|
Advertisement | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
J. Biol. Chem., Vol. 279, Issue 41, 42363-42368, October 8, 2004
Mitochondrial tRNA Import in Toxoplasma gondii*![]() ![]() ![]() ¶
From the
Received for publication, April 23, 2004 , and in revised form, July 15, 2004.
Apicomplexan parasites have the smallest known mitochondrial genome. It consists of a repeated element of 67 kb in length and encodes three mitochondrial proteins, a number of rRNA fragments, but no tRNAs. It has therefore been postulated that in apicomplexans all tRNAs required for mitochondrial translation are imported from the cytosol. To provide direct evidence for this process we have established a cell fractionation procedure allowing the isolation of defined organellar RNA fractions from the apicomplexan Toxoplasma gondii. Analysis of T. gondii total and organellar RNA by Northern hybridization showed that except for the cytosol-specific initiator tRNAMet all nucleus-encoded tRNAs tested were present in the cytosol and in the mitochondrion but not in the plastid. Thus, these results provide the first experimental evidence for mitochondrial tRNA import in apicomplexans. The only other taxon that imports the whole set of mitochondrial tRNAs are the trypanosomatids. Interestingly, the initiator tRNAMet is the only cytosol-specific tRNA in trypanosomatids, indicating that the import specificity is identical in both groups. In agreement with this, the T. gondii initiator tRNAMet remained in the cytosol when expressed in Trypanosoma brucei. However, in contrast to trypanosomatids, no thio-modifications were detected in the tRNAGln of T. gondii indicating that, unlike what is suggested in Leishmania, they are not involved in regulating import.
Toxoplasma gondii is an obligate intracellular parasite of humans and animals. Whereas in immunocompetent individuals a T. gondii infection is generally asymptomatic, immunosuppressed patients are at risk of severe disease (1). T. gondii and Plasmodium falciparum, the causative agent of human malaria, belong to the apicomplexans and are evolutionarily closely related. Thus, in addition to being an important pathogen of its own, T. gondii serves as a model system for Plasmodium to study some experimentally less accessible aspects of apicomplexan biology (2). Interestingly, apicomplexans contain a non-photosynthetic plastid whose genome shares many features with chloroplast DNA (3). As expected for eukaryotes, apicomplexans also contain mitochondria. However, although much effort has been invested to investigate the plastid, there are only very few studies on apicomplexan mitochondria. This is surprising, because their biology is not only expected to be of medical relevance but, due to some unique features, is also of great interest for basic science. It has been proposed that the contribution of mitochondrial ATP synthesis to the total cellular pool is minimal (4). However, the presence of a mitochondrial membrane potential has been demonstrated in both intracellular T. gondii tachyzoites (5) and intraerythrocytic Plasmodium yoelii (4). Furthermore, it has been suggested that the anti-apicomplexan drug atovaquone acts by interfering with the electron transport chain of the parasites through inhibition of cytochrome b in the bc1 complex (4). This is supported by the detection of mutated cytochrome b genes in the mitochondrial DNA of atovaquone-resistant T. gondii cell lines (6). Thus, the mitochondrial electron transport must be essential for some apicomplexan life cycle stages that are found in the vertebrate host.
The most striking difference between mitochondrion of the apicomplexan and that of another of the species is its DNA. It consists of a tandemly repeated element of
The aim of the present work was to directly demonstrate tRNA import in the apicomplexan T. gondii and to determine its specificity. Furthermore, we wanted to compare the features of mitochondrial tRNA import in T. gondii to the one of trypanosomatids.
CellsTachyzoites of T. gondii (RH strain) were maintained in Vero cell monolayers at 37 °C and 5% CO2 in Roswell Park Memorial Institute medium containing 2 mM glutamine, 50 units/ml penicillin, 50 µg/ml streptomycin, and 210% immunoglobulin-free horse serum. Tachyozoites were harvested from their feeder cell cultures as previously described (16). The preparation containing tachyzoites and host cell debris was washed twice in cold phosphate-buffered saline and passed through a pre-equilibrated Sephadex G-25M column. The eluted purified parasites were centrifuged (3000 x g for 3 min at 4 °C), and the resulting pellets were used either directly, to isolate total RNA and for in vivo aminoacylations, or they were subjected to subcellular fractionation. Procyclic T. brucei cells, stock 427, were grown at 27 °C in SDM-79 medium supplemented with 5% fetal bovine serum. Cells were harvested at late log phase, corresponding to 2.5 x 107 to 3.5 x 107 cells/ml, and washed once in cold 20 mM sodium phosphate buffer (pH 7.9) containing 150 mM NaCl and 20 mM glucose. The resulting cellular pellets were used either to isolate total RNA or to prepare mitochondria.
Subcellular Fractionation of T. gondiiWashed T. gondii cells (2 x 108 cells corresponding to Subcellular Fractionation of T. bruceiDigitonin extraction (final concentration, 0.035%) was essentially performed as described previously (14). The obtained pellet was essentially free of cytosolic RNA and, because T. brucei does not have a plastid, corresponded to a crude mitochondrial fraction. RNA Isolation and Northern AnalysisRNA from total cells or digitonin-treated fractions of T. gondii or T. brucei was purified by using the acidic guanidinium isothiocyanate method as previously described (17). The samples containing the isolated RNAs were separated on 8 M urea-10% polyacrylamide gels. A formaldehyde-agarose gel was used for the Northern analysis of the cytochrome b mRNA. Blotting and hybridizations using 5'-end-labeled oligonucleotides were done as described (13). Affinity gel-electrophoresis for thio-modified residues (Fig. 5) was performed on 8 M urea-10% polyacrylamide gels containing 25 µM ((N-acryloylamino)phenyl)mercuric chloride (18).
Hybridization ProbesOligonucleotides recognizing the cytosolic 5.8 S rRNA (GAGCCAAGACATCCATTG) (19), the plastid tRNAMet (AACCTGCTCTACCCCGCT) (20), and the mitochondrial large subunit (LSU) rRNA fragment (GACAAGGATTTTCCTACCTT) of T. gondii (21) were designed using published sequence information. The probe to detect mitochondrial-encoded cytochrome b mRNA (6) was prepared by PCR amplification using CGAGAACACTCAGTCTATC and CAGATACGTAGAAACCTCC as primers. Oligonucleotides hybridizing to nucleus-encoded T. gondii tRNAs were designed using sequence information from the public T. gondii databases (preliminary genomic and/or cDNA sequence data were accessed via ToxoDB.org and/or www.tigr.org/tdb/t_gondii/). tRNA genes were identified by BLAST using tRNA genes from other organisms as templates. The following oligonucleotides were used: tRNAAla (TGGACGACATGGGTATCG), tRNAIle (TGGTCCCAACCGGGATCG), tRNASer (CGACGGCGGCAGGATTCG), tRNATrp (TGAGCCCAGAGCGACTCG), tRNAMet-e (CTGCGAGGATCGAACTCG), tRNAMet-i (CCCACTGAGCTACGGTGC), and tRNAGln (AGGTCCCACCGGGACTCG). To detect T. brucei tRNAs (Fig. 4) the following probes were used: GTGGTGGTCCTACCAGGAT for tRNAGln and TGAGGACTGCAGGGATTG for tRNATrp. The oligonucleotides hybridizing to the T. brucei tRNAMet-i and tRNAMet-e are described in Ref. 14.
In Vivo Aminoacylation AssayWashed T. gondii (5 x 107 cells) were resuspended in 300 µl of 1x SBG (20 mM glucose, 0.15 M NaCl, 20 mM NaPi, pH 7.9) containing 100 µg/ml cycloheximide and 2040 µCi of [35S]methionine/[35S]cysteine mixture (>1000 Ci/mmol). The labeled [35S]cysteine ( 25% of total) was competed out by the addition of 0.5 mM unlabeled cysteine. The reaction was incubated for 15 min at 37 °C. Intact cells were then centrifuged (3000 x g, for 3 min at 4 °C), and the RNA was isolated from the resulting pellet as described above. In Vitro Aminoacylation AssayThe assays were done in 100 µl of acylation buffer (50 mM Tris-HCl, pH 7.5), 25 mM KCl, 8 mM MgCl2, 10 mM dithiothreitol, 10% glycerol) containing 2040 µCi of a [35S]methionine/[35S]cysteine mixture, 0.5 mM unlabeled cysteine, 2 mM ATP, RNA isolated from 107 T. gondii tachyzoites or from the digitonin fractions (2 x 108 cell equivalents each), and 3060 µg of RNA-free cytosolic protein extract of either T. gondii or T. brucei, as sources of methionyl-tRNA synthetase activity (22). To be able to test externally added substrate tRNAs, it was essential to use protein extracts that were free of endogenous RNAs. Removal of endogenous RNA from the cytosolic fractions was achieved through binding to a DEAE-Sepharose column in the presence of 150 mM NaCl (23). Incubation was for 15 min at 37 °C, and RNAs were re-isolated as described above. The 35S-labeled tRNAsMet from both the in vivo and the in vitro assays were analyzed on 8 M urea/10% polyacrylamide gels and visualized by fluorography. To prevent deacylation of the labeled tRNAsMet during electrophoresis, the samples were subjected to a deamination procedure (11). Transfection of T. bruceiFor expression of wild-type and variant T. gondii tRNAMet-i in T. brucei cells, derivatives of the pHD-437 plasmid (24), which allow stable integration into the trypanosomal rDNA loci, were used. The KpnI/BamHI fragment of the plasmid was replaced by inserts containing either T. gondii wild-type or variant genes of tRNAsMet. Variations in the tRNAMet-i were introduced by PCR-mediated mutagenesis and verified by sequencing. Both tRNAsMet-i were expressed containing 179 nucleotides of their own 5'-flanking region and 61 nucleotides of their 3'-flanking sequence. The constructs were linearized with NotI and electroporated into T. brucei, and transformants were selected with phleomycine and cloned as previously described (25).
Characterization of T. gondii Organellar RNA FractionsTo investigate mitochondrial tRNA import in T. gondii it was essential to prepare defined organellar RNA fractions, which can be analyzed by Northern blots using oligonucleotides recognizing specific nucleus-encoded T. gondii tRNAs. BLAST searches on the available T. gondii genomic sequences allowed us to identify candidate tRNA genes by homology to the corresponding tRNAs in other organisms. Preparing defined organellar RNA fractions of T. gondii was a bigger challenge for the following reasons. It is difficult and expensive to obtain T. gondii cells in large quantities, and, contrary to T. brucei, apicomplexans in addition to mitochondria also contain a plastid that has its own genome and translation system. It was therefore necessary not only to fractionate the mitochondria from the cytosol but also to separate the two organelles from each other. Recently, we have performed an extensive analysis of mitochondrial tRNA import in T. brucei requiring the isolation of mitochondrial RNAs from many different cell lines (13, 14). This was achieved by using the detergent digitonin, which at the correct concentration selectively dissolves the cellular membranes but leaves (at least the inner) mitochondrial membrane(s) intact. Subsequent RNase digestion allows the removal of contaminating cytosolic RNAs. Finally, a centrifugation step results in a pellet that essentially only contains mitochondrial RNAs. The big advantage of this procedure is that it requires a relatively small number of cells only. We therefore tested whether the procedure would be suitable for apicomplexans. Purified and washed T. gondii tachyzoites were extracted with 0.05 and 0.1% of digitonin and subjected to RNase digestion. The resulting RNA fractions together with total T. gondii RNA were then analyzed by specific Northern hybridizations. To identify the different organellar fractions oligonucleotide probes recognizing specific marker RNAs were used. These RNAs were the 5.8 S rRNA for the cytosol and the plastid-encoded tRNAMet for the plastid, both of which can easily be detected on Northern blots. To choose a mitochondrial marker was more difficult, because the mitochondrial genome of T. gondii, unlike that of many other apicomplexans, has not been sequenced yet. However, fragments apparently derived from the mitochondrial DNA have been detected in the nuclear genome of T. gondii (21). These sequences appear to code for typical mitochondrially encoded proteins and show a high homology to the mitochondrial genomes of other apicomplexans but are not expressed. Southern blot hybridization furthermore showed that in addition to the nucleus these sequences also occur in an extrachromosomal, tandemly repeated element of 6 kb, suggesting that they are also present within the bona fide mitochondrial genome of T. gondii (8). We therefore chose a segment of the nuclear mitochondrial-like sequences that is identical to a region coding for a fragment of the mitochondrial LSU rRNA in Plasmodium to design an oligonucleotide expected to hybridize to mitochondrial RNA only. It has been shown that specific mutations in the cytochrome b gene lead to atovaquone-resistant T. gondii cells, indicating that mitochondrial cytochrome b is expressed (6). Thus, in addition to the putative LSU rRNA we were using the mRNA of cytochrome b as a mitochondrial marker. The results of a digitonin-based organellar fractionation of T. gondii cells are shown in Fig. 1. Total RNA and RNA isolated from the RNase-treated pellet fractions obtained from 0.05 and 0.1% digitonin extractions were tested for the presence of cytosolic and organellar RNAs. The top panel shows that as expected the cytosolic marker, 5.8 S rRNA, is detected in the total RNA fraction only. The next two panels show the intracellular distribution of the mitochondrial LSU rRNA fragment and cytochrome b mRNA, respectively. Both RNAs are recovered in the 0.05% digitonin fraction but are accessible to added nucleases in the presence of 0.1% of detergent. Thus, mitochondria with an intact membrane barrier are specifically recovered in the 0.05% digitonin fraction. The last panel shows that the plastid marker, the tRNAMet, remains protected from added RNase in both pellet fractions, indicating that the plastid membranes (at least the innermost), unlike the mitochondrial ones, remain intact even after the 0.1% digitonin extraction. Hence, 0.05% digitonin extraction and subsequent RNase digestion yield a fraction containing mitochondrial and plastid RNAs, which is essentially free of intact cytosolic RNAs. Extraction with 0.1% digitonin, in contrast, results in a fraction containing plastid RNAs only.
Nucleus-encoded T. gondii tRNAs Are Imported into MitochondriaFig. 1B shows the intracellular distribution of four nucleus-encoded T. gondii tRNAs. All were detected in the total RNA fraction as well as in the 0.05% digitonin pellet but were absent from the 0.1% pellet. These results show that, although the largest fraction of each of the tRNAs is found in the cytosol (note that the total RNA fraction essentially corresponds to the cytosol), a small but significant part is recovered in the mitochondria. Quantitatively between 1.5 and 2% of the total cellular content of each tRNA is localized within the mitochondrion (Fig. 1C). These numbers are in the same range as those for T. brucei where 17% of a given tRNA is localized within mitochondria (13). Localization of T. gondii tRNAsMetA global analysis of mitochondrial tRNA import in T. brucei has shown that, with a single exception, all trypanosomal tRNAs are in part imported into mitochondria (13). The only tRNA behaving differently is the tRNAMet-i, which is exclusively found in the cytosol. It was therefore of great interest to analyze the intracellular localization of the nucleus-encoded T. gondii tRNAsMet. As expected BLAST searches of the T. gondii genomic sequences identified two distinct but homologous tRNAsMet, one corresponding to the elongator tRNAMet (tRNAMet-e) and the other one corresponding to the eukaryotic tRNAMet-i (Fig. 2A). In agreement with this we found two [35S]methionine-labeled bands in an in vivo aminoacylation experiment (Fig. 2B, left lane), suggesting that only two cytosolic tRNAMet exist in T. gondii. Furthermore, comparison with a Northern blot analysis run on a duplicate gel and using oligonucleotides designed to specifically detect either of the two tRNAsMet allowed us to attribute the upper band to the tRNAMet-i and the lower one to the tRNAMet-e. Using the same oligonucleotides we also analyzed the RNA fraction from both total cells and from digitonin-extracted samples. The results in Fig. 2C show that the tRNAMet-e is imported into mitochondria and therefore behaves the same as all the other tRNAs tested before (Fig. 1B). However, reminiscent of the situation in T. brucei, the T. gondii tRNAMet-i remained in the cytosol. The quantification in Fig. 2D shows that less of the tRNAMet-i is found in the mitochondrial fraction than of the cytosolic marker, the full-length 5.8 S rRNA. This can be explained by the fact that tRNAs are expected to be soluble molecules, whereas the 5.8 S rRNA is a component of ribosomes and some of which may remain associated with mitochondria.
In a further analysis we subjected aliquots of total and digitonin-extracted organellar RNA fractions to in vitro aminoacylation assays using radioactive [35S]methionine and either RNA-free cytosolic extract of T. brucei or T. gondii as a source of enzyme. As expected and in agreement with the in vivo results shown in Fig. 2B, for both extracts two labeled bands, corresponding to tRNAMet-i and tRNAMet-e, were detected in the total RNA fraction (Fig. 3, left lanes). In the 0.05% digitonin pellet containing the mitochondrial RNAs, only the lower band corresponding to the tRNAMet-e was observed (Fig. 3, middle lanes). Thus, these results confirm the cytosol-specific localization of the tRNAMet-i. Furthermore, they suggest that the only tRNAMet present in mitochondria of T. gondii, corresponds to the tRNAMet-e identified in the genomic data base. The methionyl-tRNA synthetase activity in the T. gondii cytosolic extract was lower than the one in the T. brucei extract. This is explained by the fact that it was difficult to prepare a sufficiently concentrated RNA-free cytosolic fraction from T. gondii due to the limited amount of material that was available. However, this cannot account for the fact that the T. gondii methionyl-tRNA synthetase preferentially charges the tRNAMet-e when tested in vitro (Fig. 3, bottom panel left lane), whereas the T. brucei extract preferentially charges the tRNAMet-i (Fig. 3, top panel left lane).
There are at least two possible explanations for this observation. It could be that, although the methionyl-tRNA synthetase activities in T. gondii and T. brucei can in principle charge both T. gondii tRNAsMet, their preferred substrate tRNAsMet are different. Alternatively, it is possible that the T. brucei extract aminoacylates (with methionine) a T. gondii tRNA species other than tRNAMet. Expression of T. gondii tRNAsMet in T. bruceiExpression of tRNAMet variants in transgenic T. brucei has successfully been used to identify the determinants responsible for their intracellular localization (14). In principle the same approach should be feasible for T. gondii. However, despite repeated attempts, we were not able to express tRNAMet variants in transgenic T. gondii. We therefore took the converse approach and expressed T. gondii tRNAsMet in T. brucei. However, this was also problematic, because, of the many variants of T. gondii tRNAMet that were assessed, only the wild-type tRNAMet-i and a variant thereof carrying the T-arm of the tRNAMet-e could be expressed. This was surprising, because we have previously successfully expressed many variants of trypanosomal (14) as well as heterologous tRNAs (26), and this suggests that for unknown reasons expression of most T. gondii tRNAMet variants is harmful for T. brucei. The results of the two T. gondii tRNAsMet that could be expressed are shown in Fig. 4. Total and mitochondrial RNA from wild-type and the two transgenic T. brucei cell lines were analyzed for the presence of the T. gondii tRNAMet-i (Fig. 4, middle panel) and the tRNAMet-i variant carrying the T-arm of the T. gondii tRNAMet-e (Fig. 4, right panel), respectively. The top panel in Fig. 4 shows that in T. brucei both T. gondii tRNAsMet remain in the cytosol. The lower two panels of Fig. 4 show the intracellular distribution of the trypanosomal wild-type tRNAMet-i, which serves as the cytosolic marker, and that of the partially imported wild-type tRNAMet-e, respectively. The fact that the T. gondii tRNAMet-i remains in the cytosol is expected, because it contains the cytosolic T-stem localization determinants, which were defined for the T. brucei tRNAsMet (14). In contrast, the cytosolic localization of the tRNAMet-i variant carrying the T-arm of the T. gondii tRNAMet-e is unexpected, because it contains the predicted trypanosomal mitochondrial T-stem localization determinants. It is therefore possible that the localization determinants in T. gondii and T. brucei tRNAsMet are different. However, we cannot exclude that the T. gondii tRNAMet-i variant when expressed in T. brucei is less efficiently charged. The unexpected localization of the T. gondii tRNAMet-i variant, therefore, does not automatically mean that incompatible localization determinants are present but could in principle be a secondary effect due to poor charging. Interestingly, however, as shown in previous experiments (26) most heterologous elongator tRNAs behave differently and generally are imported into trypanosomal mitochondria indicating that, at least for elongator tRNAs, import is the default pathway. Absence of Thio-modified Nucleotides in T. gondii tRNAGln and tRNATrpIn trypanosomatids all tRNAs, with the exception of the tRNAMet-i, are imported into the mitochondria to variable extents, and as shown in this work the same appears to be true for T. gondii. This raises the question of how the extent of import is regulated. Recently, it was suggested that in Leishmania, this is achieved by cytosol-specific 2-thiouridines, which are found in the anticodon wobble position of leishmanial tRNAGlu and tRNAGln and which act as anti-import determinants (15). To see whether this might also be the case in apicomplexans we analyzed the T. gondii tRNAGln for the presence of thio-modified nucleotides by using affinity gel electrophoresis for thiolated residues (18). The result of such an analysis for the T. brucei tRNAGln is shown in the left panel of Fig. 5. A retardation of the band, which is specific for the cytosolic fraction, was observed indicating that the cytosolic but not the mitochondrial tRNAGln contains a thio-modified nucleotide. The converse result was obtained for the T. brucei tRNATrp, part of which was selectively thio-modified in the mitochondrial fraction only (Fig. 5, bottom left panel). These results are identical to the ones obtained for Leishmania, where cytosol- and mitochondria-specific thiolation of the tRNAGln (15) and tRNATrp (27), respectively, have first been described and suggest that the pattern of thio-modifications is conserved within trypanosomatids. Interestingly, a very different result is obtained for T. gondii tRNAGln and tRNATrp. Both tRNAs were lacking any thio-modified nucleotides, irrespective of whether they were isolated from the cytosol or from mitochondria. Thus, in T. gondii, unlike that suggested in trypanosomatids, thio-modified nucleotides cannot be involved in regulating the extent of tRNAGln import. Furthermore, the fact that thio-modified nucleotides were also absent from the imported tRNATrp may indicate a general absence of thio-modified tRNAs in T. gondii.
The mitochondrial genome of apicomplexans lacks tRNA genes (7). It has therefore been postulated that these organisms import all their tRNAs from the cytosol. Using defined organellar RNA fractions, obtained by a newly established fractionation procedure (Fig. 1A), we have tested this prediction for the apicomplexan parasite T. gondii. Six out of six nucleus-encoded elongator-type tRNAs (tRNAAla, tRNAIle, tRNASer, tRNATrp, tRNAGln, and tRNAMet-e) tested were in part recovered in the mitochondrial fraction (Figs. 1B, 2C, and 5) and therefore imported from the cytosol. This suggests that in T. gondii a small fraction of any given cytosolic elongator-type tRNA is imported into mitochondria. Interestingly, however, the nucleus-encoded eukaryotic-type tRNAMet-i only occurs in the cytosol. tRNAMet-i and tRNAMet-e differ only by 31 nucleotides (Fig. 2A) indicating that these differences or a subset thereof must be responsible for their differential localization. This situation is reminiscent of the one in the trypanosomatid T. brucei, which also imports all mitochondrial tRNAs (13). Furthermore, the only trypanosomal cytosol-specific tRNA, just as in T. gondii, corresponds to the cytosolic tRNAMet-i. It differs from the imported tRNAMet-e by 26 nucleotides, and a recent study (14) has shown that two nucleotide pairs in the T-stem region are both necessary and sufficient to specify the localization of the trypanosomal tRNAsMet. Imported tRNAs are always of the eukaryotic type (10). Thus, we have the extraordinary situation in T. gondii and T. brucei mitochondria of a bacterial-type translation system that has to function with imported eukaryotic type tRNAs only. Although most eukaryotic type tRNAs can be expected to function in the context of a bacterial type translation system, this is not the case for tRNAsMet. All organisms have two classes of tRNAsMet, an tRNAMet-i, which is used for initiation of protein synthesis, and a tRNAMet-e, which functions in the insertion of methionine into internal peptidic linkages. Whereas elongator tRNAsMet-e of all organisms look similar, there are two distinct groups of tRNAsMet-i. The tRNAMet-i of the eukaryotic cytosol carries an A1:T72 base pair, which is not found in any other tRNA. Bacterial and organellar tRNAsMet-i, on the other hand, are characterized by a mismatch at the top of the acceptor stem and carry a formylated methionine (28, 29). Thus, it makes sense that the only cytosol-specific tRNA detected in T. gondii as well as T. brucei corresponds to the eukaryotic-type tRNAMet-i, because this tRNA could not possibly function in the context of the bacterial type translation systems of mitochondria. However, the fact that the imported tRNAMet-e appears to be the only tRNAMet present in mitochondria raises the question of how mitochondrial translation initiation in apicomplexans and trypanosomatids, known to require a formylated bacterial type tRNAMet-i, can function with an imported tRNAMet-e. Mitochondrial translation initiation has been studied in detail in T. brucei, and it was shown that a fraction of the imported tRNAMet-e becomes formylated after import into mitochondria and subsequently can act in translation initiation (22, 30). Formylation of a tRNAMet-e is very unusual and requires a distinct tRNAMet formyl-transferase (MTF). The enzyme has been identified in T. brucei and was shown to have a diametrically opposed substrate specificity compared with all other known bacterial and organellar MTFs, in that it selectively recognizes tRNAMet-e. Furthermore, the trypanosomal protein is approximately twice the size of all other MTFs (22). Do apicomplexan mitochondria also use formylated tRNAMet-e to initiate mitochondrial translation? Due to the limited amount of mitochondrial RNA available it was not possible to analyze the formylation state of the imported tRNAMet-e in T. gondii. However, BLAST searches of the two complete and annotated genomes of P. falciparum and Plasmodium yoelli show that these two apicomplexans possess a single MTF, each of which has approximately twice the size of MTFs from other organisms. Preliminary analysis of the as yet unannotated genome suggests that also T. gondii has an unusually large MTF. Thus, it is possible that, just as in T. brucei, the apicomplexan MTF formylates imported tRNAMet-e and that the large molecular weight of the proteins is linked to their unusual substrate specificity. However, the problem with this explanation is that apicomplexans appear to have a single MTF gene only. This is unexpected, because both mitochondria and the plastid are expected to require formylated tRNAMet for organellar translation initiation. It is therefore possible that the identified apicomplexan MTF genes encode the plastid enzymes or that the proteins are targeted to both organelles. Examples for dual targeting of proteins to the plastid and to mitochondria have been described before (31). Finally, taking into account that only three proteins are synthesized in the mitochondria of apicomplexans (8), it is also conceivable that the need for a formylated tRNAMet for translation initiation has been bypassed altogether. Thus, the question of which tRNA is used for mitochondrial translation initiation at present remains open. In summary, we present for the first time experimental evidence for mitochondrial tRNA import in apicomplexans and show that the specificity of the process is identical to the one in trypanosomatids. Apicomplexans and trypanosomatids are not closely related, which raises the question, whether the uncovered similarities of the two systems are due to a remote common ancestor or arose independently through convergent evolution. Answering this question will require a detailed knowledge of the tRNA import mechanisms in both organisms.
* This study was supported by Grants 31-067906.02 (to A. S.) and 32-067782.02 (to A. H.) from the Swiss National Foundation. Genomic data were provided by The Institute for Genomic Research (supported by National Institutes of Health (NIH) Grant AI05093), and by the Sanger Center (Wellcome Trust). Expressed Sequence Tag sequences were generated by Washington University (NIH Grant 1R01AI04580601A1). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. ¶ To whom correspondence should be addressed. Tel.: 41-26-300-8877; Fax: 41-26-300-9741; E-mail: andre.schneider{at}unifr.ch.
1 The abbreviations used are: tRNAMet-i, initiator tRNAMet; tRNAMet-e, elongator tRNAMet; LSU rRNA, large subunit ribosomal RNA; MTF, tRNAMet-formyl transferase.
Preliminary genomic and/or cDNA sequence data was accessed via ToxoDB.org and/or www.tigr.org/tdb/t_gondii/.
This article has been cited by other articles:
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Advertisement | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||