HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 279, Issue 40, 42147-42156, October 1, 2004

This Article Abstract Full Text (PDF) All Versions of this Article: 279/40/42147    most recent M405579200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Larsen, M. B. Articles by Wiborg, O. Search for Related Content PubMed PubMed Citation Articles by Larsen, M. B. Articles by Wiborg, O. Social Bookmarking                      What's this?

The Chicken Serotonin Transporter Discriminates between Serotonin-selective Reuptake Inhibitors

A SPECIES-SCANNING MUTAGENESIS STUDY^*

Mads Breum Larsen, Betina Elfving, and Ove Wiborg

From the Laboratory of Molecular Neurobiology, Department of Biological Psychiatry, Aarhus Psychiatric University Hospital, Skovagervej 2, Risskov 8240, Denmark

Received for publication, May 19, 2004 , and in revised form, July 22, 2004.

	ABSTRACT

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
The serotonin transporter (SERT) belongs to a family of sodium chloride-dependent transporters responsible for uptake of amino acids and biogenic amines from extracellular spaces. SERT represents the main pharmacological target in the treatment of several clinical conditions, including depression and anxiety. Serotonin-selective reuptake inhibitors and tricyclic antidepressants are the most predominantly prescribed drugs in the treatment of depression. In addition to antidepressants also psychostimulants, like cocaine and amphetamines, are important SERT antagonists. In the present study, we report the cloning and characterization of chicken SERT. Although the uptake kinetic was very similar to human SERT, the pharmacological profiles differed considerably for the two species. We find that chicken SERT is capable of discriminating between different serotonin-selective reuptake inhibitors; thus, the potency of S-citalopram and paroxetine is reduced more than 40-fold. A cross-species chimera strategy was undertaken and followed by species-scanning mutagenesis. Differences in pharmacological profiles were tracked to amino acid residues 169, 172, and 586 in human SERT. Structure-activity studies on structurally related compounds indicated that species divergences in drug sensitivity between human and chicken SERT were arising from differences in coordination or recognition of an important aminomethyl pharmacophoric substructure, which is shared by all high affinity antidepressants. Consequently, we suggest that Ala¹⁶⁹ and Ile¹⁷² of human SERT are important residues in sensing the N-methylation state of SERT antagonists.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Serotonergic neurotransmission is modulated by active reuptake of serotonin (5-hydroxytryptamine or 5-HT)¹ from the extracellular space. Reuptake is mediated by the serotonin transporter (SERT), and 5-HT is subsequently either degraded by monoamine oxidases or repackaged into vesicles by the proton-dependent vesicular monoamine transporter. A balance between release and active reuptake of 5-HT determines the magnitude and duration of signaling and thus plays a key role in the spatio-temporal fine tuning of serotonergic neurotransmission.

Malfunction in active 5-HT reuptake is speculated to be associated with psychiatric disorders, particularly anxiety and depression (1, 2). Antidepressants inhibiting 5-HT reuptake are used also in treatment of anxiety disorders, obsessive-compulsive disorders, and eating disorders (3, 4).

SERT is a member of a large family of homologous integral membrane proteins (5). SERT is of considerable interest as a molecular target for many antidepressants, including the tricyclic antidepressants such as imipramine and amitriptyline, as well as the serotonin-selective reuptake inhibitors (SSRIs) like citalopram, fluoxetine, paroxetine, sertraline, and fluvoxamine. SERT is also target for drugs of abuse including cocaine and amphetamines such as 3,4-methylenedioxymethamphetamine (MDMA or "ecstasy") (6, 7).

SERT is a putative 12-transmembrane (TM) domain protein that co-transports one 5-HT molecule inwardly, in a protonated form, together with one Na⁺ ion and one Cl^- ion. An internal K⁺ ion is bound and countertransported, after dissociation of 5-HT, Na⁺, and Cl^-, as SERT returns to its initial state (8). Although the stoichiometry of 5-HT transport predicts an electroneutral process, electrophysiological studies have revealed a net inward current, which probably arises from an uncoupled excess inward flux of Na⁺ ions (9, 10).

The three-dimensional structure of SERT is unknown; however, in the quaternary structure SERT was reported to form homo-oligomeric complexes. This was supported by fluorescence resonance energy transfer interactions, chemical cross-linking, and co-immunoprecipitation of epitope-tagged SERT (11-13).

Although the cloning of SERT cDNAs from several different species and their expression in heterologous systems has intensified characterization of recombinant SERT, the molecular mechanisms underlying transport and how it is inhibited are still not well understood (14-26). Interspecies differences in pharmacological profiles, combined with construction of cross-species chimeras and site-directed mutagenesis, have been used as a rational strategy to localize domains and residues critical for ligand interaction. Studies using this strategy identified Phe⁵⁸⁶ in TM12 to be important in high affinity recognition of tricyclic antidepressants (27, 28), and in a similar study an important determinant of species-selective recognition of mazindol and citalopram was tracked to Tyr⁹⁵ in TM1 (29). In one of our own species-scanning mutagenesis studies, we identified Met¹⁸⁰ in TM3 and Tyr⁴⁹⁵ and Phe⁵¹³, both in TM10, as important molecular determinants of antidepressant interactions (30).

Site-directed mutagenesis studies have indicated that the conserved aspartate in TM1 of the monoamine transporters, Asp⁹⁸ in human SERT (hSERT), and the conserved serine in TM11, Ser⁵⁴⁵ in hSERT, are both essential to transport activity, antagonist potency, and ion dependence (31, 32). The important role of TM1 was supported by the suggestion of G100 as a structural pivot providing flexibility during substrate translocation (33). In TM7, several residues are important for uptake and Na⁺ dependence, indicating that TM7 is involved in binding pocket formation or substrate translocation (34). A cysteine scanning of residues in TM3 indicated that Ile¹⁷² and Tyr¹⁷⁶ are associated with a 5-HT and cocaine binding pocket (35).

A detailed mapping of residues defining the binding sites is, however, still incomplete, and details on transport dynamics and conformational changes during uptake are essentially unknown.

In the present study, we report the cloning of chicken SERT (gSERT). Although the amino acid sequence is highly conserved, the pharmacological characterization of a number of selected compounds revealed a profile very different from hSERT. Consequently, a species-scanning mutagenesis strategy was undertaken in order to identify residues that are important for differential binding of SSRIs.

	MATERIALS AND METHODS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Dulbecco's modified Eagle's medium, fetal bovine serum, trypsin, and penicillin/streptomycin were purchased from Invitrogen. Cell culture flasks and 96-well plates were from NUNC. White 96-well culture plates and MicroScint-20 scintillation mixture were from Packard. [³H]5-HT (21.7 Ci/mmol) and [¹²⁵I]RTI-55 (2200 Ci/mmol) were from PerkinElmer Life Sciences. [³H]S-citalopram (85 Ci/mmol) was a gift from H. Lundbeck A/S (Valby, Denmark). The QuikChange mutagenesis kit was from Stratagene. Restriction enzymes were purchased from New England Biolabs. The Rapid DNA ligation kit and Fugene-6 transfection reagent were from Roche Molecular Biochemicals. The Wizard PureFection plasmid DNA purification system was from Promega, and the ABI Prism BigDye terminator cycle sequencing ready reaction kit was from PerkinElmer Life Sciences. RTI-55 and short imipramine were a gift from Dr. Mikael Bols (Aarhus University, Denmark). S- and R-citalopram, S-didemethylcitalopram, and Lu 33-086-O, Lu 08-052-O were a gift from H. Lundbeck A/S. DASB was a gift from Dr. S. Houle (Vivian M. Rakoff PET Centre, Toronto, Canada). IDAM was a gift from the University of Pennsylvania Medical Centre (Philadelphia, PA).

Cloning of gSERT cDNA—Total RNA was isolated from chicken brain tissue using the acid guanidinium thiocyanate method by Chomczynski and Sacchi (36). Single-stranded cDNA was synthesized from 5 µg of total RNA using Superscript II reverse transcriptase (Invitrogen) and the gSERT gene-specific primer KR5 (CGTTGAATTGCTTGGATAG) at 42 °C for 50 min. Complementary RNA was removed with RNase H.

Full-length cDNA was cloned by PCR using primers KF1 with an integrated XhoI restriction site (CCGCTCGAGGGCAGGAGAAACCTTGGAA) and KR3 with an integrated XbaI restriction site (CTAGTCTAGACCAAATGTCCGTTGTCAGTG) located in the 5'- and 3'-untranslated region, respectively. The proofreading polymerase PFU Turbo (Stratagene) was used with the following touchdown PCR parameters: 30 s at 94 °C, 30 s at 61 °C, 150 s at 72 °C for 25 cycles where the annealing temperature was decreased 0.4 °C for every cycle followed by 35 cycles of 30 s at 94 °C, 30 s at 51 °C, and 150 s at 72 °C. The resulting fragment was 2200 bp, which was the expected size based on the information from the chicken expressed sequence tags and the hSERT. The fragment was digested with XhoI and XbaI and inserted into the eucaryotic expression vector pcDNA 3 (Invitrogen) cleaved with the same enzymes. The PCR amplification was repeated in an independent experiment, and a total of eight clones were sequenced in their entirety to identify possible PCR-generated artifacts. Sequencing was performed using BigDye Terminator version 3.1 and an automated ABI 3100 Genetic Analyzer (Applied Biosystems).

The final clone contained 21 bp of 5'-untranslated region, the entire coding sequence, and 128 bp of 3'-untranslated region.

Construction of SERT Chimeras and Mutants—A PCR-based approach was chosen to generate rationally designed cross-species chimeras between hSERT and gSERT based on the method by Kirsch and Joly (37). The coding region of hSERT was previously cloned from human placenta and inserted into the pcDNA3 vector, denoted hSERT (33). Briefly, a region of the hSERT was amplified by PCR using primers complementary to hSERT in the 3'-end and complementary to gSERT in the 5'-end. The resulting fragment was gel-purified and subsequently used as a pair of complementary megaprimers following the QuikChange protocol (Stratagene). All chimeras were sequenced in their entirety to verify sequence switching points and exclude PCR-generated errors. Primer sequences for the generation of megaprimers are as follows (5' to 3' direction): 1F, GATGGAGCTGGGAGACCGGGAGACCTGGGGCAAGAAG; 1R, CATATTTTTCTCCAAATTGAAATGCATCCATTTCGGTGG; 2F, CAGGAATGGGTGTATTTCAATATGGAGGAAAATCTGCCCG; 2R, CCACCTTGCCAGATGTCTTGACGCCTTTCCAGATGC; 3F, CTGGAAAGGGGTCAAAACCTCTGGCAAGGTGGTGTG; 3R, CTTGGTAGCAGTTGTTATTGAACTTGTTGTAGCTAGC; 4F, CAGCTACAACAAATTCCACAACAACTGCTACCAAGATGC; 4R, GGAATTCATCCAGTACTCCCGTGATCACCCCCTCCAAG; 5F, GATTAGAGGGAGTGATTACTGCTGTGCTGGATGAGTTCCC; 5R, GTACCAGCCTGGAGCGAAGCCGAGCATTTCCTTCAC; 6F, GAAAGAAATGCTGGGCTTCAGCCCGGGGTGGTTCTGG; 6R, GAATACGCTCCTTAAGTGTCCCTGGAGTGATGATCAAC; 13R, CGTGAAGGAGGACACGAGGTAGTATAGCGCCCAGGCC; 14F, GCGTGGGTCTTCTACTACCTCATCTCCTCCTTCACGG; 14R, GCCAGCTAATGCCCCCCAGGTCCTGGAGCCCC; 15F, GGGCTGGATGACCTGGGGGGCATCAGCTGGC; 16R, GGGATAGTTGTAATCAAAAAGTCGTAGTTGTGGCGGGCTC; 17F, CCCCCCCGAGCTCCGGCTTTTCCAATATAATTATCCTTAC. Primer combinations used to generate the megaprimers for cross-species chimera constructions are shown in Table I.

Cell Culture and Expression of SERTs in COS-1 Cells—COS-1 cells were maintained in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum, 100 µg/ml streptomycin, and 100 units/ml penicillin at 37 °C and 5% CO₂ in a humidified atmosphere.

For transfections, 0.2 µg of plasmid and 0.4 µl of Fugene6 (Roche Molecular Biochemicals) was used per cm² of plating area. Appropriate amounts of plasmid and Fugene6 were mixed with Dulbecco's modified Eagle's medium according to the manufacturer's recommendations. COS-1 cells were trypsinized and suspended in growth media, and the plasmid/Fugene6 mixture was added followed by dispension into growth plates at 70-80% confluence. White 96-well plates (Corning) were used for uptake experiments.

5-HT Uptake Assays—Uptake assays were performed 40-64 h after transfection. The medium was removed, and the cells were washed with phosphate-buffered saline (137 mM NaCl, 2.7 mM KCl, 4.3 mM Na₂HPO₄, 1.4 mM KH₂PO₄, pH 7.4) containing 0.1 mM CaCl₂ and 1 mM MgCl₂ (PBSCM). Following washing, cells were incubated at room temperature for 10 min in PBSCM containing 12 (in duplicate) or eight (in triplicate) increasing concentrations of [³H]5-HT diluted 30 times with unlabeled 5-HT for K_m and V_max determinations. Washing with PBSCM terminated the uptake. For IC₅₀ determinations, following the initial washing step, cells were incubated for 30 min with 12 increasing concentrations of drug (in duplicate) to reach equilibrium. Substrates were not preincubated with the cells. Uptake was then initiated by the addition of a solution of [³H]5-HT containing the appropriate drug to give a final [³H]5-HT concentration of 100 nM. The uptake was allowed to continue for 10 min at room temperature and terminated by washing with PBSCM. All washing steps were carried out using an automated plate washer. Following uptake, cells were solubilized in scintillant (MicroScint-20; PerkinElmer Life Sciences), and plates were counted in a Packard TopCounter NXT microplate scintillation counter. Specific uptake was determined as the difference between uptake counts from cells transfected with SERT-containing constructs and mock-transfected cells. Assuming Michaelis-Menten kinetics, the data were plotted and analyzed by nonlinear least-squares curve fit (GraphPad Prism). IC₅₀ values were calculated by nonlinear regression analysis of inhibition of normalized 5-HT uptake versus logarithmic drug concentration (GraphPad Prism). K_i values were calculated from the IC₅₀ values using the Cheng and Prusoff equation (38) to adjust for substrate concentration. 95% confidence intervals for K_i values were calculated (Graphpad Prism). K_i values were compared using an unpaired t test (Graphpad Prism).

RTI-55 Binding Assays—COS-1 cells were transfected as described. Cells were grown for 64 h, and prior to harvesting, dishes were rinsed in PBS. Cells were harvested with a cell scraper in buffer 1 (50 mM Tris-base, 150 mM NaCl, 20 mM EDTA, pH 7.4). After centrifugation, cells were suspended and homogenized with an Ultra-turrax homogenizer for 20 s in buffer 1. Membranes were pelleted by ultracentrifugation, and homogenization was repeated. Finally, after ultracentrifugation, membranes were suspended in buffer 3 (50 mM Tris-base, 120 mM NaCl, 5 mM KCl, pH 7.4) and stored at -80 °C. Membrane protein concentration was determined by the BCA protein assay reagent kit (Pierce). For IC₅₀ determinations, 2 µg of membrane in buffer 3 was added to each well in a 96-well plate and combined with buffer 3 containing increasing concentrations of the desired drug and a final concentration of 200 pM [¹²⁵I]RTI-55 (-carbomethoxy-3-(4-iodophenyl)tropane) as radioligand. Membranes were incubated for 60 min at room temperature and subsequently washed six times with water after transferring to a 96-well glass fiber filter plate GF/B (Unifilter; Packard Bell) preincubated with 50 µl of 0.5% polyethyleneimine, using a Packard Bell cell harvester. Filters were soaked with 40 µl of MicroScint 20 scintillation liquid (Packard Bell), and accumulated radioactivity per filter was determined by direct counting of plates using a Packard Bell microplate scintillation counter. IC₅₀ values were calculated as described for uptake inhibition. To calculate K_i values from IC₅₀ values using the Cheng and Prusoff equation, K_D values for [¹²⁵I]RTI-55 was measured using 2 µg of membrane in buffer 3 and 12 increasing concentrations of [¹²⁵I]RTI-55 followed by incubation and washing as described above.

	RESULTS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Cloning of a Chicken 5-HT Transporter—Initial 5-HT uptake inhibition experiments using synaptosomes prepared from chicken (Gallus gallus domesticus) brain indicated that the pharmacological properties of this transporter differed from the human counterpart. To study the molecular mechanisms underlying these differences in a cultured cell model, we cloned the gSERT. We used the hSERT cDNA sequence to search GenBank^TM for possible chicken sequences encoding SERT. This search revealed several homologous chicken expressed sequence tag fragments, some of which contained apparent 5'-and 3'-nontranslated regions. We used the nontranslated sequences to design sequence-specific primers for reverse transcription and PCR. Using RNA extracted from chicken brain tissue as a template, we cloned gSERT into the mammalian expression vector, pcDNA3. We sequenced eight independent full-length cDNA clones from which we constructed a consensus sequence (GenBank^TM accession number AY573844 [GenBank] ). The consensus sequence revealed an open reading frame of 2010 bp, which translates into a 670-amino acid protein. gSERT shows a high degree of similarity to the hSERT with an overall identity of 77% (Fig. 1). The main difference between the SERT from the two species is observed in the predicted intracellular N terminus of the protein, which is 40 amino acids longer for gSERT compared with hSERT. Hydropathy analysis with TMHMM (available on the World Wide Web at www.cbs.dtu.dk/services/TMHMM) predicts 12 transmembrane domains with intracellular N and C termini as described for other transporters of this family. Two potential N-glycosylation sites are present in the large second extracellular loop at Asn²⁴⁸ and Asn²⁵⁷, corresponding to the sites previously identified in rat SERT (rSERT) and human norepinephrine transporter (39, 40). Two cysteine residues, which form a potential disulfide bridge in the rSERT, are also conserved in gSERT (Cys²⁴⁰ and Cys²⁴⁹).

View larger version (49K): [in this window] [in a new window]   FIG. 1. Alignment of the translated amino acid sequence of gSERT and hSERT. Identical residues are shown on a black background. Conservative amino acid changes are shaded in gray.

5-HT Uptake and Pharmacology of gSERT Compared with hSERT—When transiently transfected in COS-1 cells, the cloned gSERT displayed robust and saturable 5-HT uptake, with an apparent affinity constant, K_m, of 846 ± 90 nM, which is comparable with values obtained for hSERT (Table II and Fig. 2). V_max values varied with transfection efficiencies, but in individual experiments, gSERT gave rise to slightly higher uptake than hSERT as demonstrated by the example in Fig. 2.

View larger version (12K): [in this window] [in a new window]   FIG. 2. 5-HT uptake in COS-1 cells, mediated by gSERT and hSERT. Transiently transfected COS-1 cells were incubated with increasing concentrations of [3H]5-HT for 10 min at 20 °C. Nonspecific 5-HT uptake was determined by parallel transfections with a pcDNA vector without insert.

We estimated the inhibitory potency of several SERT antagonists and substrates (Table III, Fig. 3); the five classical SSRIs paroxetine, S-citalopram, sertraline, fluoxetine, and fluvoxamine; the highly SERT-selective emissions tomography ligands DASB and IDAM; the tricyclic antidepressants imipramine and desipramine; the serotonin norepinephrine reuptake inhibitor venlafaxine; cocaine and the high affinity cocaine analog RTI-55; S-citalopram analogues R-citalopram, S-didemethylcitalopram, Lu 33-086-O, and Lu 08-052-O; an imipramine analog, short imipramine, with a shorter alkylamine chain; dopamine; and finally the substrates MDMA and 5-HT.

View larger version (28K): [in this window] [in a new window]   FIG. 3. Structures of drugs used for the pharmacological characterization of gSERT.

The five compounds with the highest potency at hSERT during 5-HT uptake inhibition studies were DASB, RTI-55, paroxetine, IDAM, and S-citalopram with mean K_i values of 2.4, 8.2, 9.7, 11, and 13 nM, respectively. In comparison, for gSERT the five highest ranking compounds were DASB, RTI-55, Lu 33-086-O, fluvoxamine, and Lu 08-052-O, with mean K_i values of 3.5, 10, 122, 132, and 163 nM, respectively.

In RTI-55 binding inhibition studies, the compounds with highest potency for hSERT were paroxetine, DASB, sertraline, RTI-55, and S-citalopram, with mean K_i values of 0.62, 0.89, 1.6, 2.1, and 7.1 nM, respectively, and for gSERT the highest ranking were DASB, RTI-55, sertraline, fluvoxamine, and venlafaxine, with mean K_i values of 1.0, 2.3, 4.6, 29, and 38 nM, respectively.

Noticeably, the inhibitory potency of paroxetine, S-citalopram, IDAM, and imipramine is more than 10-fold reduced for gSERT compared with hSERT in both inhibition of 5-HT uptake and inhibition of RTI-55 binding by comparing the respective K_i values (Table III). In particular, for S-citalopram and paroxetine the difference is evident, since the potency at gSERT is more than 40-fold reduced. The inhibitory potency of sertraline, fluoxetine, desipramine, and Lu 08-052-O is slightly reduced for gSERT. The inhibitory potency of fluvoxamine, DASB, venlafaxine, R-citalopram, S-didemethylcitalopram, Lu 33-086-O, and short imipramine is unchanged between gSERT and hSERT. Cocaine displays higher affinity for gSERT compared with hSERT. Dopamine and the two substrates MDMA and 5-HT show no difference between gSERT and hSERT, thus confirming the affinity measurements for 5-HT uptake.

Identification of TM3 and TM12 as Determinants for High Affinity S-Citalopram and Paroxetine Recognition Using Cross-species Chimeras—In order to identify regions of SERT that are essential for the observed differences in drug sensitivity, we designed a number of cross-species chimeras of gSERT and hSERT. We used a restriction site-independent method (37) to rationally generate a number of chimeras, in which successive parts of gSERT were exchanged with the corresponding parts of hSERT (Fig. 4). We initially constructed a set of 12 chimeras, labeled chimeras 1-12. K_m and V_max values for 5-HT uptake for all chimeras were within 2-fold of the parental gSERT and hSERT. Since we observed the largest differences in potencies for S-citalopram and paroxetine, we decided to initially focus on these two drugs. Consequently, we determined the S-citalopram and paroxetine potencies for the chimeras in 5-HT uptake inhibition studies performed in parallel with the wild type gSERT and hSERT, using transiently transfected COS-1 cells. The results of these experiments are shown in Fig. 5, A and B. We found that for paroxetine, chimeras 2, 7, 8, and 10 display near hSERT phenotype. These chimeras all share the TM3-TM4 region of hSERT, indicating that residues within this region are essential for the high affinity recognition of paroxetine. For S-citalopram, things were less clear, but the results from chimeras 6-8 suggest that there is an additive effect of the TM11-TM12 region and more proximal parts of the SERT molecule.

View larger version (22K): [in this window] [in a new window]   FIG. 4. A schematic representation of the gSERT/hSERT chimeras used in this study. Parts of gSERT were exchanged for the corresponding parts of hSERT. gSERT parts of the chimeras are shown in green, and hSERT parts are shown in red.

View larger version (17K): [in this window] [in a new window]   FIG. 5. S-Citalopram and paroxetine potencies at gSERT/hSERT chimeras. IC50 values for chimeras relative to hSERT WT were determined using 5-HT uptake assays in transfected COS-1 cells. Error bars, S.E.

In conclusion, our work with cross-species chimeras demonstrates that residues in the TM3 and TM12 regions are important for conferring high affinity recognition of S-citalopram and paroxetine.

The gSERT Triple Mutant D209A/V212/I626F Gains High Affinity for Antagonists—A total of six amino acid residues diverge between gSERT and hSERT in the target TM3 region exchanged in the chimera 13. Using site-specific mutagenesis, we substituted gSERT amino acids for the corresponding hSERT residues to identify the amino acids responsible for the observed gain in antagonist sensitivity in chimera 13. We thus created the following gSERT mutants: F203Y, D209A/V212I, D209A/L210F, L210F/V212I, V223A/F224L, and D209A/L210F/V212I. Only mutants containing either D209A or V212I displayed an increase in S-citalopram and paroxetine sensitivity compared with WT gSERT (Fig. 6, A and B). The effect of D209A and V212I appears additive and is not potentiated by mutating the neighboring Leu²¹⁰ residue. The paroxetine and the S-citalopram affinity for the double mutant D209A/V212I resembles that of chimera 13.

View larger version (22K): [in this window] [in a new window]   FIG. 6. Pharmacological characterization of gSERT mutations. Amino acid residues in gSERT were substituted with the corresponding hSERT residues to obtain gain in function. A, paroxetine inhibition of 5-HT uptake, comparing hSERT and gSERT WTs with chimera 13 and gSERT mutants. B, paroxetine inhibition of 5-HT uptake, comparing hSERT and gSERT WTs with chimera 13 and gSERT mutants. C, paroxetine inhibition of 5-HT uptake, comparing hSERT and gSERT WTs with chimera 17 and gSERT I626F. D, S-citalopram inhibition of 5-HT uptake, comparing hSERT and gSERT WTs with chimera 17 and gSERT I626F.

Based on these results, we considered whether a gSERT triple mutant D209A/V212I/I626F would completely recover high affinity for paroxetine and S-citalopram and whether the corresponding hSERT triple mutant, A169D/I172V/F586I, would lose high affinity. As displayed in Fig. 7 the gSERT D209A/V212I/I626F attains near hSERT affinity for paroxetine and S-citalopram, whereas the hSERT A169D/I172V/F586I shifts to gSERT affinity. The affinity for fluvoxamine and serotonin, however, does not change significantly, implying that the overall conformation is intact in the mutants.

View larger version (16K): [in this window] [in a new window]   FIG. 7. Pharmacological characterization of gSERT D209A/V212I/I626F and hSERT A169I/I172V/F586I triple mutants. Inhibition of 5-HT uptake, comparing gSERT D209A/V212I/I626F and hSERT A169I/I172V/F586I triple mutants with gSERT and hSERT WTs. 5-HT uptake was inhibited with S-citalopram (A), paroxetine (B), fluvoxamine (C), and unlabeled 5-HT (D).

	DISCUSSION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

When comparing K_i values obtained from 5-HT uptake inhibition and RTI-55 binding inhibition studies (Table III), we found that the absolute potency of many drugs differed between these two assays, although the relative potency, comparing gSERT and hSERT, was nearly identical. For antagonists, the potency for inhibiting RTI-55 binding was generally higher than the potency for inhibiting 5-HT uptake. Such differences have also been noted in other studies (42). The difference in absolute K_i values may be due to SERT being arrested in one particular conformation during RTI-55 binding, whereas SERT during the 5-HT uptake process may undergo a number of different conformations.

We used a cross-species chimera strategy to identify TM3 and TM12 as being involved in conferring high affinity paroxetine and S-citalopram binding. Site-directed mutagenesis revealed that mutating Asp²⁰⁹ and Val²¹² in the gSERT, corresponding to 169 and 172 in the hSERT, to their cognate hSERT identities partly restored paroxetine and S-citalopram potencies to that obtained at hSERT. Combining these mutants with the I626F mutation in TM12 yielded antagonist potencies comparable with hSERT for paroxetine and S-citalopram as well as other antagonists.

A common trend for desipramine and short imipramine is that the gSERT D209A/V212I/I626F mutant acquires higher affinity for these compounds than for either hSERT or gSERT WT. This suggests that gSERT contains residues that allow for more favorable recognition of tricyclics than does the hSERT. Mapping of these residues would generate more information on the architecture of the SERT antagonist binding pocket.

The TM3 region of the SERT has been proposed to line a translocation pore with residues 169, 172, 176, and 179 facing a 5-HT- and cocaine-binding pocket (35). These observations are in good agreement with the results we have presented in this report and highlight the importance of this region in substrate transport as well as antagonist recognition.

Looking at the discrimination of antagonists for gSERT compared with hSERT, it is tempting to compare antagonist structures and search for common features to explain the differences in potency observed for antagonists on gSERT and hSERT. Whereas it is beyond the scope of this report to perform an extensive structure modeling analysis, a previous pharmacophore modeling study of SSRIs has been reported (43). In this study, three fix points were used for superimposition of low energy conformations of citalopram, fluoxetine, paroxetine, and sertraline. Two points, each representing the centers of the two aromatic rings, and a point in the direction of the electronic lone pair 2.8 Å away from the basic nitrogen atom of the alkylamine tail of citalopram, fluoxetine, and sertraline and the piperidine nitrogen in paroxetine, respectively, were superimposed to generate a common pharmacophoric model. The site point was used to simulate an interaction with a hypothetical acidic residue, presumed to be the primary recognition site in the transporter molecule. Sertraline and fluoxetine lack one of the N-methyl groups. Consequently, they are less bulky in this part of the model.

Our data show that the potencies of S-citalopram and paroxetine are greatly reduced for gSERT. The potency of sertraline and fluoxetine, on the other hand, are only slightly reduced compared with hSERT. No species difference in potency was observed for S-citalopram analogues S-didesmethylcitalopram and Lu 33-086-O, which lacks both N-methyl groups or has a shorter tail length, respectively (i.e. absence of one or both N-methyl groups or dislocation of the amino-dimethyl substructure reduces drug potency for hSERT but not for gSERT).

In structural terms, the majority of the activity data shown in Table III suggests that removing N-methyl groups reduces species divergences in drug potency. One exception is DASB, which has a similar affinity for the two species although possessing two N-methyl groups. Whereas DASB is structurally very similar to IDAM, their degrees of species selectivity differ. This is likely to be caused by their obvious divergences, which appear to overrule the effect of the N-methyl groups in conferring species selectivity.

According to our data, we suggest a model where the Ala¹⁶⁹ and Ile¹⁷² in hSERT participate in the coordination of the common amino-methyl pharmacophoric substructure of S-citalopram and its counterpart in paroxetine, whereas only Ile¹⁷² appears to be important for the recognition of sertraline and fluoxetine, which is in agreement with the fact that these two drugs only possess a single distal N-methyl group at the tail.

Also in agreement with the suggested model is that IDAM and imipramine, which both possess the dimethylamino group, both display diverging potency for hSERT and gSERT. On the other hand, we observed no species difference in sensitivity toward the low affinity compound R-citalopram, indicating that the alkylamine tail is coordinated much differently compared with S-citalopram. It is likely that the lower binding affinity of R-citalopram is caused by steric hindrance at the binding site preventing a favorable coordination of the tail.

In a previous study by Barker et al. (32), Asp⁹⁸ in TM1 was suggested to interact with the alkylamine tail by formation of an ion pair to the protonated alkylamine nitrogen in 5-HT congeners. Our data indicate that two residues in TM3, Ala¹⁶⁹ and Ile¹⁷² in hSERT, are important in sensing the N-methylation state of SERT inhibitors, and consequently our study suggests that these residues and Asp⁹⁸ from TM1, although distant in the primary sequence, are in close proximity in the tertiary structure. A recent model building of SERT based on the electron density projection map of the bacterial Na⁺/H⁺ (NhaA) antiporter and mutagenesis studies on SERT as well as the docking of S-citalopram using Asp⁹⁸ as anchoring point also reveal potential interaction of Ala¹⁶⁹ and Ile¹⁷² with N-methyl groups and thus support our identification of Ala¹⁶⁹ and Ile¹⁷² as important residues in antagonist binding and also support our suggestion of spatial constraints for these residues, which are located on nonadjacent TM domains (44).

	FOOTNOTES

 
^* This work was supported by the Lundbeck Foundation. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

To whom correspondence should be addressed. Tel.: 45-77893611; Fax: 45-77893549; E-mail: owiborg{at}post.tele.dk.

¹ The abbreviations used are: 5-HT, serotonin (5-hydroxytryptamine); SERT, serotonin transporter; hSERT, human SERT; gSERT, chicken SERT; TM, transmembrane; SSRI, serotonin-selective reuptake inhibitors; MDMA, 3,4-methylenedioxymethamphetamine; DASB, 3-amino-4-(2-dimethylaminomethyl-phenylsulfanyl)-benzonitrile; IDAM, [2-(2-dimethylaminomethyl-phenylsulfanyl)-5-iodo-phenyl]-methanol; WT, wild type.

	ACKNOWLEDGMENTS

 
We thank Dr. Klaus P Bøgesø and Dr. Klaus Gundertofte for critical comments on the manuscript.

	REFERENCES

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 

1. Fuller, R. W., and Wong, D. T. (1990) Ann. N. Y. Acad. Sci. 600, 68-80[Medline] [Order article via Infotrieve]
2. Owens, M. J., and Nemeroff, C. B. (1994) Clin. Chem. 40, 288-295[Abstract/Free Full Text]
3. Gorman, J. M., Korotzer, A., and Su, G. (2002) MedWorks Reprint Ser. 7, Suppl. 1, 40-44
4. Feighner, J. P. (1999) J. Clin. Psychiatry 60, Suppl. 22, 18-22
5. Nelson, N. (1998) J. Neurochem. 71, 1785-1803[Medline] [Order article via Infotrieve]
6. Tatsumi, M., Groshan, K., Blakely, R. D., and Richelson, E. (1997) Eur. J. Pharmacol. 340, 249-258[CrossRef][Medline] [Order article via Infotrieve]
7. White, F. J. (1998) Nature 393, 118-119[CrossRef][Medline] [Order article via Infotrieve]
8. Rudnick, G., and Clark, J. (1993) Biochim. Biophys. Acta 1144, 249-263[Medline] [Order article via Infotrieve]
9. Mager, S., Min, C., Henry, D. J., Chavkin, C., Hoffman, B. J., Davidson, N., and Lester, H. A. (1994) Neuron 12, 845-859[CrossRef][Medline] [Order article via Infotrieve]
10. Galli, A., Petersen, C. I., deBlaquiere, M., Blakely, R. D., and DeFelice, L. J. (1997) J. Neurosci. 17, 3401-3411[Abstract/Free Full Text]
11. Schmid, J. A., Just, H., and Sitte, H. H. (2001) Biochem. Soc. Trans. 29, 732-736[CrossRef][Medline] [Order article via Infotrieve]
12. Jess, U., Betz, H., and Schloss, P. (1996) FEBS Lett. 394, 44-46[CrossRef][Medline] [Order article via Infotrieve]
13. Kilic, F., and Rudnick, G. (2000) Proc. Natl. Acad. Sci. U. S. A. 97, 3106-3111[Abstract/Free Full Text]
14. Chen, J. X., Pan, H., Rothman, T. P., Wade, P. R., and Gershon, M. D. (1998) Am. J. Physiol. 275, G433-G448
15. Padbury, J. F., Tseng, Y. T., McGonnigal, B., Penado, K., Stephan, M., and Rudnick, G. (1997) Brain Res. Mol. Brain Res. 45, 163-168[Medline] [Order article via Infotrieve]
16. Lesch, K. P., Wolozin, B. L., Murphy, D. L., and Reiderer, P. (1993) J. Neurochem. 60, 2319-2322[Medline] [Order article via Infotrieve]
17. Sandhu, S. K., Ross, L. S., and Gill, S. S. (2002) Eur. J. Biochem. 269, 3934-3944[Medline] [Order article via Infotrieve]
18. Miller, G. M., Yatin, S. M., De La, G. R., Goulet, M., and Madras, B. K. (2001) Brain Res. Mol. Brain Res. 87, 124-143[Medline] [Order article via Infotrieve]
19. Corey, J. L., Quick, M. W., Davidson, N., Lester, H. A., and Guastella, J. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 1188-1192[Abstract/Free Full Text]
20. Ramamoorthy, S., Bauman, A. L., Moore, K. R., Han, H., Yang-Feng, T., Chang, A. S., Ganapathy, V., and Blakely, R. D. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 2542-2546[Abstract/Free Full Text]
21. Hoffman, B. J. (1994) Pharmacopsychiatry 27, 16-22[Medline] [Order article via Infotrieve]
22. Blakely, R. D., Berson, H. E., Fremeau, R. T., Jr., Caron, M. G., Peek, M. M., Prince, H. K., and Bradley, C. C. (1991) Nature 354, 66-70[CrossRef][Medline] [Order article via Infotrieve]
23. Ranganathan, R., Sawin, E. R., Trent, C., and Horvitz, H. R. (2001) J. Neurosci. 21, 5871-5884[Abstract/Free Full Text]
24. Mortensen, O. V., Kristensen, A. S., Rudnick, G., and Wiborg, O. (1999) Brain Res. Mol. Brain Res. 71, 120-126[Medline] [Order article via Infotrieve]
25. Chang, A. S., Chang, S. M., Starnes, D. M., Schroeter, S., Bauman, A. L., and Blakely, R. D. (1996) Brain Res. Mol. Brain Res. 43, 185-192[Medline] [Order article via Infotrieve]
26. Demchyshyn, L. L., Pristupa, Z. B., Sugamori, K. S., Barker, E. L., Blakely, R. D., Wolfgang, W. J., Forte, M. A., and Niznik, H. B. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 5158-5162[Abstract/Free Full Text]
27. Barker, E. L., Kimmel, H. L., and Blakely, R. D. (1994) Mol. Pharmacol. 46, 799-807[Abstract]
28. Barker, E. L., and Blakely, R. D. (1996) Mol. Pharmacol. 50, 957-965[Abstract]
29. Barker, E. L., Perlman, M. A., Adkins, E. M., Houlihan, W. J., Pristupa, Z. B., Niznik, H. B., and Blakely, R. D. (1998) J. Biol. Chem. 273, 19459-19468[Abstract/Free Full Text]
30. Mortensen, O. V., Kristensen, A. S., and Wiborg, O. (2001) J. Neurochem. 79, 237-247[CrossRef][Medline] [Order article via Infotrieve]
31. Sur, C., Betz, H., and Schloss, P. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 7639-7644[Abstract/Free Full Text]
32. Barker, E. L., Moore, K. R., Rakhshan, F., and Blakely, R. D. (1999) J. Neurosci. 19, 4705-4717[Abstract/Free Full Text]
33. Kristensen, A. S., Larsen, M. B., Johnsen, L. B., and Wiborg, O. (2004) Eur. J. Neurosci. 19, 1-11[CrossRef][Medline] [Order article via Infotrieve]
34. Kamdar, G., Penado, K. M., Rudnick, G., and Stephan, M. M. (2001) J. Biol. Chem. 276, 4038-4045[Abstract/Free Full Text]
35. Chen, J. G., Sachpatzidis, A., and Rudnick, G. (1997) J. Biol. Chem. 272, 28321-28327[Abstract/Free Full Text]
36. Chomczynski, P., and Sacchi, N. (1987) Anal. Biochem. 162, 156-159[Medline] [Order article via Infotrieve]
37. Kirsch, R. D., and Joly, E. (1998) Nucleic Acids Res. 26, 1848-1850[Abstract/Free Full Text]
38. Cheng, Y. C., and Prusoff, W. H. (1973) Biochem. Pharmacol. 22, 3099-3108[CrossRef][Medline] [Order article via Infotrieve]
39. Tate, C. G., and Blakely, R. D. (1994) J. Biol. Chem. 269, 26303-26310[Abstract/Free Full Text]
40. Melikian, H. E., Ramamoorthy, S., Tate, C. G., and Blakely, R. D. (1996) Mol. Pharmacol. 50, 266-276[Abstract]
41. Ramamoorthy, S., and Blakely, R. D. (1999) Science 285, 763-766[Abstract/Free Full Text]
42. Owens, M. J., Knight, D. L., and Nemeroff, C. B. (2001) Biol. Psychiatry 50, 345-350[CrossRef][Medline] [Order article via Infotrieve]
43. Gundertofte, K., Bøgesø, K. P., and Liljefors, T. (1996) in Computer-assisted Lead Finding and Optimization: Current Tools for Medical Chemistry (van de Waterbeemd, H., Testa, B., and Folkers, G., eds) pp. 443-459, Verlag Helvetica Chimica Acta, Basel, Switzerland
44. Ravna, A. W., Sylte, I., and Dahl, S. G. (2003) J. Pharmacol. Exp. Ther. 307, 34-41[Abstract/Free Full Text]

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				J. Andersen, O. Taboureau, K. B. Hansen, L. Olsen, J. Egebjerg, K. Stromgaard, and A. S. Kristensen Location of the Antidepressant Binding Site in the Serotonin Transporter: IMPORTANCE OF SER-438 IN RECOGNITION OF CITALOPRAM AND TRICYCLIC ANTIDEPRESSANTS J. Biol. Chem., April 10, 2009; 284(15): 10276 - 10284. [Abstract] [Full Text] [PDF]

				S. Apparsundaram, D. J. Stockdale, R. A. Henningsen, M. E. Milla, and R. S. Martin Antidepressants Targeting the Serotonin Reuptake Transporter Act via a Competitive Mechanism J. Pharmacol. Exp. Ther., December 1, 2008; 327(3): 982 - 990. [Abstract] [Full Text] [PDF]

				H. A. Neubauer, C. G. Hansen, and O. Wiborg Dissection of an Allosteric Mechanism on the Serotonin Transporter: A Cross-Species Study Mol. Pharmacol., April 1, 2006; 69(4): 1242 - 1250. [Abstract] [Full Text] [PDF]

				L. K. Henry, J. R. Field, E. M. Adkins, M. L. Parnas, R. A. Vaughan, M.-F. Zou, A. H. Newman, and R. D. Blakely Tyr-95 and Ile-172 in Transmembrane Segments 1 and 3 of Human Serotonin Transporters Interact to Establish High Affinity Recognition of Antidepressants J. Biol. Chem., January 27, 2006; 281(4): 2012 - 2023. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 279/40/42147    most recent M405579200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Larsen, M. B. Articles by Wiborg, O. Search for Related Content PubMed PubMed Citation Articles by Larsen, M. B. Articles by Wiborg, O. Social Bookmarking                      What's this?