HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 279, Issue 39, 40802-40806, September 24, 2004

This Article Abstract Full Text (PDF) All Versions of this Article: 279/39/40802    most recent M403589200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Fuda, C. Articles by Mobashery, S. Search for Related Content PubMed PubMed Citation Articles by Fuda, C. Articles by Mobashery, S. Social Bookmarking                      What's this?

The Basis for Resistance to -Lactam Antibiotics by Penicillin-binding Protein 2a of Methicillin-resistant Staphylococcus aureus^*

Cosimo Fuda, Maxim Suvorov, Sergei B. Vakulenko, and Shahriar Mobashery

From the Department of Chemistry and Biochemistry, University of Notre Dame, Notre Dame, Indiana 46556

Received for publication, March 31, 2004 , and in revised form, June 1, 2004.

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS AND DISCUSSION REFERENCES

 
Penicillin-binding protein 2a (PBP2a) of Staphylococcus aureus is refractory to inhibition by available -lactam antibiotics, resulting in resistance to these antibiotics. The strains of S. aureus that have acquired the mecA gene for PBP2a are designated as methicillin-resistant S. aureus (MRSA). The mecA gene was cloned and expressed in Escherichia coli, and PBP2a was purified to homogeneity. The kinetic parameters for interactions of several -lactam antibiotics (penicillins, cephalosporins, and a carbapenem) and PBP2a were evaluated. The enzyme manifests resistance to covalent modification by -lactam antibiotics at the active site serine residue in two ways. First, the microscopic rate constant for acylation (k₂) is attenuated by 3 to 4 orders of magnitude over the corresponding determinations for penicillin-sensitive penicillin-binding proteins. Second, the enzyme shows elevated dissociation constants (K_d) for the non-covalent pre-acylation complexes with the antibiotics, the formation of which ultimately would lead to enzyme acylation. The two factors working in concert effectively prevent enzyme acylation by the antibiotics in vivo, giving rise to drug resistance. Given the opportunity to form the acyl enzyme species in in vitro experiments, circular dichroism measurements revealed that the enzyme undergoes substantial conformational changes in the course of the process that would lead to enzyme acylation. The observed conformational changes are likely to be a hallmark for how this enzyme carries out its catalytic function in cross-linking the bacterial cell wall.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS AND DISCUSSION REFERENCES

 
Emergence of bacterial strains designated as methicillin-resistant Staphylococcus aureus (MRSA)¹ from the 1960s to the present has created clinical difficulties for nosocomial infections worldwide (1). The genetic determinant for this resistance is mecA, which is not native to S. aureus but has been acquired by it many times over the past 40 years from unknown sources (2). The gene product of mecA is a penicillin-binding protein (PBP) designated PBP2a. S. aureus normally produces four PBPs (3), enzymes that are anchored on the cytoplasmic membrane, the functions of which are the assembly and regulation of the latter stages of the cell wall biosynthesis (4, 5). Whereas these four PBPs are susceptible to modification by -lactam antibiotics, an event that leads to bacterial death, PBP2a is refractory to the action of all available -lactam antibiotics. PBP2a is capable of taking over the functions of the four typical PBPs of S. aureus in the face of the challenge by -lactam antibiotics.

The pharmaceutical industry responded by initiating research programs in the discovery of novel -lactams that will inhibit PBP2a. A few cephalosporins have been identified, of which a handful has now advanced into clinical trials for MRSA treatment (6–8). Also, the clinical urgency has been met in the past few years by the introduction of Synercid (a combination of quinupristin and dalfopristin) (9), daptomycin (10), and linezolid (an oxazolidinone) (11) for treatment of MRSA. However, resistance to all of these agents exists, and the recent emergence of variants of MRSA resistant to linezolid (12) and glycopeptide antibiotics (13–16) has created a situation in which certain strains of S. aureus are either treatable only with a single class of antibiotics or are simply not treatable, which is a disconcerting situation clinically.

As -lactams (penicillins, cephalosporins, carbapenems, etc.) arguably remain the most important antibiotics clinically (55% of all antibiotics used globally belong to this class), it is imperative to understand the molecular mechanisms for resistance to these antibiotics. This mechanistic knowledge, along with structural information (17), should prove indispensable in devising strategies to circumvent the clinical problem presented by MRSA. In this vein, we report herein our cloning, expression, and purification of PBP2a of S. aureus. Kinetics were carried out with a series of -lactam antibiotics to explore their interactions with PBP2a. Furthermore, we report on our results in understanding the incremental steps in the catalytic process of PBP2a. The enzyme undergoes a substantial conformational change in the course of its interactions with -lactam antibiotics, which should have implications for the catalytic events of PBP2a in cross-linking of the bacterial cell wall.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS AND DISCUSSION REFERENCES

 
Cloning of PBP2a—Chromosomal DNA of S. aureus ATCC706986 was isolated using a DNeasy tissue kit (Qiagen). The mecA gene was amplified without the sequence encoding its 23-amino acid-long N-terminal anchoring region using two oligonucleotide primers, SAPBP-2a-1D (TAATCCATGGCTTCAAAAGATAAAGAAAT) and SAPBP2a-R (TAATAAGCTTCTGTTTTGTTATTCATCTATAT). These primers contain recognition sequences for the restriction endonucleases NcoI and HindIII (italicized) that were utilized for cloning of the PCR product into the corresponding sites of expression vector pET24d(+). Recombinant plasmid was initially used to transform competent cells of Escherichia coli JM83. Both DNA strands of the mecA gene from several transformants were sequenced, and recombinant plasmid was used to transform competent cells of E. coli BL21(DE3).

Site-directed Mutagenesis—To produce mutants of PBP2a, the mecA gene was recloned from the pET24d(+) vector into the smaller vector pUC19 using sites for the restriction endonucleases XbaI and HindIII. The QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA) was utilized to produce three mutant derivatives of PBP2a. To obtain the K406A mutant two mutagenic primers, MecS/A-d (CCAGGTTCAACTCAAGCAATATTAACAGCAATG) and MecS/A-r (CATTGCTGTTAATATTGCTTGAGTTGAACCTGG), that include the codon GCA (in bold) for alanine instead of that for lysine (AAA) were used. Two other mutagenic primers, SaurY519PD (GCTGATTCAGGTTTCGGACAAAGTGAAAT) and SaurY519PD (ATTTCACTTTGTCCGAAACCTGAATCAGC), that contain the TTC codon for phenylalanine (in bold) were used to introduce the Y519F mutant derivative of PBP2a. The double mutant enzyme, K406A/Y519F, was produced by introducing a second substitution into the K406A mutant derivative. After mutagenesis the nucleotide sequence for each of the genes producing mutant enzymes was verified, and these genes were recloned between the NcoI and HindIII sites of the pET24d(+) expression vector.

Expression of Wild-type PBP2a and Its Mutant Variants K406A, K406A/Y519F, and Y519F in E. coli—The wild-type PBP2a and K406A, K406A/Y519F, and Y519F mutant variants were each expressed using the same method. E. coli BL21 (DE3) was transformed with the plasmid pET24d(+), which contained the wild-type and mutant mecA gene in its multiple cloning site. A 3-ml overnight seed culture was used to inoculate 500 ml of the LB medium supplemented with kanamycin (30 µg/ml). Cells were grown at 37 °C with shaking (120 rpm) until the A₆₀₀ reached 0.8 (about 6 h) followed by the addition of 0.4 mM isopropyl--D-thiogalactopyranoside to induce expression. The bacterial culture was then incubated at 25 °C for another 20 h. Cells were harvested by centrifugation at 5500 x g for 10 min at 4 °C, and the pellet was suspended in 10 mM Tris/HCl buffer, pH 8 (buffer A).

Purification of Wild-type and Mutant PBP2a—The wild-type PBP2a and its mutants K406A, K406A/Y519F, and Y519F were each purified using the same three-step purification protocol with an LP chromatography system (Pharmacia) at 4 °C. Cells were disrupted by 30 cycles of sonication (20 s of burst and 20 s of rest for each cycle) using a Branson sonifer. The resulting supernatant was then centrifuged at 14,000 x g for 25 min using a Beckman-Coulter centrifuge. Pelletting, suspension in buffer A, and sonication were each repeated three times to ensure a high yield. The resultant cell-free extract was loaded at 2 ml/min onto a Q-Sepharose column (2.5 x 30 cm; 80 ml of High Q support resin, Bio-Rad) equilibrated with buffer A. The proteins were eluted with a linear gradient of 0–0.3 M NaCl in buffer A at 4 ml/min (total volume of 800 ml). PBP2a eluted at 0.10–0.15 M NaCl as determined by SDS-PAGE.

The fractions containing PBP2a were combined, concentrated, and brought to 1.5 M (NH₄)₂SO₄ in buffer A. The combined solution was then loaded at 2 ml/min onto a phenyl-agarose column (2.5 x 30 cm; 60 ml of phenyl-agarose resin, Sigma) equilibrated with 1.5 M (NH₄)₂SO₄ in buffer A. The protein was eluted with a linear gradient of 1.5–0.5 M (NH₄)₂SO₄ in buffer A at 4 ml/min (total volume of 600 ml). The fractions containing PBP2a eluted at 1.2–0.8 M (NH₄)₂SO₄ and were identified by SDS-PAGE.

The protein fractions were combined and concentrated, and the buffer was exchanged to 0.2 M NaCl in buffer B (50 mM sodium phosphate, pH 7.0) and loaded at 1.0 ml/min onto a Sepharose column (2.5 x 50 cm; 160 ml of High S support resin, Bio-Rad) equilibrated with buffer B. The protein was eluted with a linear gradient of 0.2–1.0 M NaCl in buffer B at 1.5 ml/min to a final volume of 1500 ml. PBP2a was eluted from the column at 0.6–0.8 M NaCl. The fractions were combined, dialyzed against 25 mM Hepes in 1 M NaCl, pH 7.0. The protein concentration was determined with the BCA protein assay kit (Pierce). The yield from a 500-ml cell culture of either the wild-type PBP2a, the K406A mutant, or the Y519F mutant was 20 mg. The double mutant K406A/Y519F yielded 10 mg from a 500-ml cell culture. Each was concentrated to 12 mg/ml. The wild-type and mutant proteins used in our experiments were all homogenous (data not shown).

¹³C NMR Experiments—The wild-type PBP2a protein (5 mg) was dialyzed against several changes of degassed 25 mM sodium acetate buffer (pH 4.5) and then against degassed 50 mM sodium phosphate, 0.15 mM NaCl, 0.1 mM EDTA, pH 7.0. Subsequently, the protein was dialyzed against buffer containing 50 mM sodium phosphate, 0.15 mM NaCl, 10% D₂O, and 20 mM NaH¹³CO₃ (the source of CO₂). The protein was concentrated to 0.15 mM. The ¹³C NMR spectrum of the wild-type PBP2a protein indicated no modification of the protein by ¹³C-labeled carbon dioxide. The procedure did not affect the quality of the protein because the pseudo first-order rate constants for acylation of the protein by nitrocefin with and without this treatment remained the same.

Determination of the Kinetic Parameters for Interactions of -Lactam Antibiotics with the PBP2a Protein—PBP2a experiences acylation at the active site serine, and the acyl enzyme species slowly undergoes deacylation according to Equation 1.

(Eq. 1)

E represents PBP2a, EI is the non-covalent pre-acylation complex, E-I is the covalent acyl enzyme species, and P denotes the product of hydrolysis of the -lactam antibiotic. The first-order rate constants for protein acylation were determined for different -lactam compounds using a Cary 50 UV spectrophotometer (Varian Inc.) at room temperature. The parameters for the reaction between PBP2a and nitrocefin were determined directly by monitoring the formation of the acyl enzyme species at 500 nM (₅₀₀ = +15,900 cm^-1 M^-1). The experiments were carried out in 25 mM Hepes, 1 M NaCl (pH 7.0) buffer. The observed first-order rate constants (k_obs) were measured at a protein concentration of 2.5 µM with different concentrations of nitrocefin (20–120 µM) and monitored for 45 min each, at which time the protein was invariably acylated.

Nitrocefin (120 µM) was used as the reporter molecule to determine the apparent first-order rate constants for acylation by other non-chromogenic (or poorly chromogenic) -lactams at varying concentrations in competition experiments (18).

The deacylation rate constants for wild-type PBP2a were determined using BOCILLIN FL as a reporter molecule (19). A typical reaction mixture (60 µl) contained 15 µM of PBP2a and a -lactam antibiotic concentration at least 2-fold higher than its K_d value. The mixture was incubated at room temperature for 45 min in 25 mM Hepes, 1 M NaCl (pH 7.0) buffer. The excess -lactam was removed by passing the mixture through a Micro Bio-Spin®6 column (Bio-Rad). An aliquot (3 µl) of the mixture was diluted 5-fold with the same buffer and incubated at room temperature for different time intervals. The amount of the free protein, liberated from the acyl protein species, was assayed by the addition of BOCILLIN FL to afford a final concentration of 40 µM and incubated for an additional 45 min at room temperature. SDS sample buffer (15 µl) was added to the reaction mixture, which was then boiled for 3 min. The samples (30 µl in total) were loaded onto a 10% SDS-polyacrylamide gel, which was developed and then scanned using a Storm840® Fluorimager.

Circular Dichroism—The CD spectra of the wild-type PBP2a (6 µM in 25 mM Hepes, 1 M NaCl, pH 7.0) were recorded on a Jasco J-600 instrument (Easton, MD, 5-mm path length) in the absence and presence of 30 µM oxacillin or 30 µM ceftazidime. The -lactams had negligible CD readings compared with the protein. Regardless, the contribution of the -lactam substrate was subtracted in each case. The proteins were incubated with the -lactam antibiotics at 25 °C.

	RESULTS AND DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS AND DISCUSSION REFERENCES

 
PBP2a has been cloned and studied by others (20–25). We have cloned this protein for our studies as well. The mecA gene was PCR-amplified from the chromosomal DNA of S. aureus ATCC706986 without the 69 base pairs in the 5'-region encoding the 23-amino acid-long N-terminal membrane anchor. The gene was cloned between the NcoI and HindIII sites of the expression vector pET24d(+), and PBP2a was produced intracellularly after induction with isopropyl--D-thiogalactopyranoside. The gene was recloned into the XbaI and HindIII sites of the smaller plasmid pUC19 to produce mutant variants of the mecA gene efficiently. Subsequent to mutagenesis, the corresponding genes were recloned back between the NcoI and HindIII sites of the pET24d(+) vector, and the enzymes were produced intracellularly by isopropyl--D-thiogalactopyranoside induction. PBP2a was purified to apparent homogeneity in three chromatographic steps. We typically obtained 40 mg of pure protein from a liter of culture.

We have evaluated the kinetics of interactions of three cephalosporins (nitrocefin, cefepime and ceftazidime), two penicillins (ampicillin and oxacillin), and one carbapenem (imipenem) with PBP2a (Table I). PBP2a, as with virtually all other known PBPs, undergoes acylation with its peptidoglycan substrate at an active site serine (Ser-403) for its transpeptidase activity (cell wall cross-linking). The acyl enzyme species then undergoes the transpeptidation reaction with another strand of the peptidoglycan. -Lactam antibiotics subvert this process by undergoing the enzyme acylation process, but the resulting complex is often stable such that the enzyme is inactivated, and the organism is deprived of its vital function.

View this table: [in this window] [in a new window]   TABLE I Kinetics parameters for interactions of -lactam antibiotics with the wild-type PBP2

We hasten to add that the kinetic parameters that we report herein are somewhat different from those reported by Lu et al. (29), who used a mass spectrometric approach for analysis of kinetics. Whereas our K_d values are sufficiently high to preclude enzyme acylation when considering the in vivo situation, the corresponding numbers by Lu et al. (29) were substantially higher than ours (high millimolar range).

The issue of activation of the active site serine is of interest. As will be discussed below, Ser-403 is well sheltered within the active site and its side chain hydroxyl is in contact with the side chain of Lys-406 (8). This arrangement of Ser-X-X-Lys for PBPs and related -lactamases is understood to be important for the mechanisms of these enzymes (30). We have shown that when the corresponding lysine is mutated to alanine in the OXA-10 -lactamase, the enzyme cannot undergo acylation by its substrate (31). A similar mutation in the penicillin-binding protein BlaR from S. aureus was shown to attenuate the rate of protein acylation by 6730-fold (32). The K406A mutant variant of PBP2a underwent extremely sluggish acylation. The effect was mostly on k₂, which was attenuated by 80- to 130-fold for the mutant variant (Table II). Whereas the magnitude of the effect is relatively small, this level of attenuation reduces the already sluggish rate of acylation to the range of 10^-5 s^-1, which is the basal level that was attained for the BlaR protein and not far from the undetectable levels seen for the same mutation in the OXA-10 enzyme. Hence, in the cases of the BlaR and the OXA-10 proteins the acylation rate constants were higher, so the drops in their magnitudes were also larger on mutation. However, the basal level that we have observed for the lysine to alanine mutant variants in all three proteins were essentially the same.

View this table: [in this window] [in a new window]   TABLE II Kinetic parameters for the interactions of K406A, Y519F, and K406A/Y519F mutant PBP2a variants with three -lactam antibiotics

It is noteworthy that at least one penicillin-binding protein is now shown to be carboxylated in the side chain of its active site lysine (product of carbon dioxide addition to the lysine side chain amine) (16). In light of the reversibility of lysine carboxylation in proteins, there are known examples of lysine-carboxylated proteins that were identified by x-ray crystallography in their non-carboxylated forms. Hence, there was a possibility that PBP2a might be carboxylated at Lys-406. We carried out the diagnostic ¹³C NMR experiment for detection of protein lysine carboxylation with PBP2a, as reported for other proteins previously (15, 16). The experiment showed that PBP2a is not carboxylated at any lysine, and thus the crystal structure depicts the correct structure for Lys-406.

As shown in Fig. 1A, the x-ray structure of PBP2a reveals that the active site of the enzyme is not an open cleft. Indeed, the access to the active site is not obvious from the x-ray structure. Lim and Strynadka (17) have shown that the acyl enzyme species with -lactam antibiotics largely maintains the active site in the same conformation with small movements within the immediate vicinity of the ligand away from that seen in the native enzyme (Fig. 1, B and C). A conformational change to open the active site would appear to be necessary both for the turnover events with the peptidoglycan substrate and for interactions with inhibitors such as -lactam antibiotics.

View larger version (123K): [in this window] [in a new window]   FIG. 1. Active site of PBP2a from the x-ray structure. A, a stereo view to the active site environment from the x-ray structure of PBP2a is rendered as a solvent-accessible surface (Connolly surface, green), whereas important residues in the active site are shown in a capped sticks representation. A dotted Connolly surface (purple) is used to demonstrate the surface of the regions that cover the active site opening. B, a stereo view of the secondary structures (orange tube representation) and various important residues for the native enzyme structure is depicted. C, the penicillin G/PBP2a acyl enzyme complex is shown. (Penicillin G is shown in yellow, and capped sticks are color-coded according to atom types; oxygen, nitrogen, and carbon are shown in red, blue, and white, respectively.) The perspectives are the same for all three panels.

View larger version (23K): [in this window] [in a new window]   FIG. 2. Circular dichroic spectra of PBP2a in the presence of -lactam antibiotics. A, the far-UV CD spectrum of the wild-type PBP2a () during oxacillin turnover at 1 h (), 24 h (), 48 h (), and 72h(•). B, change in the molar ellipticity of the wild-type PBP2a at 208 (•) and 222 nm () as a function of time during turnover of oxacillin. C, the far-UV CD spectrum of the wild-type PBP2a () during ceftazidime turnover at 1 h (), 24 h (), 48 h (), and 72 h (•). D, change in the molar ellipticity of the wild-type PBP2a at 208 nm (•) and 222 nm () as a function of time during turnover of ceftazidime.

A pertinent question on activity should be whether truncation by removal of the membrane anchor would affect activity. The conclusion from studies by others is that there is no consequential difference on activity with the loss of the membrane anchor (29). This is also entirely in accordance with the x-ray structure for PBP2a, which indicates that the point of insertion into the membrane by the membrane-spanning portion is quite distal to the catalytic domain (17).

In this study we have described the kinetics of interactions of six -lactam antibiotics with the PBP2a of S. aureus. We also documented dramatic conformational changes for the protein in the presence of these antibiotics within the time scale for these turnover events. The function of PBP2a would appear to be more complex than previously appreciated. In light of the clinical importance of this protein to resistance to -lactam antibiotics, a more complete understanding of these processes at the structural level is required. It is with such fuller understanding of these events that we may be able to conceive of strategies for inhibition of this deleterious bacterial enzyme in the near future.

	FOOTNOTES

 
^* This work was supported by National Institutes of Health Grant GM61629. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

To whom correspondence should be addressed. Tel.: 574-631-2933; Fax: 574-631-6652; E-mail: mobashery{at}nd.edu.

¹ The abbreviations used are: MRSA, methicillin-resistant Staphylococcus aureus; PBP, penicillin-binding protein.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS AND DISCUSSION REFERENCES

 

1. Pinho, M. G., de Lencastre, H., and Tomasz, A. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 10886-10891[Abstract/Free Full Text]
2. Enright, M. C., Robinson, D. A., Randle, G., Feil, E. J., Grundmann, H., and Spratt, B. G. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, 7687-7692[Abstract/Free Full Text]
3. Georgopapadakou, N. H., Dix, B. A., and Mauriz, Y. R. (1996) Antimicrob. Agents Chemother. 29, 333-336
4. Bush, K., and Mobashery, S. (1998) Adv. Exp. Med. Biol. 456, 71-98[Medline] [Order article via Infotrieve]
5. Goffin, C., and Ghuysen, J. M. (2002) Microbiol. Mol. Biol. Rev. 66, 702-738[Abstract/Free Full Text]
6. Entenza, J. M., Hohl, P., Heinze-Krauss, I., Glausner, M. P., and Moreillon, P.,(2002) Antimicrob. Agents Chemother. 46, 171-177[Abstract/Free Full Text]
7. Malouin, F., Blais, J., Chamberland, S., Hoang, M., Park, C., Chan, C., Mathias, K, Hakem, S., Dupree, K., Liu, E., Nguyen, T., and Dudley, M. N. (2003) Antimicrob. Agents Chemother. 47, 658-664[Abstract/Free Full Text]
8. Ishikawa, T., Matsunaga, N., Tawada, H., Kuroda, N., Nakayama, Y., Ishibashi, Y., Tomimoto, M., Ikeda, Y., Tagawa, Y., Iizawa, Y., Okonogi, K., Hashiguchi, S., and Miyake, A. (2003) Bioorg. Med. Chem. 11, 2427-2437[CrossRef][Medline] [Order article via Infotrieve]
9. Drew, R. H., Perfect, J. R., Srinath, L., Kurkimilis, E., Dowzicky, M., and Talbot, G. H. (2000) J. Antimicrob. Chemother. 46, 775-784[Abstract/Free Full Text]
10. Richter, S. S., Kealey, D. E., Murray, C. T., Heilmann, K. P., Coffman, S. L., and Doern, G. V. (2003) J. Antimicrob. Chemother. 52, 123-127[Abstract/Free Full Text]
11. Dailey, C. F., Dileto-Fang, C. L., Buchanan, L. V., Oramas-Shirey, M. P., Batts, D. H., Ford, C. W., and Gibson, J. K. (2001) Antimicrob. Agents Chemother. 45, 2304-2308[Abstract/Free Full Text]
12. Tsiodras, S., Gold, H. S., Sakoulas, G., Eliopoulos, G. M., Wennersten, C., Venkataraman, L., Moellering, R. C., and Ferraro, M. J. (2001) Lancet 358, 207-208[CrossRef][Medline] [Order article via Infotrieve]
13. Bartley, J. (2002) Infect. Control Hosp. Epidemiol. 23, 480[Medline] [Order article via Infotrieve]
14. Walsh, T. R., Bolmstrom, A., Qwarnstrom, A., Ho, P., Wootton, M., Howe, R. A., MacGowan, A. P., and Diekema, D. (2001) J. Clin. Microbiol. 39, 2439-2444[Abstract/Free Full Text]
15. Centers for Disease Control and Prevention (2002) Morb. Mortal. Wkly. Rep. 51, 931[Medline] [Order article via Infotrieve]
16. Centers for Disease Control and Prevention (2004) Morb. Mortal. Wkly. Rep. 53, 322-323[Medline] [Order article via Infotrieve]
17. Lim, D., and Strynadka, N. C. (2002) Nat. Struct. Biol. 9, 870-876[Medline] [Order article via Infotrieve]
18. Graves-Woodward, K., and Pratt, R. F. (1998) Biochem. J. 332, 755-761
19. Zhao, G., Meier, T. I., Kahn, S. D., Gee, K. R., and Blaszczak, L. C. (1999) Antimicrob. Agents Chemother. 43, 1124-1128[Abstract/Free Full Text]
20. Roychoudhury, S., Dotzlaf, J. E., Ghag, S., and Yeh, W. (1994) J. Biol. Chem. 269, 12067-12073[Abstract/Free Full Text]
21. Sun, Y., Bauer, M. D., and Lu, W. (1998) J. Mass Spectrom. 33, 1009-1016[CrossRef][Medline] [Order article via Infotrieve]
22. Pinho, M.G., Ludovice, A. M., Wu, S., and De Lencastre, H. (1997) Microb. Drug Resist. 3, 409-413[Medline] [Order article via Infotrieve]
23. Hackbarth, C. J., Miick, C., and Chambers, H. F. (1994) Antimicrob. Agents Chemother. 38, 2568-2571[Abstract/Free Full Text]
24. Katayama, Y., Zhang, H. Z., Hong, D., and Chambers, H. F. (2003) J. Bacteriol. 185, 5465-5472[Abstract/Free Full Text]
25. Katayama, Y., Zhang, H. Z., and Chambers, H. F. (2004) Antimicrob. Agents Chemother. 48, 453-459[Abstract/Free Full Text]
26. Lu, W. P., Kincaid, E., Sun, Y., and Bauer, M. D. (2001) J. Biol. Chem. 276, 31494-31501[Abstract/Free Full Text]
27. Jamin, M., Hakenbeck, R., and Frere, J. M. (1993) FEBS Lett. 331, 101-104[CrossRef][Medline] [Order article via Infotrieve]
28. Crisostomo, M. I., Westh, H., Tomasz, A., Chung, M., Oliveira, D. C., and de Lencastre, H., (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 9865-9870[Abstract/Free Full Text]
29. Lu, W. P., Sun, Y., Bauer, M. D., Paule, S., Koenigs, P. M., and Kraft, W. G. (1999) Biochemistry 38, 6537-6546[CrossRef][Medline] [Order article via Infotrieve]
30. Wu, C. Y., Alborn, W. E., Flokowitsch, J. E., Hoskins, J., Unal, S., Blaszczak, L. C., Preston, D. A., and Skatrud, P. L. (1994) J. Bacteriol. 176, 443-449[Abstract/Free Full Text]
31. Golemi, D., Maveyraud, L., Vakulenko, S., Samama, J. P., and Mobashery, S. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 14280-14285[Abstract/Free Full Text]
32. Golemi-Kotra, D., Cha, J. Y., Meroueh, S. O., Vakulenko, S. B., and Mobashery, S. (2003) J. Biol. Chem. 278, 18419-18425[Abstract/Free Full Text]
33. Lee, W., McDonough, M. A., Kotra, L., Li, Z. H., Silvaggi, N. R., Takeda, Y., Kelly, J. A., and Mobashery, S. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 1427-1431[Abstract/Free Full Text]

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				M. Chung, A. Antignac, C. Kim, and A. Tomasz Comparative Study of the Susceptibilities of Major Epidemic Clones of Methicillin-Resistant Staphylococcus aureus to Oxacillin and to the New Broad-Spectrum Cephalosporin Ceftobiprole Antimicrob. Agents Chemother., August 1, 2008; 52(8): 2709 - 2717. [Abstract] [Full Text] [PDF]

				L. R. R. Perez, C. Dias, and P. A. d'Azevedo Agar dilution and agar screen with cefoxitin and oxacillin: what is known and what is unknown in detection of meticillin-resistant Staphylococcus aureus J. Med. Microbiol., August 1, 2008; 57(8): 954 - 956. [Abstract] [Full Text] [PDF]

				S. Lemaire, C. Fuda, F. Van Bambeke, P. M. Tulkens, and S. Mobashery Restoration of Susceptibility of Methicillin-resistant Staphylococcus aureus to {beta}-Lactam Antibiotics by Acidic pH: ROLE OF PENICILLIN-BINDING PROTEIN PBP 2a J. Biol. Chem., May 9, 2008; 283(19): 12769 - 12776. [Abstract] [Full Text] [PDF]

				X. Fan, Y. Liu, D. Smith, L. Konermann, K. W. M. Siu, and D. Golemi-Kotra Diversity of Penicillin-binding Proteins: RESISTANCE FACTOR FmtA OF STAPHYLOCOCCUS AUREUS J. Biol. Chem., November 30, 2007; 282(48): 35143 - 35152. [Abstract] [Full Text] [PDF]

				D.-H. Kwon and C.-D. Lu Polyamine Effects on Antibiotic Susceptibility in Bacteria Antimicrob. Agents Chemother., June 1, 2007; 51(6): 2070 - 2077. [Abstract] [Full Text] [PDF]

				S. Lemaire, F. Van Bambeke, M.-P. Mingeot-Leclercq, Y. Glupczynski, and P. M. Tulkens Role of Acidic pH in the Susceptibility of Intraphagocytic Methicillin-Resistant Staphylococcus aureus Strains to Meropenem and Cloxacillin Antimicrob. Agents Chemother., May 1, 2007; 51(5): 1627 - 1632. [Abstract] [Full Text] [PDF]

				C. Fuda, D. Hesek, M. Lee, W. Heilmayer, R. Novak, S. B. Vakulenko, and S. Mobashery Mechanistic Basis for the Action of New Cephalosporin Antibiotics Effective against Methicillin- and Vancomycin-resistant Staphylococcus aureus J. Biol. Chem., April 14, 2006; 281(15): 10035 - 10041. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 279/39/40802    most recent M403589200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Fuda, C. Articles by Mobashery, S. Search for Related Content PubMed PubMed Citation Articles by Fuda, C. Articles by Mobashery, S. Social Bookmarking                      What's this?