Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M405549200 on August 6, 2004

J. Biol. Chem., Vol. 279, Issue 41, 42438-42444, October 8, 2004
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
279/41/42438    most recent
M405549200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chang, W.
Right arrow Articles by McCarthy, T. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chang, W.
Right arrow Articles by McCarthy, T. L.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Fos-related Antigen 2 Controls Protein Kinase A-induced CCAAT/Enhancer-binding Protein {beta} Expression in Osteoblasts*

Weizhong Chang, Amar Rewari, Michael Centrella, and Thomas L. McCarthy{ddagger}

From the Section of Plastic Surgery, Department of Surgery, Yale University School of Medicine, New Haven, Connecticut 06520

Received for publication, May 18, 2004 , and in revised form, July 12, 2004.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Transcription factor CCAAT/enhancer-binding protein {beta} (C/EBP{beta}) plays an important role in hormone-dependent gene expression. In osteoblasts C/EBP{beta} can increase insulin-like growth factor I (IGF-I) transcription following treatment with hormones that activate protein kinase A, but little is known as yet about the expression of C/EBP{beta} itself in these cells. We initially showed that prostaglandin E2 (PGE2) rapidly enhances C/EBP{beta} mRNA and protein expression, and in this study we identified a 3'-proximal region of the C/EBP{beta} promoter containing a 541-bp upstream sequence that could account for this effect. PGE2-dependent activation of C/EBP{beta} was blocked by expression of a mutated regulatory subunit of protein kinase A or by mutation of two previously identified cAMP-sensitive cis-acting regulatory elements within the promoter between bp –111 and –61. Nuclear protein binding to these elements was induced by PGE2, required new protein synthesis, and was sensitive to antibody to the transcription factor termed Fos-related antigen 2 (Fra-2). Fra-2 cDNA generated from rat osteoblasts by reverse transcriptase PCR was 95% homologous to human Fra-2, and PGE2 rapidly induced Fra-2 mRNA and protein expression. Consistent with these findings, over-expression of Fra-2 significantly increased C/EBP{beta} promoter activity in PGE2-induced osteoblasts, whereas expression of Fra-2 lacking its activation domain had a dominant negative inhibitory effect. Together, these results reveal a significant, hormone-dependent role for Fra-2 in osteoblast function, both directly, through its ability to increase new C/EBP{beta} gene expression, and indirectly, through downstream C/EBP sensitive genes.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Many cells and tissues express one or another of the several C/EBP1 transcription factor gene family members, termed C/EBP{alpha}, -{beta}, -{delta}, -{gamma}, and -{epsilon} (1, 2). Individual C/EBPs can form homodimers or heterodimers and share common DNA binding response elements, consistent with the high degree of homology in their carboxyl termini where their dimerization and DNA binding domains reside. Of these, basal expression of C/EBP{beta} is high in liver, intestines, differentiating adipocytes, lung, kidney, and spleen, as well as in monocytic blood cells. However, basal expression of C/EBP{beta} is relatively low in osteoblasts, but it can be enhanced by treatment with glucocorticoid, PGE2, or 1,25(OH)2 vitamin D3 (35).2

Because the various C/EBPs are widely expressed, it is no surprise that they direct the synthesis of a large panel of target genes. In osteoblasts either C/EBP{delta} or C/EBP{beta}, which are variably expressed in several osteoblastic cell models, can in turn activate the expression of several prominent downstream genes, including those encoding IGF-I, IGFBP-5, IL-6, osteocalcin, and cyclooxygenase 2 (4, 69).

Earlier we reported that Runx2, a transcription factor essential for osteogenesis (10, 11), is an important, direct regulator of C/EBP{delta} expression in osteoblasts, by way of a Runx binding sequence located between bp –165 to –159 in the C/EBP{delta} gene promoter (12). Moreover, through an apparent negative feedback inhibition, the carboxyl-terminal region of C/EBP{delta} can bind directly to Runx2 and in this way self-limit C/EBP{delta} expression and activity. Others have reported roles for STAT3, Sp1, and C/EBP{delta} itself in the regulation of C/EBP{delta} expression in other cell models (1316). By contrast, molecular mediators that direct C/EBP{beta} gene expression have been better established in nonskeletal tissue-derived cells. For example, studies in hepatocytes defined two cAMP-responsive elements (CREs) that are located between bp –121 and –71 in the C/EBP{beta} promoter and can interact with CREB and C/EBP{beta} to drive C/EBP{beta} gene expression. In those cells, lipopolysaccharide increases C/EBP{beta} expression through shared or distinct elements that require c-Jun and ATF-2, whereas IL-6-dependent induction of C/EBP{beta} involves an indirect association of STAT3 to these CRE sequences (1719).

Importantly, agents or events associated with trauma, inflammation, and the acute phase response have critical effects on C/EBP{beta} synthesis, perhaps to assist the expression of downstream genes associated with recovery and tissue repair (1, 2). In osteoblasts, we earlier reported an increase in C/EBP{beta} expression in response to PGE2 (3). In the current study, we have characterized the molecular mediators that can account for this effect. We demonstrate the relative importance of a specific protein kinase system and the two previously identified cis-acting CREs that drive new C/EBP{beta} synthesis. Finally, we show that one trans-acting transcription factor that can control this event in differentiating osteoblasts is distinct from those factors characterized previously in other cell types, predicting a novel control mechanism that may be tissue or context specific.


    EXPERIMENTAL PROCEDURES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Cell Culture—Primary osteoblast-enriched cultures were prepared from parietal bones of 22-day-old Sprague-Dawley rat fetuses (Charles River Breeding Laboratories) by methods approved by the Yale Institutional Animal Care and Use Committee. Bone sutures were dissected, and cells were released from the bone fragments by five sequential collagenase digestions. Cells pooled from the last three digestions express many biochemical features that typify differentiating osteoblasts, including high levels of nuclear factor Runx2, parathyroid hormone (PTH) receptor, type I collagen synthesis, and alkaline phosphatase activity (2022). They also exhibit an increase in osteocalcin expression in response to vitamin D3, differential sensitivity to transforming growth factor-{beta}, bone morphogenetic protein-2, and various prostaglandins and form mineralized nodules in vitro (2328). Cells were plated at 4,000/cm2 in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum. COS-7 cells (CRL 1651) from the ATCC were cultured in identical medium. Hormone treatments were performed in serum-free medium.

Plasmids—C/EBP{beta} promoter constructs, prepared from a {lambda} library of genomic rat DNA, were based on earlier reported sequence information (Ref. 29 and GenBankTM accession no. AY056052 [GenBank] ). Mutations were created in two previously described CREs within the C/EBP{beta} promoter (17) by overlap PCR and mutated oligomer primer pairs. The primers used to mutate CRE1 were: CRE1µ forward, 5'-CGCGGCCGGGCAATGGTTCGCACCGACCCGG-3'; and CRE1µ reverse, 5'-CGCCGGGTCGGTGCGAACCATTGCCCGGCCG-3'. Primers used to mutate CRE2 were: CRE2µ forward, 5'-GGGAGGGGCCCCGGCGGATCCCAGCCCGTTGCCAGG-3'; and CRE2µ reverse, 5'-CGCCTGGCAACGGGCTGGGATCCGCCGGGGCCCCT-3' (mutated nucleotides are indicated by bold underlined italics). A Fos-related antigen 2 (Fra-2) expression plasmid was prepared from total rat RNA using the C.therm. Polymerase One-step RT-PCR System (Roche Applied Science) with forward primer GAGAATTCGGGAAATGTACCAGGATTATCCCGGG and reverse primer GCTCTAGATTACAGAGCCAGCAGAGTGGGG based on rat Fra-2 sequence information in GenBankTM (accession no. NM_012954 [GenBank] ), utilizing the EcoRI and XbaI restriction sites (underlined) for directional cloning. An expression plasmid encoding dominant negative Fra-2 was produced from this construct by reverse transcriptase PCR to delete amino acids 208–328, comprising its transactivation domain.

Transfections—Promoter-reporter constructs, gene expression plasmids, or empty parental vectors were pre-titrated for optimal expression efficiency and transfected with reagent TransIT LT1 (Mirus). Cells at 50–70% culture confluence (25,000–30,000/cm2) were exposed to an optimal amount of expression plasmid (10–20 ng/cm2) or reporter plasmid (50 ng/cm2) in medium supplemented with 0.8% fetal bovine serum for 16 h and then supplemented to obtain a final concentration of 5% serum. Cells were cultured for 48 h, treated as indicated in each figure in serum-free medium, rinsed, and lysed. Nuclear-free supernatants were analyzed for reporter gene activity and corrected for protein content. To account for competition among plasmids for limiting transcription components, control cells were transfected with a compensating amount of empty vector. Transfection efficiency was assessed in parallel with positive and negative reporter plasmids as described previously (28).

RNA Analysis—Total RNA was extracted with acid-guanidine-monothiocyanate, precipitated with isopropyl alcohol, and dissolved in sterile water (30). mRNA levels were assessed by Northern blot analysis using 10 µg of RNA denatured in formaldehyde/formamide. Co-electrophoresed RNA standards were used to verify transcript size. Restriction fragments including cDNA inserts encoding rat C/EBP{beta} or rat Fra-2 were isolated by agarose gel electrophoresis and a QIAquick gel extraction kit (Qiagen Corp.) were labeled with [{alpha}-32P]dCTP and [{alpha}-32P]dTTP by random hexanucleotide-primed second strand synthesis to use as Northern blot probes. Post-hybridization stringency wash was with 0.2x SSC and 0.1% SDS for 1 h at 55 °C. In some instances, after hybridization and autoradiography, primary probes were stripped, and the blots were re-hybridized with a 32P-labeled 18 S rRNA probe of 80 nucleotides, prepared with the T7 MEGAshortscript kit (Ambion) to assess equal RNA loading and blotting. In other instances, rRNA levels were assessed by staining with ethidium.

Nuclear Extracts—Cells were rinsed, harvested, and lysed in a hypotonic buffer supplemented with phosphatase and protease inhibitors and 1% Triton X-100. Nuclei were collected and resuspended in hypertonic buffer with phosphatase and protease inhibitors, and soluble nuclear proteins released after 30 min of extraction were collected by centrifugation as described (3, 31, 33).

Electrophoretic Mobility Shift Assay (EMSA)—Oligomers used in EMSA were: HS3D, 5'-GAGCAGATAGAGCCTGCGCAATCGAAATAAAGTC-3'; CRE1, 5'-CGCGGCCGGGCAATGACGCGCACCGACCCGGCG-3'; and CRE2, 5'-GGGAGGGGCCCCGGCGTGACGCAGCCCGTTGCCAGGCG-3' (bold underlined nucleotides correspond to factor-specific binding sequences). Oligomers for mutant CRE1 (CRE1µ, 5'-CGCGGCCGGGCAATGGTTCGCACCGACCCGGCG-3') and mutant CRE2 (CRE2µ, 5'-GGGAGGGGCCCCGGCGGATCCCAGCCCGTTGCCAGGCG-3') (mutated nucleotides indicated by bold underlined italics) were based on previous studies by Niehof et al. (17). Complementary strands were synthesized and hybridized to their respective partners to prepare 32P-labeled oligomers for EMSA by filling the overhanging single strand regions with dNTPs and [{alpha}-32P]dCTP with the Klenow fragment of DNA polymerase I. Three µg of nuclear protein was preincubated with 2 µg of poly(dI:dC), without or with unlabeled specific or nonspecific competitor DNAs or antibody preparations (Santa Cruz Biotechnologies), supplemented with 5 x 104 cpm of probe (0.1 to 0.2 ng) and fractionated through a 5% nondenaturing polyacrylamide gel. Radioactive bands were visualized by autoradiography (3, 31, 33).

Western Immunoblots—Total cell or nuclear extracts were fractionated through SDS-PAGE and electroblotted onto PolyScreen polyvinylidene difluoride transfer membrane (PerkinElmer Life Sciences) with pre-stained molecular weight markers. Blots were blocked in 5% fat-free powdered milk and probed with specific primary antibodies (Santa Cruz Biotechnologies), and reactive bands were visualized with secondary antibody linked to horseradish peroxidase and chemiluminescence (Western Lightning, PerkinElmer Life Sciences) (3, 33).

Statistics—Statistical differences in biochemical assays were assessed by one-way analysis of variance and Student-Newman-Keuls post hoc analysis, using SigmaStat software (Jandel Corp.), from a total of nine or more replicate samples from three or more studies each performed with different cell preparations. A significant difference was assumed by a p value of <0.05.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
PGE2 Induces C/EBP{beta} Expression—We previously showed that C/EBP is an important regulator of IGF-I expression in PKA-activated osteoblasts, by way of a single high affinity C/EBP binding half-site located within exon 1, a transcribed, noncoding, and highly conserved region of the IGF-I gene. C/EBP{delta} is the principal endogenous C/EBP in unstimulated osteoblasts (4). Close examination of in vitro binding using the IGF-I promoter derived C/EBP binding element, designated HS3D, and nuclear extract from PGE2-activated osteoblasts, showed two prominent complexes and suggested the presence of multiple proteins. As shown in Fig. 1A, antibodies to either C/EBP{beta} or C/EBP{delta} each effectively reduced protein binding to this element. The upper gel shift complex that occurred with extract from PGE2-activated osteoblasts was primarily sensitive to anti-C/EBP{beta} antibody, whereas both complexes were reduced by anti-C/EBP{delta} antibody, consistent with the importance of heterodimers containing both C/EBP isoforms. Treatment with PGE2 rapidly elevated the levels of C/EBP{beta} mRNA and protein. A large increase in C/EBP{beta} mRNA occurred within 1 h of treatment, peaked at 2 h, and declined but remained significantly elevated for at least 24 h (Fig. 1B). By Western immunoblot analysis, a maximal increase in C/EBP{beta} protein in total osteoblast extract was achieved by 4 h of PGE2 treatment (Fig. 1C).



View larger version (83K):
[in this window]
[in a new window]
 
FIG. 1.
PGE2 induces the expression of C/EBP{beta} in rat osteoblasts. A, nuclear extracts from osteoblasts treated for 4 h in serum-free medium with vehicle (0) or 1 µM PGE2 (P) were examined by EMSA with 32P-labeled oligonucleotide HS3D, corresponding to the C/EBP binding site in the rat IGF-I gene without (0) or with nonimmune rabbit Ig, anti-C/EBP{beta} ({beta}), or anti-C/EBP{delta} ({delta}) antibody (ab) as indicated. B, total RNA from osteoblasts treated with vehicle (0) or 1 µM PGE2 for the time periods indicated was fractionated by agarose gel electrophoresis, blotted onto charge-modified nylon, and probed with 32P-labeled full-length C/EBP{beta} cDNA. The membrane was stripped and reprobed with low specific activity 32P-labeled probe for 18 S rRNA. Binding was assessed by autoradiography. C, total osteoblast extracts were fractionated by SDS-PAGE through a 12.5% Laemmli gel under reducing conditions and probed with rabbit anti-C/EBP{beta} polyclonal antiserum.

 
Locating the PGE2-responsive Element in the C/EBP{beta} Promoter—To locate regulatory elements utilized by osteoblasts after PGE2 activation, cells were transfected with reporter plasmids encoding progressive C/EBP{beta} promoter truncations. The C/EBP{beta} promoter fragments shared a common 3'-end at bp +54 but terminated at bp –2700, –1300, or –541 at their 5'-ends. As shown in Fig. 2A, gene expression through each fragment was significantly induced by 6 h of treatment with PGE2. Earlier evidence from studies with hepatocytes showed two important cAMP-sensitive elements downstream of bp –541, located between bp –111 and –61 (17), allowing us to focus our effort more precisely. Indeed, we found that mutation of either or both of these elements within the context of the –541 upstream segment significantly reduced basal C/EBP{beta} promoter activity in osteoblasts and severely limited the stimulatory effect PGE2 by 75–80%. To assess the kinase systems responsible for the stimulatory effect of PGE2, we co-transfected osteoblasts with the fully functional –541 C/EBP{beta} promoter-reporter construct and either a mutant regulatory subunit of PKA that blocks its activation (PKAregµ) or a dominant negative PKC (PKCDN) that exerts broad-spectrum PKC isoform inhibition (34, 35). Expression of the mutant regulatory subunit of PKA completely blocked C/EBP{beta} promoter activation, whereas expression of the PKCDN protein had no effect (Fig. 2B).



View larger version (24K):
[in this window]
[in a new window]
 
FIG. 2.
Functional CREs in the proximal region of the C/EBP{beta} gene promoter and PKA dependent activation in rat osteoblasts. A, osteoblasts were transfected with 250 ng of reporter plasmids containing fragments of the rat C/EBP{beta} promoter with 5'-termini at –2700, –1300, or –541 bp and a common 3'-terminus at +54 bp in a total of 500 µl. Mutations introduced into C/EBP{beta} promoter fragment –541 to +54 to disrupt either or both previously identified CREs between –111 and –61 bp are designated as –541µ1, –541µ2, and –541µ1,2. B, osteoblasts were co-transfected to express 250 ng of the native –541-bp fragment of the C/EBP{beta} promoter and 100 ng of either a mutated regulatory subunit of PKA (PKAregµ) or a dominant negative PKC{alpha} subunit (PKCDN) in a total of 500 µl. Reporter gene activity was measured after 6 h of treatment with vehicle (control) or 1 µM PGE2. Data were corrected for protein content and are the means ± S.E. from 9 or more replicate cultures per condition and 3 or more experiments. *, basal C/EBP{beta} promoter activity and the stimulatory effect of PGE2 were significantly suppressed (p < 0.05) by either or both CRE mutations (in A) and only by PKAregµ in PGE2-treated osteoblasts (in B).

 
Inducible Protein Binding to CRE1 and CRE2—To assess protein binding to these important CRE elements that occur in the C/EBP{beta} promoter, we performed EMSA with 32P-labeled oligonucleotides, designated CRE1 and CRE2, corresponding to each element. Nuclear extract from osteoblasts treated for 4 h with PGE2 caused inducible gel shift complexes with each element, and these complexes were competed by excess unlabeled homologous oligonucleotides but not by oligonucleotides in which the CRE1 binding sequences were mutated. Data are shown in Fig. 3A for [32P]CRE1 and unlabeled CREµ1(µ1), but analogous results occurred with [32P]CRE2 and mutated CREµ2. Unlabeled oligonucleotide HS3D, corresponding to the C/EBP binding element in the IGF-I gene (as described in Fig. 1A), did not compete for protein binding to either CRE probe even at a 100-fold molar excess, and neither anti-C/EBP{beta} nor anti-C/EBP{delta} antibody reduced complex formation (Fig. 3B). However, although oligonucleotides corresponding to consensus CREB binding sequences effectively competed for nuclear factor binding to these CREs (Fig. 3B), anti-CREB antibody did not alter complex formation (Fig. 3A). Therefore, these CREs appear to have an important effect on PKA-dependent C/EBP{beta} expression in osteoblasts, and transcription factors other than C/EBP or CREB appear to associate with these elements after treatment with PGE2.



View larger version (96K):
[in this window]
[in a new window]
 
FIG. 3.
PGE2 induces rat osteoblast nuclear factor binding to CREs in the C/EBP{beta} promoter. A, nuclear extracts from osteoblasts treated for 4 h in serum-free medium with vehicle (0) or 1 µM PGE2 (P) were examined by EMSA with 32P-labeled oligonucleotide CRE1 and with either 100-fold molar excess of unlabeled CRE1 (C1), CRE2 (C2), or mutated CRE1 (µ1) as defined under "Experimental Procedures" or by anti-CREB antibody as indicated. B, nuclear extracts from vehicle or PGE2-treated osteoblasts were examined by EMSA with 32P-labeled oligonucleotide CRE1 and with either a 100-fold molar excess of unlabeled oligonucleotide HS3D (H) that associate with the C/EBPs or CREB (CB), as defined under "Experimental Procedures," or anti-C/EBP{beta} ({beta}) or anti-C/EBP{delta} ({delta}) antibody as indicated.

 
Fra-2 Binds to CRE1 and CRE2—PGE2 activated the C/EBP{beta} promoter through a PKA-dependent event, and we speculated that these CREs might bind AP-1-like factors based on their nucleotide sequences and previous evidence from studies in osteoblasts (36). Select AP-1 transcription factors are expressed during osteoblast differentiation (3740). Therefore we used a panel of antibodies to various AP-1-binding proteins, C/EBP{delta}, C/EBP{beta}, CREB (as shown in Fig. 3), ATF-2, and JunD.2 However, only antibodies specific to the transcription factor Fra-2 effectively modified binding to each of these elements. Again, analogous results occurred with oligonucleotides encoded by element CRE-1 and CRE-2, and data from results obtained using the oligonucleotide specific for CRE-1 are shown in Fig. 4A. Western immunoblot analysis showed that PGE2 induced a rapid accumulation of Fra-2 (Fig. 4B) that was completely blocked by co-treatment with the protein synthesis inhibitor cycloheximide (Fig. 4C). Using sequence information obtained from GenBankTM, we designed primers to synthesize full-length cDNA encoding rat Fra-2 by reverse transcriptase PCR from total osteoblast RNA. The rat Fra-2 sequence that we cloned was 95% homologous to human Fra-2. All sequence variations appeared to be minor, and the predicted gene products retained a protein sequence homology of 96% (Fig. 5). Using the rat Fra-2 cDNA as a probe, we then examined Fra-2 mRNA by Northern blot analysis. Fra-2 mRNA levels increased within 30 min of PGE2 treatment, peaked at 1 h, and remained elevated for at least 4 h (Fig. 4D).



View larger version (48K):
[in this window]
[in a new window]
 
FIG. 4.
PGE2 induces Fra-2 expression in rat osteoblasts. A, nuclear extracts from osteoblasts treated for 4 h in serum-free medium with vehicle (0) or 1 µM PGE2 (P) were examined by EMSA with 32P-labeled oligonucleotide CRE1 as described for Fig. 3 and either nonimmune Ig or anti-Fra-2 antibody (ab). B, total osteoblast extract from vehicle or PGE2-treated osteoblasts for the time periods indicated was fractionated by SDS-PAGE through a 12.5% Laemmli gel under reducing conditions and probed with rabbit anti-Fra-2 polyclonal antiserum. C, total nuclear extracts from osteoblasts treated with PGE2 without or with cycloheximide (Cyclohex), as indicated, were assessed as described in B. D, total RNA from osteoblasts treated with vehicle (0) or 1 µM PGE2 for the time periods indicated was fractionated by agarose gel electrophoresis, blotted onto charge-modified nylon, probed with 32P-labeled full-length Fra-2 cDNA, and assessed by autoradiography. Parallel samples were stained with ethidium to detect 18 S and 28 S rRNA bands.

 



View larger version (63K):
[in this window]
[in a new window]
 
FIG. 5.
Comparison of amino acid sequences corresponding to Fra-2 from human and rat cells. The sequence of rat osteoblast Fra-2 protein was derived from the cDNA cloned from primary cultures of fetal rat osteoblasts. The predicted protein sequence from rat osteoblast cDNA (Fra2_Rat_OB) was compared with Fra-2 cloned from human monocytic cells (Fra2_Human_Mono) and rat pineal gland (Fra2_Rat_PIN) using ClustalW software from the European Bioinformatics Institute (www.ebi.ac.uk). By the criteria of this software program, an asterisk below the sequence means that the residues in that column are identical in all sequences in the alignment. A colon below the sequence means that conserved substitutions were observed. A period below the sequence means that semi-conserved substitutions were observed.

 
Fra-2 Regulates C/EBP{beta} Promoter Activity in PGE2-induced Osteoblasts—We produced expression plasmid constructs encoding full-length Fra-2 and a carboxyl-truncated dominant negative Fra-2 devoid of its carboxyl transactivation domain (41). The full-length and dominant negative Fra-2 were then co-transfected with either the fully active –541-bp C/EBP{beta} promoter plasmid or that containing the mutated CRE1 and CRE2 elements. Full-length Fra-2 significantly enhanced PGE2-induced C/EBP{beta} promoter activation in a concentration-dependent fashion (Fig. 6A), whereas dominant negative Fra-2 significantly reduced C/EBP{beta} promoter activation by 50% (Fig. 6B). Consistent with the importance of these CREs for Fra-2 activity, full-length Fra-2 failed to enhance gene expression in cells co-transfected to express C/EBP{beta} promoter that contained the CRE1/CRE2 mutations (Fig. 6A). The dominant negative expression construct encoding Fra-2 also suppressed basal C/EBP{beta} gene promoter activity (Fig. 6B). This effect may be direct through other currently unidentified Fra-2 binding elements, or it may be indirect through the formation of inactive heterodimer complexes between other important trans-acting factors and the dominant negative Fra-2 protein. In either case, these results confirm that C/EBP{beta} expression is transcriptionally activated by PGE2 through the CRE1 and CRE2 AP-1 binding elements and reveal the stimulatory effect at these sites by newly synthesized Fra-2 in PKA-activated osteoblasts.



View larger version (28K):
[in this window]
[in a new window]
 
FIG. 6.
Over-expression of native or dominant negative Fra-2 modifies C/EBP{beta} gene promoter activity in rat osteoblasts. Osteoblasts were transfected with the indicated amounts of pcDNA3 expression plasmids encoding full-length rat Fra-2 cDNA (A) or dominant negative Fra-2 (Fra-2-DN) produced by carboxyl-terminal truncation to delete amino acids 208–328 (B) in combination with 250 ng of reporter plasmids driven by either the native –541-bp C/EBP{beta} promoter fragment or plasmid µ1,2 containing mutations in both CRE1 and CRE2 in a total of 500 µl. Compensating amounts of the parental expression vector pcDNA3 were added to balance the total plasmid load. Cells were treated for 6 h with vehicle (control) or 1 µM PGE2 as indicated. Reporter gene activity was measured after 6 h of treatment with vehicle (control) or 1 µM PGE2. Data were corrected for protein content and are the means ± S.E. from 9 or more replicate cultures per condition and 3 or more experiments. *, the stimulatory effect of PGE2 was significantly enhanced (p < 0.05) in cells transfected with 100–150 ng of native Fra-2 and significantly suppressed (p < 0.05) in cells transfected to express 100–300 ng of dominant negative Fra-2.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
C/EBP{beta} and C/EBP{delta} are important components in the development of the acute phase response and participate in the induction of many genes involved in tissue remodeling (1, 2). In osteoblasts, C/EBPs can activate the expression of several important gene products, including IGF-I, IGFBP-5, IL-6, osteocalcin, and cyclooxygenase 2 (4, 69). C/EBP{delta} is the predominantly expressed C/EBP in unstimulated rat and human osteoblasts (4). In this regard, we earlier reported that Runx2, an essential transcription factor required for osteoblast differentiation, is responsible for basal and PGE2-induced C/EBP{delta} expression (12). Although basal C/EBP{beta} expression in osteoblasts is relatively low, PGE2 or any hormone, such as PTH, or agent, such as forskolin, that elevates cAMP levels and activates PKA rapidly induces its expression.

A novel role for C/EBP{beta} in the regulation of cell survival recently has been suggested. In hepatic stellate cells, oxidative stress activates ribosomal protein S-6 kinase, which can phosphorylate C/EBP{beta} on threonine 217, creating a functional so-called XEXD caspase substrate inhibitory box (42, 43). This evidence shows a direct link between C/EBP{beta} threonine 217 phosphorylation and an association with procaspase-1 and -8, which inhibits apoptosis. Therefore, C/EBP{beta} may have profound effects on cell survival as well as gene transcription.

Our study identified two Fra-2-dependent CREs in the C/EBP{beta} gene promoter and showed that they are responsible for PKA-dependent activation by PGE2 in osteoblasts. These elements were originally identified as CREB-binding elements in hepatocytes, whereas more recent studies indicate a potential auto-regulatory role for C/EBP{beta} through the more upstream binding sequence that we designated as CRE1 (17, 18). However, we found no CREB, C/EBP{beta}, or C/EBP{delta} binding to either CRE in PGE2-treated osteoblasts by EMSA. Moreover, when we transfected osteoblasts to over-express CREB in combination with the C/EBP{beta} promoter, we did not detect an increase in reporter gene expression.2 It is important to note that the increase in C/EBP{beta} expression in IL-6-activated hepatocytes is also thought to occur through these CREs, where the formation of a complex containing activated STAT3 is tethered to an unidentified 68-kDa protein that associates with each of these elements (19). Therefore, multiple observations, including our current findings, show the importance of both CREs in the activation of C/EBP{beta} gene expression in cells from several tissue sources, albeit through different trans-acting proteins.

In PGE2-activated osteoblasts, Fra-2 binds directly to these CREs in the C/EBP{beta} promoter. The increase in C/EBP{beta} gene expression by PGE2 required PKA activation and ongoing protein synthesis, consistent with the low level of Fra-2 in unstimulated osteoblasts and its rapid induction by PGE2. Overexpression of full-length Fra-2 further enhanced C/EBP{beta} promoter activity in osteoblasts activated with PGE2, whereas truncated, dominant negative Fra-2 severely suppressed this response. These gain- and loss-of-function effects confirm an important if not unique role for Fra-2 in the induction of C/EBP{beta} expression in differentiating osteoblasts. Furthermore, the activation domain of Fra-2 has several known phosphorylation sites (4447). Therefore, post-translational kinase-dependent modification may play an important role in Fra-2-dependent C/EBP{beta} activation in osteoblasts, which will be the subject of our future studies.

The protein sequence predicted from the rat Fra-2 cDNA that we cloned retains 95.4% homology to human Fra-2 and 99% homology to the published rat Fra-2 nucleotide sequence (GenBankTM accession numbers NM_005253 [GenBank] and NM_012954 [GenBank] , respectively). However, a comparison among the various Fra-2 sequences available shows that in four of five instances, amino acids predicted by our sequence that differ with the previously reported rat Fra-2 sequence are identical to those that occur in human Fra-2. Thus, some differences may relate to species, strain, or tissue variability. The sequence that we derived from rat osteoblast cDNA has been deposited in GenBankTM (accession no. AY622611 [GenBank] ).

Analogous to the C/EBPs, CREB, the ATFs, and Ap-1 factors c-Fos and c-Jun, Fra-2 is a member of the bZip (basic leucine zipper) family of transcription factors. Each member of this protein family appears to function as a dimer and can form homodimers or heterodimers with other select family members (1). Polyclonal anti-Fra-2 antibody modified nuclear protein binding to the CREs found in the C/EBP{beta} promoter by EMSA, but we did not detect C/EBP{delta}, C/EBP{beta}, CREB, ATF-2, or JunD in the gel shift complex using specific antibodies and similar methods.2 Unlike the C/EBPs, the transactivation domain of Fra-2 occurs in the carboxyl-terminal region, which contains potential phosphorylation sites, whereas its leucine zipper dimerization domain is centrally located, and its DNA binding domain resides in the amino-terminal region (41, 4850). Therefore, this dissimilar organization of Fra-2 protein structure, at least by comparison with the C/EBPs (51, 52), suggests that it may have a restricted pattern of functional binding partners (50, 53, 54). Additional studies will be necessary to determine whether Fra-2 acts as a homodimeric transactivator of C/EBP{beta} gene expression in osteoblasts or to identify other potential binding partners for Fra-2 in this context.

Expression of Fra-2 during mouse embryonic development reveals temporal and spatial variations. It appears late in organogenesis where it occurs in developing cartilage, including the bony and cartilaginous sides of the growth plate, mandibles, and ribs and in the central nervous system (55). Differentiated osteoblasts express Fra-2, and experiments with Fra-2 antisense reveal significant suppression of the differentiated osteoblast phenotype and a diminished bone tissue-like organization in Fra-2 antisense-treated cell cultures (38). As we saw with PGE2 in primary rat osteoblasts, PTH stimulates Fra-2 expression in the murine preosteoblastic cell line MC3T3-E1 (40). PTH alters the expression of many downstream genes in osteoblasts (56). These effects, which may vary with regard to concentration and duration of PTH treatment, involve multiple signal pathways (11, 36, 57) analogous to several activators of PKA in other tissue-derived cells (58). Moreover, transforming growth factor-{beta}, fibroblast growth factor-2, and mechanical loading also regulate Fra-2-dependent gene expression in vivo or in vitro in bone or bone cells models (39, 5961).

Recent in vivo studies supports these in vitro observations in osteoblasts, indicating that Fra-2 may have a significant effect on the developing or remodeling skeleton (32). Over-expression of Fra-2 in mice increased the bone volume and bone formation rate, even in the absence of changes in osteoblast number. In the opposite situation, animals lacking a functional Fra-2 gene exhibited growth retardation, severe osteoporosis, and perinatal death. Osteoblast number was also unaffected in Fra-2-deficient mice, but osteoclast number and size were increased. Even so, fewer osteocalcin-expressing osteoblasts occurred in Fra-2-deficient animals. This is consistent with the view that osteocalcin is a target gene for C/EBP{beta} and that loss of Fra-2 would consequently lower the expression of C/EBP{beta} or its induction by hormones such as PGE2 and PTH that effect bone remodeling.

In summary, our current studies reveal that C/EBP{beta} gene expression in osteoblasts is regulated by activation of PKA through two CREs that occur within a downstream region of the C/EBP{beta} gene promoter and that associate with newly synthesized transcription factor Fra-2. These results, in combination with our earlier studies revealing Runx-2-dependent expression of C/EBP{delta}, continue to define the complex molecular events (modeled in Fig. 7) that consequently control hormone-dependent changes in expression of the important bone growth factor, IGF-I.



View larger version (53K):
[in this window]
[in a new window]
 
FIG. 7.
PKA-dependent control of IGF-I gene expression in osteoblasts. A, osteoblasts exposed to hormones such as PGE2 and PTH, having receptors that couple to adenylate cyclase, increase cAMP synthesis and enhance PKA activity, in turn increasing IGF-I mRNA transcription through a C/EBP-sensitive element in exon I within the IGF-I gene. B, previous studies showed that this occurs in part through a translation-independent effect on the activation of pre-existing C/EBP{delta} and C/EBP{beta} (central bifurcated arrow) (3, 5) and through a Runx-2-dependent transcriptional effect on new C/EBP{delta} gene expression (left column) (12). Studies in this report demonstrate a parallel Fra-2-dependent transcriptional effect on C/EBP{beta} gene expression (right column) revealing complex re-enforcing effects on IGF-I synthesis through increases in both C/EBP expression and activity. The question mark indicates a current gap in our knowledge about the molecular events that control Fra-2 synthesis.

 

    FOOTNOTES
 
* This study was supported by Public Health Service Grants DK56310 and AR39201. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EBI Data Bank with accession number(s) AY622611 [GenBank] . Back

{ddagger} To whom correspondence should be addressed: Dept. of Surgery, Yale University School of Medicine, P. O. Box 208041, New Haven, CT 06520-8041. Tel.: 203-785-4927; Fax: 203-785-5714; E-mail: thomas.mccarthy{at}yale.edu.

1 The abbreviations used are: C/EBP, CCAAT/enhancer-binding protein; PGE2, prostaglandin E2; EMSA, electrophoretic mobility shift assay; CRE, cAMP-responsive element; CREB, cAMP-response element-binding protein; IGF, insulin-like growth factor; IGFBP, insulin-like growth factor-binding protein; IL-6, interleukin-6; PTH, parathyroid hormone; Fra-2, Fos-related antigen 2; PKA, protein kinase A; PKC, protein kinase C; STAT, signal transducers and activators of transcription; ATF, activating transcription factor. Back

2 W. Chang, A. Rewari, M. Centrella, and T. L. McCarthy, unpublished studies. Back


    ACKNOWLEDGMENTS
 
We thank Dr. Peter. F. Johnson (National Cancer Institute, Frederick, MD) for some of the C/EBP{beta} promoter reporter plasmids, Dr. G. Stanley McKnight (University of Washington, Seattle) for the PKA regulatory mutant expression plasmid, and Dr. Peter J. Parker (Imperial Cancer Research Fund, London) for the PKC dominant negative expression plasmid used in our studies.



    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Wedel, A., and Ziegler-Heitbrock, H. W. (1995) Immunobiology 193, 171–185[Medline] [Order article via Infotrieve]
  2. Ramji, D. P., and Foka, P. (2002) Biochem. J. 365, 561–575[Medline] [Order article via Infotrieve]
  3. McCarthy, T. L., Ji, C., Chen, Y., Kim, K., and Centrella, M. (2000) Endocrinology 141, 127–137[Abstract/Free Full Text]
  4. Umayahara, Y., Ji, C., Centrella, M., Rotwein, P., and McCarthy, T. L. (1997) J. Biol. Chem. 272, 31793–31800[Abstract/Free Full Text]
  5. Billiard, J., Umayahara, Y., Wiren, K., Centrella, M., McCarthy, T. L., and Rotwein, P. (2001) J. Biol. Chem. 276, 15354–15361[Abstract/Free Full Text]
  6. Ji, C., Chen, Y., Centrella, M., and McCarthy, T. L. (1999) Endocrinology 140, 4564–4572[Abstract/Free Full Text]
  7. Galien, R., Evans, H. F., and Garcia, T. (1996) Mol. Endocrinol. 10, 713–722[Abstract/Free Full Text]
  8. Gutierrez, S., Javed, A., Tennant, D. K., van Rees, M., Montecino, M., Stein, G. S., Stein, J. L., and Lian, J. B. (2002) J. Biol. Chem. 277, 1316–1323[Abstract/Free Full Text]
  9. Harrison, J. R., Kelly, P. L., and Pilbeam, C. C. (2000) J. Bone Miner Res. 15, 1138–1146[CrossRef][Medline] [Order article via Infotrieve]
  10. Karsenty, G. (2000) Semin Cell Dev. Biol. 11, 343–346[CrossRef][Medline] [Order article via Infotrieve]
  11. Franceschi, R. T., and Xiao, G. (2003) J. Cell. Biochem. 88, 446–454[CrossRef][Medline] [Order article via Infotrieve]
  12. McCarthy, T. L., Ji, C., Chen, Y., Kim, K. K., Imagawa, M., Ito, Y., and Centrella, M. (2000) J. Biol. Chem. 275, 21746–21753[Abstract/Free Full Text]
  13. Yamada, T., Tobita, K., Osada, S., Nishihara, T., and Imagawa, M. (1997) J. Biochem. (Tokyo) 121, 731–738[Abstract/Free Full Text]
  14. Cantwell, C. A., Sterneck, E., and Johnson, P. F. (1998) Mol. Cell. Biol. 18, 2108–2117[Abstract/Free Full Text]
  15. Yamada, T., Tsuchiya, T., Osada, S., Nishihara, T., and Imagawa, M. (1998) Biochem. Biophys. Res. Commun. 242, 88–92[CrossRef][Medline] [Order article via Infotrieve]
  16. Tanabe, A., Kumahara, C., Osada, S., Nishihara, T., and Imagawa, M. (2000) Biol. Pharm. Bull. 23, 1424–1429[Medline] [Order article via Infotrieve]
  17. Niehof, M., Manns, M., and Trautwein, C. (1997) Mol. Cell. Biol. 17, 3600–3613[Abstract]
  18. Niehof, M., Kubicka, S., Zender, L., Manns, M. P., and Trautwein, C. (2001) J. Mol. Biol. 309, 855–868[CrossRef][Medline] [Order article via Infotrieve]
  19. Niehof, M., Streetz, K., Rakemann, T., Bischoff, S. C., Manns, M. P., Horn, F., and Trautwein, C. (2001) J. Biol. Chem. 276, 9016–9027[Abstract/Free Full Text]
  20. McCarthy, T. L., Centrella, M., and Canalis, E. (1988) J. Bone Miner Res. 3, 401–408[Medline] [Order article via Infotrieve]
  21. Centrella, M., Canalis, E., McCarthy, T. L., Stewart, A. F., Orloff, J. J., and Insogna, K. L. (1989) Endocrinology 125, 199–208[Abstract/Free Full Text]
  22. Ji, C., Casinghino, S., Chang, D. J., Chen, Y., Javed, A., Ito, Y., Hiebert, S. W., Lian, J. B., Stein, G. S., McCarthy, T. L., and Centrella, M. (1998) J. Cell. Biochem. 69, 353–363[CrossRef][Medline] [Order article via Infotrieve]
  23. Centrella, M., McCarthy, T. L., and Canalis, E. (1987) J. Biol. Chem. 262, 2869–2874[Abstract/Free Full Text]
  24. Centrella, M., Casinghino, S., and McCarthy, T. L. (1994) Endocrinology 135, 1611–1620[Abstract]
  25. Centrella, M., Casinghino, S., Kim, J., Pham, T., Rosen, V., Wozney, J., and McCarthy, T. L. (1995) Mol. Cell. Biol. 15, 3273–3281[Abstract]
  26. Centrella, M., Casinghino, S., Gundberg, C., McCarthy, T. L., Wozney, J., and Rosen, V. (1996) Ann. N. Y. Acad. Sci. 785, 224–226[Medline] [Order article via Infotrieve]
  27. Carpenter, T. O., Moltz, K. C., Ellis, B., Andreoli, M., McCarthy, T. L., Centrella, M., Bryan, D., and Gundberg, C. M. (1998) Endocrinology 139, 35–43[Abstract/Free Full Text]
  28. Ji, C., Casinghino, S., McCarthy, T. L., and Centrella, M. (1997) J. Biol. Chem. 272, 21260–21267[Abstract/Free Full Text]
  29. Williams, S. C., Cantwell, C. A., and Johnson, P. F. (1991) Genes Dev. 5, 1553–1567[Abstract/Free Full Text]
  30. Chomczynski, P., and Sacchi, N. (1987) Anal. Biochem. 162, 156–159[Medline] [Order article via Infotrieve]
  31. Lee, K. A., Bindereif, A., and Green, M. R. (1988) Gene Anal. Tech. 5, 22–31[CrossRef][Medline] [Order article via Infotrieve]
  32. Schilling, A. F., Priemel, M., Amling, M., and Wagner, E. F. (2003) J. Bone Min. Res. 18, Suppl. 2, S3 (Abstr. 1006)[CrossRef]
  33. McCarthy, T. L., Chang, W.-Z., Liu, Y., Centrella, M. (2003) J. Biol. Chem. 278, 43121–43129[Abstract/Free Full Text]
  34. McCarthy, T. L., Thomas, M. J., Centrella, M., and Rotwein, P. (1995) Endocrinology 136, 3901–3908[Abstract]
  35. Schonwasser, D. C., Marais, R. M., Marshall, C. J., and Parker, P. J. (1998) Mol. Cell. Biol. 18, 790–798[Abstract/Free Full Text]
  36. Swarthout, J. T., D'Alonzo, R. C., Selvamurugan, N., and Partridge, N. C. (2002) Gene 282, 1–17[Medline] [Order article via Infotrieve]
  37. McCabe, L. R., Kockx, M., Lian, J., Stein, J., and Stein, G. (1995) Exp. Cell Res. 218, 255–262[CrossRef][Medline] [Order article via Infotrieve]
  38. McCabe, L. R., Banerjee, C., Kundu, R., Harrison, R. J., Dobner, P. R., Stein, J. L., Lian, J. B., and Stein, G. S. (1996) Endocrinology 137, 4398–4408[Abstract]
  39. Banerjee, C., Stein, J. L., Van Wijnen, A. J., Frenkel, B., Lian, J. B., and Stein, G. S. (1996) Endocrinology 137, 1991–2000[Abstract]
  40. McCauley, L. K., Koh-Paige, A. J., Chen, H., Chen, C., Ontiveros, C., Irwin, R., and McCabe, L. R. (2001) Endocrinology 142, 1975–1981[Abstract/Free Full Text]
  41. Smith, M., Burke, Z., Humphries, A., Wells, T., Klein, D., Carter, D., and Baler, R. (2001) Mol. Cell. Biol. 21, 3704–3713[Abstract/Free Full Text]
  42. Buck, M., Poli, V., Hunter, T., and Chojkier, M. (2001) Mol. Cell 8, 807–816[CrossRef][Medline] [Order article via Infotrieve]
  43. Buck, M., and Chojkier, M. (2003) Hepatology 37, 731–738[CrossRef][Medline] [Order article via Infotrieve]
  44. Yoshida, T., Sato, H., and Iba, H. (1991) Biochem. Biophys. Res. Commun. 174, 934–939[CrossRef][Medline] [Order article via Infotrieve]
  45. Gruda, M. C., Kovary, K., Metz, R., and Bravo, R. (1994) Oncogene 9, 2537–2547[Medline] [Order article via Infotrieve]
  46. Murakami, M., Sonobe, M. H., Ui, M., Kabuyama, Y., Watanabe, H., Wada, T., Handa, H., and Iba, H. (1997) Oncogene 14, 2435–2444[CrossRef][Medline] [Order article via Infotrieve]
  47. Murakami, M., Ui, M., and Iba, H. (1999) Cell Growth & Differ. 10, 333–342[Abstract/Free Full Text]
  48. Nishina, H., Sato, H., Suzuki, T., Sato, M., and Iba, H. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 3619–3623[Abstract/Free Full Text]
  49. Foletta, V. C., Sonobe, M. H., Suzuki, T., Endo, T., Iba, H., and Cohen, D. R. (1994) Oncogene 9, 3305–3311[Medline] [Order article via Infotrieve]
  50. Foletta, V. C. (1996) Immunol. Cell Biol. 74, 121–133[Medline] [Order article via Infotrieve]
  51. Friedman, A. D., and McKnight, S. L. (1990) Genes Dev. 4, 1416–1426[Abstract/Free Full Text]
  52. Ji, C., Chang, W., Centrella, M., and McCarthy, T. L. (2003) Mol. Endocrinol. 17, 1834–1843[Abstract/Free Full Text]
  53. Chinenov, Y., and Kerppola, T. K. (2001) Oncogene 20, 2438–2452[CrossRef][Medline] [Order article via Infotrieve]
  54. van Dam, H., and Castellazzi, M. (2001) Oncogene 20, 2453–2464[CrossRef][Medline] [Order article via Infotrieve]
  55. Carrasco, D., and Bravo, R. (1995) Oncogene 10, 1069–1079[Medline] [Order article via Infotrieve]
  56. Qin, L., Qiu, P., Wang, L., Li, X., Swarthout, J. T., Soteropoulos, P., Tolias, P., and Partridge, N. C. (2003) J. Biol. Chem. 278, 19723–19731[Abstract/Free Full Text]
  57. Franceschi, R. T., Xiao, G., Jiang, D., Gopalakrishnan, R., Yang, S., and Reith, E. (2003) Connect. Tissue Res. 44, Suppl. 1, 109–116[Medline] [Order article via Infotrieve]
  58. Tierney, E. P., Tulac, S., Huang, S.-T. J., and Giudice, L. C. (2003) Physiol. Genomics 16, 47–66[Abstract/Free Full Text]
  59. Varghese, S., Rydziel, S., and Canalis, E. (2000) Endocrinology 141, 2185–2191[Abstract/Free Full Text]
  60. Lewinson, D., Rachmiel, A., Rihani-Bisharat, S., Kraiem, Z., Schenzer, P., Korem, S., and Rabinovich, Y. (2003) J. Histochem. Cytochem. 51, 1161–1168[Abstract/Free Full Text]
  61. Granet, C., Vico, A. G., Alexandre, C., and Lafage-Proust, M. H. (2002) Cell. Signal. 14, 679–688[CrossRef][Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Immunol.Home page
J. A. Meyers, D. W. Su, and A. Lerner
Chronic Lymphocytic Leukemia and B and T Cells Differ in Their Response to Cyclic Nucleotide Phosphodiesterase Inhibitors
J. Immunol., May 1, 2009; 182(9): 5400 - 5411.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. L. McCarthy, R. B. Hochberg, D. C. Labaree, and M. Centrella
3-Ketosteroid Reductase Activity and Expression by Fetal Rat Osteoblasts
J. Biol. Chem., November 23, 2007; 282(47): 34003 - 34012.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
T. L. McCarthy, T. H. Pham, B. I. Knoll, and M. Centrella
Prostaglandin E2 Increases Transforming Growth Factor-{beta} Type III Receptor Expression through CCAAT Enhancer-Binding Protein {delta} in Osteoblasts
Mol. Endocrinol., November 1, 2007; 21(11): 2713 - 2724.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
M. Yamaguchi, N. Ogata, Y. Shinoda, T. Akune, S. Kamekura, Y. Terauchi, T. Kadowaki, K. Hoshi, U.-I. Chung, K. Nakamura, et al.
Insulin Receptor Substrate-1 Is Required for Bone Anabolic Function of Parathyroid Hormone in Mice
Endocrinology, June 1, 2005; 146(6): 2620 - 2628.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
279/41/42438    most recent
M405549200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chang, W.
Right arrow Articles by McCarthy, T. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chang, W.
Right arrow Articles by McCarthy, T. L.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2004 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement