Ca2+]i that corresponded to the emptying of intracellular Ca2+ stores (Fig. 7A). The subsequent addition of Ca2+ to the extracellular medium caused a concentration-dependent increase in [Ca2+]i. The response to 30 µM Ca2+ was similar in magnitude to that evoked by 3 mM Ca2+ in Tg pre-treated cells (576 ± 89 nM, n = 9 and 527 ± 86 nM, n = 10, respectively) (Fig. 7A). This ionomycin-mediated Ca2+ entry was unaffected by 2-APB (100 µM) (Fig. 7B) at a concentration that inhibited CCE (Fig. 4C) confirming that it was a non-selective entry mechanism.



View larger version (19K):
[in this window]
[in a new window]
  		FIG. 7.
PDE1 is activated by a generalized increase in [Ca2+]i. After 1 min in nominally Ca2+-free KBS, cells were incubated with ionomycin (10 µM, 15 min) prior to the addition of CaCl2 into the extracellular medium. A, Ca2+ entry in ionomycin-pre-treated cells after the addition of 70 µM (a), 30 µM (b), 10 µM (c), and 0 mM (d) CaCl2. B, ionomycin-treated cells were incubated with the CCE blocker 2-APB (100 µM) (gray line) in nominally Ca2+-free KBS for 5 min before the addition of 30 µM CaCl2. The control response is shown by the black line. Traces (A and B) are representative of at least three independent experiments. C, under identical conditions to A and B, cells were incubated with ionomycin (10 µM, 15 min) in nominally Ca2+-free medium before the addition of isoproterenol (10 µM, 5 min) in the presence of 30 µM extracellular Ca2+. Where indicated, IBMX (50 µM) and MMX (50 µM) were present 10 min before and throughout the experiment. Results are the means ± S.E. of four experiments. The asterisk denotes a statistically significant difference from the response to isoproterenol alone (p ≤ 0.05).

 
Under identical conditions to those used in the Ca2+ measurements, ionomycin alone did not significantly affect isoproterenol-evoked cAMP accumulation (Fig. 7C). However, the addition of 30 µM Ca2+ to the extracellular medium produced a substantial inhibition of isoproterenol-evoked cAMP accumulation in ionomycin-pre-treated cells (41 ± 8%, n = 4). The effect was completely reversed by IBMX (50 µM) and MMX (50 µM) (Fig. 7C). This result establishes that not only CCE, but also a nonspecific, generalized rise in [Ca2+]i can activate PDE1 in 1321N1 cells.

PDE1A Is Distributed within the Cytosol and Non-plasma Membrane Organellar Compartments of 1321N1 Cells—The functional co-localization of Ca2+-sensitive ACs with CCE channels is reinforced by their subcellular distribution (12, 13). The disparity between the selectivity of ACs and the nonselectivity of PDE1 for particular sources of Ca2+ entry pathways might therefore be explained by the spatial distribution of the enzymes within the cell. To examine this possibility, we initially measured Ca2+-calmodulin-dependent PDE activity in crude membrane and "crude cytosolic" fractions prepared from 1321N1 cells (Fig. 8). In the presence of calmodulin, Ca2+ evoked a concentration-dependent increase in PDE activity in the cytosolic fraction (Fig. 8A), which was completely inhibited by the PDE1-specific inhibitor MMX (50 µM) (Fig. 8B). By contrast, Ca2+-calmodulin-dependent PDE activity was not detected in the membrane fraction (Fig. 8C).

We considered the possibility that the crude cytosol described above could include non-plasma membrane organelles with which PDE1A would be associated. Therefore, we fractionated the crude cytosolic fraction into cytosol and organellar components and measured the Ca2+-calmodulin-dependent PDE activity. AC activity was also measured to show the subcellular distribution of PDE1A relative to plasma membrane-associated ACs. Ca2+-calmodulin-dependent PDE activity occurred in the cytosol and, to a slightly lesser extent, in the organellar components of the cells (Fig. 9A, panels i and ii), but was absent from the plasma membrane (Fig. 9A, panel iii). In all cases, the Ca2+-calmodulin-dependent increase in PDE activity was abolished by the PDE1-specific inhibitor MMX (50 µM). In contrast, all AC activity was localized to the crude plasma membrane fraction (Fig. 9B) (19).



View larger version (20K):
[in this window]
[in a new window]
  		FIG. 9.
PDE1A is associated both with the cytosol and the non-plasma membrane organellar components of 1321N1 cells. Cytosolic (i), organellar (ii), and crude plasma membrane (iii) fractions were prepared from 1321N1 cells as described under "Experimental Procedures" and assayed for both PDE (A) and AC activity (B). Ca2+-calmodulin-dependent PDE activity was assayed with 4 µM cAMP, 3 mM MgCl2, and 0.24 µM calmodulin in the absence (solid bars) and presence (open bars) of 50 µM MMX. AC activity was measured after co-stimulation with 10 µM forskolin (FK) and 10 µM isoproterenol (ISO). Results show the means ± S.E. of three independent experiments.

 
The experiments described above examined the subcellular distribution of PDE1A at resting [Ca2+]i. Because the effect of elevated [Ca2+]i on the subcellular localization of PDE1 has never been explored, we entertained the further possibility that the intracellular targeting of PDE1A may be a function of the rise in [Ca2+]i that follows agonist stimulation in a manner analogous to PDE4A1 (28). 1321N1 cells were treated with ionomycin (10 µM) and Ca2+ (30 µM) as shown in Fig. 7 prior to lysis, and the PDE activity in the different cellular fractions was measured (data not shown). Increasing [Ca2+]i prior to lysis did not affect the subcellular distribution of PDE1A compared with resting [Ca2+]i. Therefore, PDE1A is likely to remain cytosolic or associated with organellar membranes in 1321N1 cells, and it seems reasonable to conclude that it is this diffuse organization that renders the enzyme susceptible to non-selective Ca2+ entry.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
The regulation of ACs by Ca2+ has been extensively characterized (9). In the intact cell, they show a remarkable dependence on CCE: neither release from intracellular stores (6, 7, 10) nor ionophore- (6, 7, 10) or arachidonic acid-mediated Ca2+ entry (11) affect AC activity. As a consequence, Ca2+-sensitive ACs have been postulated to lie close to CCE channels in the plasma membrane. In contrast, very little is known about the regulation of Ca2+-sensitive PDEs by Ca2+. Although earlier work has established that activation of Ca2+-calmodulin-dependent PDE1 requires extracellular Ca2+ (15, 16) the nature of the Ca2+ signal involved has never been explored. In the present study, we first characterized the various modes of [Ca2+]i elevation in the human astrocytoma cell line, 1321N1. By using selective PDE inhibitors, we established that 1321N1 cells express endogenous PDE1, and through RT-PCR identified PDE1A as the only PDE1 isoform expressed in these cells. We then manipulated [Ca2+]i by various means to ask (i) whether Ca2+ release from intracellular stores regulates PDE1 activity, (ii) whether CCE activates PDE1 and, (iii) whether any other mode of elevating [Ca2+]i could regulate PDE1. Finally, we explored the subcellular distribution of PDE1A as a potential determinant in its selectivity toward Ca2+ from a particular source.

In 1321N1 cells, CCh evokes an increase in [Ca2+]i through the formation of InsP3 and the subsequent release of Ca2+ from InsP3-sensitive stores (49). Because removal of extracellular Ca2+ almost eliminates the inhibitory effects of InsP3-coupled agonists on cAMP accumulation in 1321N1 cells, we can infer that release of Ca2+ from intracellular stores plays little role in the regulation of PDE1A. The importance of Ca2+ entry versus Ca2+ release for the regulation of PDE1A is emphasized when the substantial, but relatively ineffective rise in [Ca2+]i due to Ca2+ release is compared with the robust effect of a similar rise in [Ca2+]i due to Ca2+ influx (see Fig. 6).

In non-excitable cells, CCE plays a critical role in determining the amplitude of sustained elevations in [Ca2+]i and replenishing depleted intracellular Ca2+ stores. Although the identity of store-operated Ca2+ channels remains unclear, prime candidates for the role are mammalian homologues of the Drosophila transient receptor potential (trp) protein (50). The localization of these trp proteins and Ca2+-sensitive ACs in cholesterol-rich domains of the plasma membrane (51) may provide the means whereby Ca2+-sensitive ACs are exclusively regulated by CCE. Our findings show that CCE triggered independently of receptor activation (i.e. Tg) causes a profound increase in PDE1A activity (Fig. 5). Although CCE clearly stimulates PDE1A, the use of Tg to induce CCE may overlook modes of Ca2+ entry that are stimulated by agonists, in addition to CCE. For example, when CCh increases InsP3 formation in 1321N1 cells (49), it may be assumed that the depletion of CCh-sensitive Ca2+ stores will trigger CCE. However, CCh may also activate NCCE through a diacylglycerol/arachidonic acid-driven pathway. It turned out that known CCE blockers abolished CCh-induced Ca2+ entry and its effect on PDE1 (Fig. 6). Therefore, we can conclude that CCE is the primary route of Ca2+ entry and the major stimulus for PDE1A activation in 1321N1 cells.

The dependence of PDE1 activity on Ca2+ influx might reflect either the functional co-localization of the enzyme with Ca2+ entry channels, localization of the enzyme near the plasma membrane, or simply a requirement for a sustained elevation of [Ca2+]i, irrespective of its origin. To distinguish between these possibilities, we devised conditions where the effect on PDE1A activity of non-selective Ca2+ influx could be compared with that of CCE. Unlike CCE, ionophore-mediated Ca2+ entry is not restricted to discrete regions of the plasma membrane, but allows a nonspecific influx of Ca2+ into the cell (6). The experimental conditions developed permitted ionomycin to cause a substantial increase in [Ca2+]i in the presence of a low concentration of Ca2+ (30 µM) that evoked no CCE in Tg-treated cells (Figs. 5 and 7). The failure of CCE blockers to inhibit ionomycin-mediated Ca2+ entry established that ionomycin stimulated nonspecific Ca2+ entry in 1321N1 cells. This ionomycin-mediated Ca2+ entry also activated PDE1A, and so we conclude that PDE1A requires sustained Ca2+ entry for activation, but unlike Ca2+-sensitive ACs, it does not discriminate between the different routes of Ca2+ entry. However, the possibility should not be discounted that other PDE1 isoforms (viz. PDE1B or PDE1C) might be more selective for the source of Ca2+ to which they will respond. Future studies involving heterologous expression of the various isoforms might be insightful in this regard.

The disparity between the regulation of Ca2+-sensitive ACs and PDE1A by Ca2+ is most likely to reflect the subcellular placement of these enzymes. A major contributing factor for the regulation of Ca2+-sensitive ACs by CCE is their compartmentalization in cholesterol-rich domains of the plasma membrane (12, 13). Indeed, other proteins that are specifically regulated by CCE are also targeted to this domain, as are trp proteins (51, 52). Unlike ACs, which possess twelve transmembrane-spanning domains and are always associated with the plasma membrane, only some of the known PDEs have the potential to be associated with the plasma membrane, and this is dependent on lipid modifications to amino acids in their N-terminal regions (20, 26). The subcellular distribution of PDEs is largely determined by the formation of signaling complexes with scaffolding proteins (53). Although extremely little is known about the intracellular targeting of PDE1, at resting [Ca2+]i the enzyme is likely to be distributed within the cytosol (54) or associated with cytoskeletal components (55) (Fig. 9).

Although PDE1A does not discriminate between specific and nonspecific routes of Ca2+ entry it is highly selective for Ca2+ entering the cell versus Ca2+ released from intracellular stores. The dependence of PDE1A on Ca2+ entering the cell may be another manifestation of its subcellular distribution. Selective targeting of PDE1A to the sub-plasmalemmal space (possibly through association with cytoskeletal, accessory proteins, or organellar structures) could allow regulation of the enzyme by Ca2+ entry, while potentially shielding it from Ca2+ released from intracellular stores.

In conclusion, the present study has significantly refined our understanding of how PDE1 is regulated by [Ca2+]i. It is clear that Ca2+ released from intracellular stores plays little or no role in the regulation of PDE1A compared with robust activation by Ca2+ influx. However, PDE1A is unable to discriminate between the different sources of Ca2+ entry owing to its subcellular distribution. Nevertheless, it is worth noting that, in a physiological context, where artificial modes of elevating [Ca2+]i are not available, as with ACs, a dependence of PDE1A on CCE would be manifest, and it would be the duration of the influx of Ca2+ that would determine for how long PDE1A was activated.


   FOOTNOTES
 
* The work was supported by the Wellcome Trust and the National Institutes of Health. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

{ddagger} To whom correspondence should be addressed. Tel.: 44-1223-334-063; Fax: 44-1223-334-040; E-mail: dmfc2{at}cam.ac.uk.

1 The abbreviations used are: [Ca2+]i, intracellular free Ca2+ concentration; AC, adenylyl cyclase; 2-APB, 2-aminoethoxydiphenyl borate; CCE, capacitive Ca2+ entry; CCh, carbachol; IBMX, 3-isobutyl-1-methylxanthine; MMX, 8-methoxymethyl 3-isobutyl-1-methylxanthine; NCCE, non-capacitative Ca2+ entry; PDE, cyclic nucleotide phosphodiesterase; RT, reverse transcriptase; Tg, thapsigargin; InsP3, inositol 1,4,5-trisphosphate; BSA, bovine serum albumin; KBS, Krebs-buffered saline; PBS, phosphate-buffered saline. Back

2 It is considered that, in sources where both occur, NCCE is triggered by low concentrations of agonist (or arachidonate) and is not blocked by 2-APB, whereas high concentrations of agonist trigger CCE, which is blocked by 2-APB (56). Back


   ACKNOWLEDGMENTS
 
We are grateful to Dr. Debbie Willoughby for careful reading of the manuscript.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. DeBernardi, M. A., Seki, T., and Brooker, G. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 9257–9261[Abstract/Free Full Text]
  2. Boyajian, C. L., Garritsen, A., and Cooper, D. M. F. (1991) J. Biol. Chem. 266, 4995–5003[Abstract/Free Full Text]
  3. Webb, J. G., Yates, P. W., Yang, Q., Mukhin, Y. V., and Lanier, S. M. (2001) Am. J. Physiol. 281, H1545–H1552
  4. Han, P., Werber, J., Surana, M., Fleischer, N., and Michaeli, T. (1999) J. Biol. Chem. 274, 22337–22344[Abstract/Free Full Text]
  5. Colvin, R. A., Oibo, J. A., and Allen, R. A. (1991) Cell Calcium 12, 19–27[CrossRef][Medline] [Order article via Infotrieve]
  6. Fagan, K. A., Mons, N., and Cooper, D. M. F. (1998) J. Biol. Chem. 273, 9297–9305[Abstract/Free Full Text]
  7. Chiono, M., Mahey, R., Tate, G., and Cooper, D. M. F. (1995) J. Biol. Chem. 270, 1149–1155[Abstract/Free Full Text]
  8. Nakahata, N., Martin, M. W., Hughes, A. R., Hepler, J. R., and Harden, T. K. (1986) Mol. Pharmacol. 29, 188–195[Abstract]
  9. Cooper, D. M. F. (2003) Biochem. J. 375, 517–529[CrossRef][Medline] [Order article via Infotrieve]
  10. Fagan, K. A., Mahey, R., and Cooper, D. M. F. (1996) J. Biol. Chem. 271, 12438–12444[Abstract/Free Full Text]
  11. Shuttleworth, T. J., and Thompson, J. L. (1999) J. Biol. Chem. 274, 31174–31178[Abstract/Free Full Text]
  12. Fagan, K. A., Smith, K. E., and Cooper, D. M. F. (2000) J. Biol. Chem. 275, 26530–26537[Abstract/Free Full Text]
  13. Smith, K. E., Gu, C., Fagan, K. A., Hu, B., and Cooper, D. M. F. (2002) J. Biol. Chem. 277, 6025–6031[Abstract/Free Full Text]
  14. Gross, R. A., and Clark, R. B. (1977) Mol. Pharmacol. 13, 242–250[Abstract/Free Full Text]
  15. Meeker, R. B., and Harden, T. K. (1982) Mol. Pharmacol. 22, 310–319[Abstract]
  16. Tanner, L. I., Harden, T. K., Wells, J. N., and Martin, M. W. (1986) Mol. Pharmacol. 29, 455–460[Abstract]
  17. Evans, T., Smith, M. M., Tanner, L. I., and Harden, T. K. (1984) Mol. Pharmacol. 26, 395–404[Abstract]
  18. Salomon, Y., Londos, C., and Rodbell, M. (1974) Anal. Biochem. 58, 541–548[CrossRef][Medline] [Order article via Infotrieve]
  19. Gu, C., and Cooper, D. M. F. (2000) J. Biol. Chem. 275, 6980–6986[Abstract/Free Full Text]
  20. Shakur, Y., Takeda, K., Kenan, Y., Yu, Z. X., Rena, G., Brandt, D., Houslay, M. D., Degerman, E., Ferrans, V. J., and Manganiello, V. C. (2000) J. Biol. Chem. 275, 38749–38761[Abstract/Free Full Text]
  21. Gil, J., Larrinaga, G., Meana, J. J., Rodriguez-Puertas, R., Irazusta, J., and Casis, L. (2001) Neuropeptides 35, 276–284[Medline] [Order article via Infotrieve]
  22. Smith, P. K., Krohn, R. I., Hermanson, G. T., Mallia, A. K., Gartner, F. H., Provenzano, M. D., Fujimoto, E. K., Goeke, N. M., Olson, B. J., and Klenk, D. C. (1985) Anal. Biochem. 150, 76–85[CrossRef][Medline] [Order article via Infotrieve]
  23. Shahid, M., and Nicholson, C. D. (1995) Methods Mol. Biol. 41, 129–150[Medline] [Order article via Infotrieve]
  24. Ahlijanian, M. K., and Cooper, D. M. F. (1987) J. Pharmacol. Exp. Ther. 241, 407–414[Abstract/Free Full Text]
  25. Jackson, E. K., and Raghvendra, D. K. (2004) Annu. Rev. Physiol. 66, 571–599[CrossRef][Medline] [Order article via Infotrieve]
  26. Conti, M. (2000) Mol. Endocrinol. 14, 1317–1327[Free Full Text]
  27. Kakiuchi, S., and Yamazaki, R. (1970) Biochem. Biophys. Res. Commun. 41, 1104–1110[CrossRef][Medline] [Order article via Infotrieve]
  28. Baillie, G. S., Huston, E., Scotland, G., Hodgkin, M., Gall, I., Peden, A. H., MacKenzie, C., Houslay, E. S., Currie, R., Pettitt, T. R., Walmsley, A. R., Wakelam, M. J., Warwicker, J., and Houslay, M. D. (2002) J. Biol. Chem. 277, 28298–28309[Abstract/Free Full Text]
  29. Sonnenburg, W. K., Seger, D., Kwak, K. S., Huang, J., Charbonneau, H., and Beavo, J. A. (1995) J. Biol. Chem. 270, 30989–31000[Abstract/Free Full Text]
  30. Shakur, Y., Wilson, M., Pooley, L., Lobban, M., Griffiths, S. L., Campbell, A. M., Beattie, J., Daly, C., and Houslay, M. D. (1995) Biochem. J. 306, 801–809
  31. Beavo, J. A., and Reifsnyder, D. H. (1990) Trends Pharm. Sci. 11, 150–155[CrossRef][Medline] [Order article via Infotrieve]
  32. Wells, J. N., and Miller, J. R. (1988) Methods Enzymol. 159, 489–496[Medline] [Order article via Infotrieve]
  33. Reeves, M. L., Leigh, B. K., and England, P. J. (1987) Biochem. J. 241, 535–541[Medline] [Order article via Infotrieve]
  34. Houslay, M. D., Sullivan, M., and Bolger, G. B. (1998) Adv. Pharmacol. 44, 225–342
  35. Rybalkin, S. D., Rybalkina, I., Beavo, J. A., and Bornfeldt, K. E. (2002) Circ. Res. 90, 151–157[Abstract/Free Full Text]
  36. Geoffroy, V., Fouque, F., Nivet, V., Clot, J. P., Lugnier, C., Desbuquois, B., and Benelli, C. (1999) Eur. J. Biochem. 259, 892–900[Medline] [Order article via Infotrieve]
  37. Johnson, R. A., and Toews, M. L. (1990) Mol. Pharmacol. 37, 296–303[Abstract]
  38. Thastrup, O., Cullen, P. J., Drobak, B. K., Hanley, M. R., and Dawson, A. P. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 2466–2470[Abstract/Free Full Text]
  39. Putney, J. W., Jr. (1986) Cell Calcium 7, 1–12[CrossRef][Medline] [Order article via Infotrieve]
  40. Bootman, M. D., Collins, T. J., Mackenzie, L., Roderick, H. L., Berridge, M. J., and Peppiatt, C. M. (2002) FASEB J. 16, 1145–1150[Abstract/Free Full Text]
  41. Broad, L. M., Cannon, T. R., and Taylor, C. W. (1999) J. Physiol. 517, 121–134[Abstract/Free Full Text]
  42. Dolphin, A. C. (1996) Trends. Neurosci. 19, 35–43[CrossRef][Medline] [Order article via Infotrieve]
  43. Hirota, K., and Lambert, D. G. (1997) Neurosci. Lett. 223, 169–172[CrossRef][Medline] [Order article via Infotrieve]
  44. Noronha-Blob, L., Richard, C., and U'Prichard, D. C. (1988) J. Neurochem. 50, 1381–1390[Medline] [Order article via Infotrieve]
  45. Mignen, O., Thompson, J. L., and Shuttleworth, T. J. (2001) J. Biol. Chem. 276, 35676–35683[Abstract/Free Full Text]
  46. Shuttleworth, T. J. (1996) J. Biol. Chem. 271, 21720–21725[Abstract/Free Full Text]
  47. Morgan, A. J., and Jacob, R. (1994) Biochem. J. 300, 665–672
  48. Liu, C., and Hermann, T. E. (1978) J. Biol. Chem. 253, 5892–5894[Abstract/Free Full Text]
  49. Masters, S. B., Harden, T. K., and Brown, J. H. (1984) Mol. Pharmacol. 26, 149–155[Abstract]
  50. Montell, C., Birnbaumer, L., and Flockerzi, V. (2002) Cell. 108, 595–598[CrossRef][Medline] [Order article via Infotrieve]
  51. Lockwich, T. P., Liu, X., Singh, B. B., Jadlowiec, J., Weiland, S., and Ambudkar, I. S. (2000) J. Biol. Chem. 275, 11934–11942[Abstract/Free Full Text]
  52. Lin, S., Fagan, K. A., Li, K. X., Shaul, P. W., Cooper, D. M. F., and Rodman, D. M. (2000) J. Biol. Chem. 275, 17979–17985[Abstract/Free Full Text]
  53. Houslay, M. D., and Adams, D. R. (2003) Biochem. J. 370, 1–18[CrossRef][Medline] [Order article via Infotrieve]
  54. Giorgi, M., Giordano, D., Rosati, J., Tata, A. M., and Augusti-Tocco, G. (2002) J. Neurochem. 80, 970–979[Medline] [Order article via Infotrieve]
  55. Runge, M. S., Detrich, H. W., 3rd, and Williams, R. C., Jr. (1979) Biochemistry 18, 1689–1698[CrossRef][Medline] [Order article via Infotrieve]
  56. Mignen, O., Thompson, J. L., and Shuttleworth, T. J. (2003) J. Biol. Chem. 278, 10174–10181[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 Am. J. Physiol. Cell Physiol.Home page
L. E. Fridlyand, M. C. Harbeck, M. W. Roe, and L. H. Philipson
Regulation of cAMP dynamics by Ca2+ and G protein-coupled receptors in the pancreatic -cell: a computational approach
Am J Physiol Cell Physiol, December 1, 2007; 293(6): C1924 - C1933.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
F. Murray, H. H. Patel, R. Y. S. Suda, S. Zhang, P. A. Thistlethwaite, J. X.-J. Yuan, and P. A. Insel
Expression and activity of cAMP phosphodiesterase isoforms in pulmonary artery smooth muscle cells from patients with pulmonary hypertension: role for PDE1
Am J Physiol Lung Cell Mol Physiol, January 1, 2007; 292(1): L294 - L303.
[Abstract] [Full Text] [PDF]

Home page
 JCBHome page
A. Gerbino, W. C. Ruder, S. Curci, T. Pozzan, M. Zaccolo, and A. M. Hofer
Termination of cAMP signals by Ca2+ and G{alpha}i via extracellular Ca2+ sensors: a link to intracellular Ca2+ oscillations
J. Cell Biol., October 24, 2005; 171(2): 303 - 312.
[Abstract] [Full Text] [PDF]

Home page
 Biol. Reprod.Home page
V. Vasta, W. K. Sonnenburg, C. Yan, S. H. Soderling, M. Shimizu-Albergine, and J. A. Beavo
Identification of a New Variant of PDE1A Calmodulin-Stimulated Cyclic Nucleotide Phosphodiesterase Expressed in Mouse Sperm
Biol Reprod, October 1, 2005; 73(4): 598 - 609.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
L. R. Landa Jr., M. Harbeck, K. Kaihara, O. Chepurny, K. Kitiphongspattana, O. Graf, V. O. Nikolaev, M. J. Lohse, G. G. Holz, and M. W. Roe
Interplay of Ca2+ and cAMP Signaling in the Insulin-secreting MIN6 {beta}-Cell Line
J. Biol. Chem., September 2, 2005; 280(35): 31294 - 31302.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
279/39/40494    most recent
M313441200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Goraya, T. A.
Right arrow Articles by Cooper, D. M. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Goraya, T. A.
Right arrow Articles by Cooper, D. M. F.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2004 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement