|
Advertisement | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
J. Biol. Chem., Vol. 279, Issue 41, 42438-42444, October 8, 2004
Fos-related Antigen 2 Controls Protein Kinase A-induced CCAAT/Enhancer-binding Protein
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| ABSTRACT |
|---|
|
|
|---|
(C/EBP
) plays an important role in hormone-dependent gene expression. In osteoblasts C/EBP
can increase insulin-like growth factor I (IGF-I) transcription following treatment with hormones that activate protein kinase A, but little is known as yet about the expression of C/EBP
itself in these cells. We initially showed that prostaglandin E2 (PGE2) rapidly enhances C/EBP
mRNA and protein expression, and in this study we identified a 3'-proximal region of the C/EBP
promoter containing a 541-bp upstream sequence that could account for this effect. PGE2-dependent activation of C/EBP
was blocked by expression of a mutated regulatory subunit of protein kinase A or by mutation of two previously identified cAMP-sensitive cis-acting regulatory elements within the promoter between bp 111 and 61. Nuclear protein binding to these elements was induced by PGE2, required new protein synthesis, and was sensitive to antibody to the transcription factor termed Fos-related antigen 2 (Fra-2). Fra-2 cDNA generated from rat osteoblasts by reverse transcriptase PCR was 95% homologous to human Fra-2, and PGE2 rapidly induced Fra-2 mRNA and protein expression. Consistent with these findings, over-expression of Fra-2 significantly increased C/EBP
promoter activity in PGE2-induced osteoblasts, whereas expression of Fra-2 lacking its activation domain had a dominant negative inhibitory effect. Together, these results reveal a significant, hormone-dependent role for Fra-2 in osteoblast function, both directly, through its ability to increase new C/EBP
gene expression, and indirectly, through downstream C/EBP sensitive genes. | INTRODUCTION |
|---|
|
|
|---|
, -
, -
, -
, and -
(1, 2). Individual C/EBPs can form homodimers or heterodimers and share common DNA binding response elements, consistent with the high degree of homology in their carboxyl termini where their dimerization and DNA binding domains reside. Of these, basal expression of C/EBP
is high in liver, intestines, differentiating adipocytes, lung, kidney, and spleen, as well as in monocytic blood cells. However, basal expression of C/EBP
is relatively low in osteoblasts, but it can be enhanced by treatment with glucocorticoid, PGE2, or 1,25(OH)2 vitamin D3 (35).2
Because the various C/EBPs are widely expressed, it is no surprise that they direct the synthesis of a large panel of target genes. In osteoblasts either C/EBP
or C/EBP
, which are variably expressed in several osteoblastic cell models, can in turn activate the expression of several prominent downstream genes, including those encoding IGF-I, IGFBP-5, IL-6, osteocalcin, and cyclooxygenase 2 (4, 69).
Earlier we reported that Runx2, a transcription factor essential for osteogenesis (10, 11), is an important, direct regulator of C/EBP
expression in osteoblasts, by way of a Runx binding sequence located between bp 165 to 159 in the C/EBP
gene promoter (12). Moreover, through an apparent negative feedback inhibition, the carboxyl-terminal region of C/EBP
can bind directly to Runx2 and in this way self-limit C/EBP
expression and activity. Others have reported roles for STAT3, Sp1, and C/EBP
itself in the regulation of C/EBP
expression in other cell models (1316). By contrast, molecular mediators that direct C/EBP
gene expression have been better established in nonskeletal tissue-derived cells. For example, studies in hepatocytes defined two cAMP-responsive elements (CREs) that are located between bp 121 and 71 in the C/EBP
promoter and can interact with CREB and C/EBP
to drive C/EBP
gene expression. In those cells, lipopolysaccharide increases C/EBP
expression through shared or distinct elements that require c-Jun and ATF-2, whereas IL-6-dependent induction of C/EBP
involves an indirect association of STAT3 to these CRE sequences (1719).
Importantly, agents or events associated with trauma, inflammation, and the acute phase response have critical effects on C/EBP
synthesis, perhaps to assist the expression of downstream genes associated with recovery and tissue repair (1, 2). In osteoblasts, we earlier reported an increase in C/EBP
expression in response to PGE2 (3). In the current study, we have characterized the molecular mediators that can account for this effect. We demonstrate the relative importance of a specific protein kinase system and the two previously identified cis-acting CREs that drive new C/EBP
synthesis. Finally, we show that one trans-acting transcription factor that can control this event in differentiating osteoblasts is distinct from those factors characterized previously in other cell types, predicting a novel control mechanism that may be tissue or context specific.
| EXPERIMENTAL PROCEDURES |
|---|
|
|
|---|
, bone morphogenetic protein-2, and various prostaglandins and form mineralized nodules in vitro (2328). Cells were plated at 4,000/cm2 in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum. COS-7 cells (CRL 1651) from the ATCC were cultured in identical medium. Hormone treatments were performed in serum-free medium.
PlasmidsC/EBP
promoter constructs, prepared from a
library of genomic rat DNA, were based on earlier reported sequence information (Ref. 29 and GenBankTM accession no. AY056052
[GenBank]
). Mutations were created in two previously described CREs within the C/EBP
promoter (17) by overlap PCR and mutated oligomer primer pairs. The primers used to mutate CRE1 were: CRE1µ forward, 5'-CGCGGCCGGGCAATGGTTCGCACCGACCCGG-3'; and CRE1µ reverse, 5'-CGCCGGGTCGGTGCGAACCATTGCCCGGCCG-3'. Primers used to mutate CRE2 were: CRE2µ forward, 5'-GGGAGGGGCCCCGGCGGATCCCAGCCCGTTGCCAGG-3'; and CRE2µ reverse, 5'-CGCCTGGCAACGGGCTGGGATCCGCCGGGGCCCCT-3' (mutated nucleotides are indicated by bold underlined italics). A Fos-related antigen 2 (Fra-2) expression plasmid was prepared from total rat RNA using the C.therm. Polymerase One-step RT-PCR System (Roche Applied Science) with forward primer GAGAATTCGGGAAATGTACCAGGATTATCCCGGG and reverse primer GCTCTAGATTACAGAGCCAGCAGAGTGGGG based on rat Fra-2 sequence information in GenBankTM (accession no. NM_012954
[GenBank]
), utilizing the EcoRI and XbaI restriction sites (underlined) for directional cloning. An expression plasmid encoding dominant negative Fra-2 was produced from this construct by reverse transcriptase PCR to delete amino acids 208328, comprising its transactivation domain.
TransfectionsPromoter-reporter constructs, gene expression plasmids, or empty parental vectors were pre-titrated for optimal expression efficiency and transfected with reagent TransIT LT1 (Mirus). Cells at 5070% culture confluence (25,00030,000/cm2) were exposed to an optimal amount of expression plasmid (1020 ng/cm2) or reporter plasmid (50 ng/cm2) in medium supplemented with 0.8% fetal bovine serum for 16 h and then supplemented to obtain a final concentration of 5% serum. Cells were cultured for 48 h, treated as indicated in each figure in serum-free medium, rinsed, and lysed. Nuclear-free supernatants were analyzed for reporter gene activity and corrected for protein content. To account for competition among plasmids for limiting transcription components, control cells were transfected with a compensating amount of empty vector. Transfection efficiency was assessed in parallel with positive and negative reporter plasmids as described previously (28).
RNA AnalysisTotal RNA was extracted with acid-guanidine-monothiocyanate, precipitated with isopropyl alcohol, and dissolved in sterile water (30). mRNA levels were assessed by Northern blot analysis using 10 µg of RNA denatured in formaldehyde/formamide. Co-electrophoresed RNA standards were used to verify transcript size. Restriction fragments including cDNA inserts encoding rat C/EBP
or rat Fra-2 were isolated by agarose gel electrophoresis and a QIAquick gel extraction kit (Qiagen Corp.) were labeled with [
-32P]dCTP and [
-32P]dTTP by random hexanucleotide-primed second strand synthesis to use as Northern blot probes. Post-hybridization stringency wash was with 0.2x SSC and 0.1% SDS for 1 h at 55 °C. In some instances, after hybridization and autoradiography, primary probes were stripped, and the blots were re-hybridized with a 32P-labeled 18 S rRNA probe of 80 nucleotides, prepared with the T7 MEGAshortscript kit (Ambion) to assess equal RNA loading and blotting. In other instances, rRNA levels were assessed by staining with ethidium.
Nuclear ExtractsCells were rinsed, harvested, and lysed in a hypotonic buffer supplemented with phosphatase and protease inhibitors and 1% Triton X-100. Nuclei were collected and resuspended in hypertonic buffer with phosphatase and protease inhibitors, and soluble nuclear proteins released after 30 min of extraction were collected by centrifugation as described (3, 31, 33).
Electrophoretic Mobility Shift Assay (EMSA)Oligomers used in EMSA were: HS3D, 5'-GAGCAGATAGAGCCTGCGCAATCGAAATAAAGTC-3'; CRE1, 5'-CGCGGCCGGGCAATGACGCGCACCGACCCGGCG-3'; and CRE2, 5'-GGGAGGGGCCCCGGCGTGACGCAGCCCGTTGCCAGGCG-3' (bold underlined nucleotides correspond to factor-specific binding sequences). Oligomers for mutant CRE1 (CRE1µ, 5'-CGCGGCCGGGCAATGGTTCGCACCGACCCGGCG-3') and mutant CRE2 (CRE2µ, 5'-GGGAGGGGCCCCGGCGGATCCCAGCCCGTTGCCAGGCG-3') (mutated nucleotides indicated by bold underlined italics) were based on previous studies by Niehof et al. (17). Complementary strands were synthesized and hybridized to their respective partners to prepare 32P-labeled oligomers for EMSA by filling the overhanging single strand regions with dNTPs and [
-32P]dCTP with the Klenow fragment of DNA polymerase I. Three µg of nuclear protein was preincubated with 2 µg of poly(dI:dC), without or with unlabeled specific or nonspecific competitor DNAs or antibody preparations (Santa Cruz Biotechnologies), supplemented with 5 x 104 cpm of probe (0.1 to 0.2 ng) and fractionated through a 5% nondenaturing polyacrylamide gel. Radioactive bands were visualized by autoradiography (3, 31, 33).
Western ImmunoblotsTotal cell or nuclear extracts were fractionated through SDS-PAGE and electroblotted onto PolyScreen polyvinylidene difluoride transfer membrane (PerkinElmer Life Sciences) with pre-stained molecular weight markers. Blots were blocked in 5% fat-free powdered milk and probed with specific primary antibodies (Santa Cruz Biotechnologies), and reactive bands were visualized with secondary antibody linked to horseradish peroxidase and chemiluminescence (Western Lightning, PerkinElmer Life Sciences) (3, 33).
StatisticsStatistical differences in biochemical assays were assessed by one-way analysis of variance and Student-Newman-Keuls post hoc analysis, using SigmaStat software (Jandel Corp.), from a total of nine or more replicate samples from three or more studies each performed with different cell preparations. A significant difference was assumed by a p value of <0.05.
| RESULTS |
|---|
|
|
|---|
ExpressionWe previously showed that C/EBP is an important regulator of IGF-I expression in PKA-activated osteoblasts, by way of a single high affinity C/EBP binding half-site located within exon 1, a transcribed, noncoding, and highly conserved region of the IGF-I gene. C/EBP
is the principal endogenous C/EBP in unstimulated osteoblasts (4). Close examination of in vitro binding using the IGF-I promoter derived C/EBP binding element, designated HS3D, and nuclear extract from PGE2-activated osteoblasts, showed two prominent complexes and suggested the presence of multiple proteins. As shown in Fig. 1A, antibodies to either C/EBP
or C/EBP
each effectively reduced protein binding to this element. The upper gel shift complex that occurred with extract from PGE2-activated osteoblasts was primarily sensitive to anti-C/EBP
antibody, whereas both complexes were reduced by anti-C/EBP
antibody, consistent with the importance of heterodimers containing both C/EBP isoforms. Treatment with PGE2 rapidly elevated the levels of C/EBP
mRNA and protein. A large increase in C/EBP
mRNA occurred within 1 h of treatment, peaked at 2 h, and declined but remained significantly elevated for at least 24 h (Fig. 1B). By Western immunoblot analysis, a maximal increase in C/EBP
protein in total osteoblast extract was achieved by 4 h of PGE2 treatment (Fig. 1C).
|
PromoterTo locate regulatory elements utilized by osteoblasts after PGE2 activation, cells were transfected with reporter plasmids encoding progressive C/EBP
promoter truncations. The C/EBP
promoter fragments shared a common 3'-end at bp +54 but terminated at bp 2700, 1300, or 541 at their 5'-ends. As shown in Fig. 2A, gene expression through each fragment was significantly induced by 6 h of treatment with PGE2. Earlier evidence from studies with hepatocytes showed two important cAMP-sensitive elements downstream of bp 541, located between bp 111 and 61 (17), allowing us to focus our effort more precisely. Indeed, we found that mutation of either or both of these elements within the context of the 541 upstream segment significantly reduced basal C/EBP
promoter activity in osteoblasts and severely limited the stimulatory effect PGE2 by 7580%. To assess the kinase systems responsible for the stimulatory effect of PGE2, we co-transfected osteoblasts with the fully functional 541 C/EBP
promoter-reporter construct and either a mutant regulatory subunit of PKA that blocks its activation (PKAregµ) or a dominant negative PKC (PKCDN) that exerts broad-spectrum PKC isoform inhibition (34, 35). Expression of the mutant regulatory subunit of PKA completely blocked C/EBP
promoter activation, whereas expression of the PKCDN protein had no effect (Fig. 2B).
|
promoter, we performed EMSA with 32P-labeled oligonucleotides, designated CRE1 and CRE2, corresponding to each element. Nuclear extract from osteoblasts treated for 4 h with PGE2 caused inducible gel shift complexes with each element, and these complexes were competed by excess unlabeled homologous oligonucleotides but not by oligonucleotides in which the CRE1 binding sequences were mutated. Data are shown in Fig. 3A for [32P]CRE1 and unlabeled CREµ1(µ1), but analogous results occurred with [32P]CRE2 and mutated CREµ2. Unlabeled oligonucleotide HS3D, corresponding to the C/EBP binding element in the IGF-I gene (as described in Fig. 1A), did not compete for protein binding to either CRE probe even at a 100-fold molar excess, and neither anti-C/EBP
nor anti-C/EBP
antibody reduced complex formation (Fig. 3B). However, although oligonucleotides corresponding to consensus CREB binding sequences effectively competed for nuclear factor binding to these CREs (Fig. 3B), anti-CREB antibody did not alter complex formation (Fig. 3A). Therefore, these CREs appear to have an important effect on PKA-dependent C/EBP
expression in osteoblasts, and transcription factors other than C/EBP or CREB appear to associate with these elements after treatment with PGE2.
|
promoter through a PKA-dependent event, and we speculated that these CREs might bind AP-1-like factors based on their nucleotide sequences and previous evidence from studies in osteoblasts (36). Select AP-1 transcription factors are expressed during osteoblast differentiation (3740). Therefore we used a panel of antibodies to various AP-1-binding proteins, C/EBP
, C/EBP
, CREB (as shown in Fig. 3), ATF-2, and JunD.2 However, only antibodies specific to the transcription factor Fra-2 effectively modified binding to each of these elements. Again, analogous results occurred with oligonucleotides encoded by element CRE-1 and CRE-2, and data from results obtained using the oligonucleotide specific for CRE-1 are shown in Fig. 4A. Western immunoblot analysis showed that PGE2 induced a rapid accumulation of Fra-2 (Fig. 4B) that was completely blocked by co-treatment with the protein synthesis inhibitor cycloheximide (Fig. 4C). Using sequence information obtained from GenBankTM, we designed primers to synthesize full-length cDNA encoding rat Fra-2 by reverse transcriptase PCR from total osteoblast RNA. The rat Fra-2 sequence that we cloned was 95% homologous to human Fra-2. All sequence variations appeared to be minor, and the predicted gene products retained a protein sequence homology of 96% (Fig. 5). Using the rat Fra-2 cDNA as a probe, we then examined Fra-2 mRNA by Northern blot analysis. Fra-2 mRNA levels increased within 30 min of PGE2 treatment, peaked at 1 h, and remained elevated for at least 4 h (Fig. 4D).
|
|
Promoter Activity in PGE2-induced OsteoblastsWe produced expression plasmid constructs encoding full-length Fra-2 and a carboxyl-truncated dominant negative Fra-2 devoid of its carboxyl transactivation domain (41). The full-length and dominant negative Fra-2 were then co-transfected with either the fully active 541-bp C/EBP
promoter plasmid or that containing the mutated CRE1 and CRE2 elements. Full-length Fra-2 significantly enhanced PGE2-induced C/EBP
promoter activation in a concentration-dependent fashion (Fig. 6A), whereas dominant negative Fra-2 significantly reduced C/EBP
promoter activation by 50% (Fig. 6B). Consistent with the importance of these CREs for Fra-2 activity, full-length Fra-2 failed to enhance gene expression in cells co-transfected to express C/EBP
promoter that contained the CRE1/CRE2 mutations (Fig. 6A). The dominant negative expression construct encoding Fra-2 also suppressed basal C/EBP
gene promoter activity (Fig. 6B). This effect may be direct through other currently unidentified Fra-2 binding elements, or it may be indirect through the formation of inactive heterodimer complexes between other important trans-acting factors and the dominant negative Fra-2 protein. In either case, these results confirm that C/EBP
expression is transcriptionally activated by PGE2 through the CRE1 and CRE2 AP-1 binding elements and reveal the stimulatory effect at these sites by newly synthesized Fra-2 in PKA-activated osteoblasts.
|
| DISCUSSION |
|---|
|
|
|---|
and C/EBP
are important components in the development of the acute phase response and participate in the induction of many genes involved in tissue remodeling (1, 2). In osteoblasts, C/EBPs can activate the expression of several important gene products, including IGF-I, IGFBP-5, IL-6, osteocalcin, and cyclooxygenase 2 (4, 69). C/EBP
is the predominantly expressed C/EBP in unstimulated rat and human osteoblasts (4). In this regard, we earlier reported that Runx2, an essential transcription factor required for osteoblast differentiation, is responsible for basal and PGE2-induced C/EBP
expression (12). Although basal C/EBP
expression in osteoblasts is relatively low, PGE2 or any hormone, such as PTH, or agent, such as forskolin, that elevates cAMP levels and activates PKA rapidly induces its expression.
A novel role for C/EBP
in the regulation of cell survival recently has been suggested. In hepatic stellate cells, oxidative stress activates ribosomal protein S-6 kinase, which can phosphorylate C/EBP
on threonine 217, creating a functional so-called XEXD caspase substrate inhibitory box (42, 43). This evidence shows a direct link between C/EBP
threonine 217 phosphorylation and an association with procaspase-1 and -8, which inhibits apoptosis. Therefore, C/EBP
may have profound effects on cell survival as well as gene transcription.
Our study identified two Fra-2-dependent CREs in the C/EBP
gene promoter and showed that they are responsible for PKA-dependent activation by PGE2 in osteoblasts. These elements were originally identified as CREB-binding elements in hepatocytes, whereas more recent studies indicate a potential auto-regulatory role for C/EBP
through the more upstream binding sequence that we designated as CRE1 (17, 18). However, we found no CREB, C/EBP
, or C/EBP
binding to either CRE in PGE2-treated osteoblasts by EMSA. Moreover, when we transfected osteoblasts to over-express CREB in combination with the C/EBP
promoter, we did not detect an increase in reporter gene expression.2 It is important to note that the increase in C/EBP
expression in IL-6-activated hepatocytes is also thought to occur through these CREs, where the formation of a complex containing activated STAT3 is tethered to an unidentified 68-kDa protein that associates with each of these elements (19). Therefore, multiple observations, including our current findings, show the importance of both CREs in the activation of C/EBP
gene expression in cells from several tissue sources, albeit through different trans-acting proteins.
In PGE2-activated osteoblasts, Fra-2 binds directly to these CREs in the C/EBP
promoter. The increase in C/EBP
gene expression by PGE2 required PKA activation and ongoing protein synthesis, consistent with the low level of Fra-2 in unstimulated osteoblasts and its rapid induction by PGE2. Overexpression of full-length Fra-2 further enhanced C/EBP
promoter activity in osteoblasts activated with PGE2, whereas truncated, dominant negative Fra-2 severely suppressed this response. These gain- and loss-of-function effects confirm an important if not unique role for Fra-2 in the induction of C/EBP
expression in differentiating osteoblasts. Furthermore, the activation domain of Fra-2 has several known phosphorylation sites (4447). Therefore, post-translational kinase-dependent modification may play an important role in Fra-2-dependent C/EBP
activation in osteoblasts, which will be the subject of our future studies.
The protein sequence predicted from the rat Fra-2 cDNA that we cloned retains 95.4% homology to human Fra-2 and 99% homology to the published rat Fra-2 nucleotide sequence (GenBankTM accession numbers NM_005253 [GenBank] and NM_012954 [GenBank] , respectively). However, a comparison among the various Fra-2 sequences available shows that in four of five instances, amino acids predicted by our sequence that differ with the previously reported rat Fra-2 sequence are identical to those that occur in human Fra-2. Thus, some differences may relate to species, strain, or tissue variability. The sequence that we derived from rat osteoblast cDNA has been deposited in GenBankTM (accession no. AY622611 [GenBank] ).
Analogous to the C/EBPs, CREB, the ATFs, and Ap-1 factors c-Fos and c-Jun, Fra-2 is a member of the bZip (basic leucine zipper) family of transcription factors. Each member of this protein family appears to function as a dimer and can form homodimers or heterodimers with other select family members (1). Polyclonal anti-Fra-2 antibody modified nuclear protein binding to the CREs found in the C/EBP
promoter by EMSA, but we did not detect C/EBP
, C/EBP
, CREB, ATF-2, or JunD in the gel shift complex using specific antibodies and similar methods.2 Unlike the C/EBPs, the transactivation domain of Fra-2 occurs in the carboxyl-terminal region, which contains potential phosphorylation sites, whereas its leucine zipper dimerization domain is centrally located, and its DNA binding domain resides in the amino-terminal region (41, 4850). Therefore, this dissimilar organization of Fra-2 protein structure, at least by comparison with the C/EBPs (51, 52), suggests that it may have a restricted pattern of functional binding partners (50, 53, 54). Additional studies will be necessary to determine whether Fra-2 acts as a homodimeric transactivator of C/EBP
gene expression in osteoblasts or to identify other potential binding partners for Fra-2 in this context.
Expression of Fra-2 during mouse embryonic development reveals temporal and spatial variations. It appears late in organogenesis where it occurs in developing cartilage, including the bony and cartilaginous sides of the growth plate, mandibles, and ribs and in the central nervous system (55). Differentiated osteoblasts express Fra-2, and experiments with Fra-2 antisense reveal significant suppression of the differentiated osteoblast phenotype and a diminished bone tissue-like organization in Fra-2 antisense-treated cell cultures (38). As we saw with PGE2 in primary rat osteoblasts, PTH stimulates Fra-2 expression in the murine preosteoblastic cell line MC3T3-E1 (40). PTH alters the expression of many downstream genes in osteoblasts (56). These effects, which may vary with regard to concentration and duration of PTH treatment, involve multiple signal pathways (11, 36, 57) analogous to several activators of PKA in other tissue-derived cells (58). Moreover, transforming growth factor-
, fibroblast growth factor-2, and mechanical loading also regulate Fra-2-dependent gene expression in vivo or in vitro in bone or bone cells models (39, 5961).
Recent in vivo studies supports these in vitro observations in osteoblasts, indicating that Fra-2 may have a significant effect on the developing or remodeling skeleton (32). Over-expression of Fra-2 in mice increased the bone volume and bone formation rate, even in the absence of changes in osteoblast number. In the opposite situation, animals lacking a functional Fra-2 gene exhibited growth retardation, severe osteoporosis, and perinatal death. Osteoblast number was also unaffected in Fra-2-deficient mice, but osteoclast number and size were increased. Even so, fewer osteocalcin-expressing osteoblasts occurred in Fra-2-deficient animals. This is consistent with the view that osteocalcin is a target gene for C/EBP
and that loss of Fra-2 would consequently lower the expression of C/EBP
or its induction by hormones such as PGE2 and PTH that effect bone remodeling.
In summary, our current studies reveal that C/EBP
gene expression in osteoblasts is regulated by activation of PKA through two CREs that occur within a downstream region of the C/EBP
gene promoter and that associate with newly synthesized transcription factor Fra-2. These results, in combination with our earlier studies revealing Runx-2-dependent expression of C/EBP
, continue to define the complex molecular events (modeled in Fig. 7) that consequently control hormone-dependent changes in expression of the important bone growth factor, IGF-I.
|
| FOOTNOTES |
|---|
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EBI Data Bank with accession number(s) AY622611
[GenBank]
. ![]()
To whom correspondence should be addressed: Dept. of Surgery, Yale University School of Medicine, P. O. Box 208041, New Haven, CT 06520-8041. Tel.: 203-785-4927; Fax: 203-785-5714; E-mail: thomas.mccarthy{at}yale.edu.
1 The abbreviations used are: C/EBP, CCAAT/enhancer-binding protein; PGE2, prostaglandin E2; EMSA, electrophoretic mobility shift assay; CRE, cAMP-responsive element; CREB, cAMP-response element-binding protein; IGF, insulin-like growth factor; IGFBP, insulin-like growth factor-binding protein; IL-6, interleukin-6; PTH, parathyroid hormone; Fra-2, Fos-related antigen 2; PKA, protein kinase A; PKC, protein kinase C; STAT, signal transducers and activators of transcription; ATF, activating transcription factor. ![]()
2 W. Chang, A. Rewari, M. Centrella, and T. L. McCarthy, unpublished studies. ![]()
| ACKNOWLEDGMENTS |
|---|
promoter reporter plasmids, Dr. G. Stanley McKnight (University of Washington, Seattle) for the PKA regulatory mutant expression plasmid, and Dr. Peter J. Parker (Imperial Cancer Research Fund, London) for the PKC dominant negative expression plasmid used in our studies. | REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
J. A. Meyers, D. W. Su, and A. Lerner Chronic Lymphocytic Leukemia and B and T Cells Differ in Their Response to Cyclic Nucleotide Phosphodiesterase Inhibitors J. Immunol., May 1, 2009; 182(9): 5400 - 5411. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. L. McCarthy, R. B. Hochberg, D. C. Labaree, and M. Centrella 3-Ketosteroid Reductase Activity and Expression by Fetal Rat Osteoblasts J. Biol. Chem., November 23, 2007; 282(47): 34003 - 34012. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. L. McCarthy, T. H. Pham, B. I. Knoll, and M. Centrella Prostaglandin E2 Increases Transforming Growth Factor-{beta} Type III Receptor Expression through CCAAT Enhancer-Binding Protein {delta} in Osteoblasts Mol. Endocrinol., November 1, 2007; 21(11): 2713 - 2724. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Yamaguchi, N. Ogata, Y. Shinoda, T. Akune, S. Kamekura, Y. Terauchi, T. Kadowaki, K. Hoshi, U.-I. Chung, K. Nakamura, et al. Insulin Receptor Substrate-1 Is Required for Bone Anabolic Function of Parathyroid Hormone in Mice Endocrinology, June 1, 2005; 146(6): 2620 - 2628. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |