Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M402830200 on August 2, 2004

J. Biol. Chem., Vol. 279, Issue 41, 42552-42559, October 8, 2004
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
279/41/42552    most recent
M402830200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yang, T.
Right arrow Articles by Poovaiah, B. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yang, T.
Right arrow Articles by Poovaiah, B. W.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Calcium/Calmodulin Up-regulates a Cytoplasmic Receptor-like Kinase in Plants*

Tianbao Yang, Shubho Chaudhuri, Lihua Yang, Yanping Chen, and B. W. Poovaiah{ddagger}

From the Center for Integrated Biotechnology and Department of Horticulture, Washington State University, Pullman, Washington 99164-6414

Received for publication, March 12, 2004 , and in revised form, July 7, 2004.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Calcium/calmodulin-dependent kinases play an important role in protein phosphorylation in eukaryotes. However, not much is known about calcium/calmodulin-dependent protein phosphorylation and its role in signal transduction in plants. By using a protein-protein interaction-based approach, we have isolated a novel plant-specific calmodulin-binding receptor-like cytoplasmic kinase (CRCK1) from Arabidopsis thaliana, as well as its ortholog from Medicago sativa (alfalfa). CRCK1 does not show high homology to calcium/calmodulin-dependent protein kinases in animals. In contrast, it shows high homology in the kinase domain to serine/threonine receptor-like kinases in plants. However, it contains neither a transmembrane domain nor an extracellular domain. Calmodulin binds to CRCK1 in a calcium-dependent manner with an affinity of ~20.5 nM. The calmodulin-binding site in CRCK1 is located in amino acids 160–183, which overlap subdomain II of the kinase domain. CRCK1 undergoes autophosphorylation in the presence of Mg2+ at the threonine residue(s). The Km and Vmax values of CRCK1 for ATP are 1 µM and 33.6 pmol/mg/min, respectively. Calcium/calmodulin stimulates the kinase activity of CRCK1, which increases the Vmax of CRCK1 ~9-fold. The expression of CRCK1 is increased in response to stresses such as cold and salt and stress molecules such as abscisic acid and hydrogen peroxide. These results indicate the presence of a calcium/calmodulin-regulated receptor-like cytoplasmic kinase in plants. Furthermore, these results also suggest that calcium/calmodulin-regulated protein phosphorylation involving CRCK1 plays a role in stress signal transduction in plants.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Phosphorylation by protein kinase is one of the most common and important regulatory mechanisms in signal transduction in all organisms (1). Since the first plant protein kinase sequences were reported in 1989, more than 1,000 have been reported in GenBankTM. In particular, plants have a large number of receptor-like serine/threonine kinases (RLK)1 that resemble animal growth factor receptors, which can sense external signals and relay these signals by protein phosphorylation in plants (2–4). It is estimated that there are at least 600 RLK homologs, representing nearly 2.5% of the annotated protein-coding genes in Arabidopsis. Among them, 75% of the RLK family has a receptor configuration, with an extracellular domain, a transmembrane domain, and a kinase domain. These RLKs function in a wide range of signal response, such as BRI 1 for hormone perception (5, 6), SRK for pollen-pistil interaction (7), Xa21 for disease resistance (8), and CLAVATA1 for shoot apical meristem equilibrium (9). Approximately 25% of the RLK family are cytoplasmic RLKs, containing only a kinase domain, and are thus named receptor-like cytoplasmic kinases (RLCKs). During the last decade, a few plant RLCKs, such as Pto and PBS1, have been characterized. In tomato, Pto confers resistance to the pathogen Pseudomonas syringae strains expressing avrPto (10), and in Arabidopsis, PBS1 is required for specific resistance to P. syringae strains expressing avrPphB (11). However, the function of most plant RLCKs is not well understood.

Calcium is a universal second messenger and acts as a mediator of stimulus-response coupling in the regulation of plant growth, development, and responses to environmental stimuli (12–16). Various stimuli, such as cold, salt, abscisic acid (ABA), and hydrogen peroxide, trigger changes in the cytosolic calcium concentration (17–20), which can be recognized by calcium receptors. Calmodulin (CaM), a small acidic protein with four EF-hand motifs, is one of the best characterized calcium receptors in eukaryotes. Upon calcium binding to the EF hands, CaM undergoes conformational changes, and the active Ca2+-CaM complex regulates the activity of downstream target proteins (13, 16, 21, 22). Ca2+/CaM-dependent protein kinases (CaM kinases) are the best characterized CaM-binding proteins in mammals and are major players in Ca2+/CaM-mediated signal transduction (23). In plants, Ca2+/CaM-dependent protein phosphorylation was observed 2 decades ago (24). However, only two CaM-regulated kinases, which show overall homology to mammalian CaM kinases, have been reported to date, although there are a few other reported CaM-binding protein kinases (25). Our laboratory has reported that a chimeric Ca2+/CaM-dependent protein kinase (CCaMK) exhibits Ca2+-dependent autophosphorylation and Ca2+/CaM-dependent substrate phosphorylation (26, 27). CCaMK is required for bacterial and fungal symbioses in plants (28). Recently, the activity of tobacco NtCBK2 was shown to be stimulated by CaM (29). Here we report the isolation and characterization of a novel plant-specific calcium/CaM-regulated kinase, CRCK1, from Arabidopsis thaliana. In the kinase domain, this kinase has higher homology to receptor-like kinases than to mammalian CaM kinases. Ca2+/CaM interacts with subdomain II inside the kinase domain and up-regulates the kinase activity. Furthermore, the expression of CRCK1 in plants is stimulated by cold, salt, ABA, and hydrogen peroxide treatments.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Cloning of CRCKs—The cold-treated A. thaliana ecotype Columbia and Medicago sativa cv. Radius seedling cDNA expression libraries ({lambda}Screen, Novagen) were screened by using 35S-labeled potato CaM (PCM6) as described (30). The positive cDNA clones were sequenced on both strands. DNA sequences and amino acid sequences were analyzed by using GCG version 10.0 software, NCBI (www.ncbi.nlm.nih.gov), TAIR (www.arabidopsis.org), and EMBL-EBI (www.ebi.ac.uk/interpro). The full length of alfalfa CRCK cDNA and a partial Arabidopsis CRCK1 cDNA (amino acids 321–1407) were obtained from the cDNA library screening. The full length of CRCK1 was then cloned by reverse transcriptase-PCR by using gene-specific primers (ATGAGGAGCAAAACCCCAAC/CTCAATGCTATTCTCGTTATCT) based on the data base and the nucleotide sequences of the partial cDNA.

Construction of DNA Templates Coding CRCK Proteins—The templates for full-length coding regions of CRCKs were produced by PCR amplification from the cDNA library with gene-specific oligonucleotides containing the appropriate restriction sites for cloning into the down-stream of His6 tag into the pET-32a/b/c expression vector (Novagen). The nucleotide sequences of the cloned fragments derived by PCR amplification were determined after cloning into the pET-32 vector. The constructs were then transformed into E. coli strain BL21(DE3) pLysS. The bacteria were cultured in LB liquid medium at 30 °C with a shaking speed of 250 rpm.

CaM Binding Assay—The recombinant proteins were separated by SDS-PAGE, electrotransferred onto polyvinylidene difluoride membranes (Millipore), and incubated with 35S-labeled recombinant CaM (PCM6) plus 0.1 mM CaCl2, 2 mM EGTA, and 0.2 mM MgCl2, respectively, in 25 mM Tris-HCl, pH 7.5, 200 mM NaCl. The membranes were washed with the same buffer without 35S-labeled CaM and were exposed to x-ray film overnight.

CaM Binding Affinity Assay—The recombinant CRCK1 was purified to homogeneity by nickel-nitrilotriacetic acid column following the instructions of the manufacturer (Qiagen). The purified protein (4 pmol) was spotted on an Immobilon membrane (Millipore) and incubated with different amounts of 35S-labeled CaM with 0.1 mM CaCl2 or 2 mM EGTA overnight. After washing in 25 mM Tris-HCl, pH 7.5, 50 mM NaCl, and 0.1 mM CaCl2, radioactivities of bound CaM on each filter and free CaM in the incubation buffer collected before washing were measured using a liquid scintillation counter. In order to eliminate the nonspecific CaM binding, the bovine serum albumin was used as a negative control. The average background count was subtracted from the counts of protein samples when calculating the specific binding. The dissociation constant (Kd) was calculated based on Scatchard plot (30).

Gel Mobility Shift Assay—The synthetic peptide was prepared by using Applied Biosystems peptide synthesizer 431A in the Laboratory of Bioanalysis and Biotechnology, Washington State University. Samples containing 240 pmol (4 µg) of bovine CaM (Sigma) or potato PCM6 and different amounts of purified synthetic peptide in 100 mM Tris-HCl, pH 7.2, and either 0.1 M CaCl2 or 2 mM EGTA in a total volume of 30 µl were incubated for 1 h at room temperature. The samples were analyzed by nondenaturing PAGE as described (30).

Plant Materials and Treatments—A. thaliana ecotype Columbia were grown in a 1:1 mixture of soil mix and vermiculite or 1x MS medium under a 14-h photoperiod/10-h dark at 20–22 °C in a green-house. Plant stress treatments were performed as described (31). In brief, for cold stress plants were incubated at 4 °C; for salt stress, 200 mM NaCl was applied to the soil; for ABA and H2O2 treatments, plants were sprayed with 100 µM ABA or 10 mM H2O2, in buffer (10 mM Tris-HCl, pH 7.2) with 1% Triton X-100, and the control plants were sprayed with the buffer alone. All chemicals were purchased from Sigma. All the treatments were performed at 22 °C except cold treatment. After each treatment, whole plants were collected and either immediately frozen in liquid nitrogen and stored at –80 °C until RNA extraction or used for protein extraction.

RNA Isolation and Northern Analysis—Total RNA was isolated from frozen tissue essentially as described (30). RNA samples (15 µg) were separated on 1% formaldehyde-agarose gels. After transfer to Hybond N+ filters, the blots were hybridized using 32P-labeled DNAs and washed as described earlier (30).

Antibody Preparation—The peptide corresponding to the C-terminal amino acids 452–466 of CRCK1, which does not show high homology to other proteins in Arabidopsis, was conjugated with keyhole limpet hemocyanin. Two rabbits were injected intradermally by GenMed (San Francisco). The amount for initial injection and each of three booster injections was 250–300 µg. Blood samples were taken from rabbits before injection (preimmune serum) and at 90 days and 110 days after initial injection. The anti-CaMRLK1 antibody was purified as described (32). The serum was precipitated by 33% (v/v) ammonium sulfate in 1x phosphate-buffered saline, pH 7.0, centrifuged at 12,000 x g, and dialyzed in 1x phosphate-buffered saline.

Protein Isolation and Western Analysis—Total proteins were prepared by homogenizing plant tissues on ice with extraction buffer (50 mM HEPES-KOH, pH 7.5, 10 mM potassium acetate, 100 mM sodium chloride, 5 mM EDTA, and 0.4 M sucrose) with a complete protease inhibitor tablet (Roche Applied Science). The soluble and membrane proteins were fractionated from 10 g of 3-week-old plants as described (33, 34). Briefly, the homogenate was centrifuged at 1,000 x g for 15 min, and the supernatant was subjected to ultracentrifugation at 100,000 x g for 3 h. The total membrane pellet was homogenized in 3 ml of Tris-buffered saline (0.14 M NaCl, 2.7 mM KCl, and 25 mM Tris, pH 8.0), solubilized by the addition of Triton X-100 (1% (v/v) final concentration), and cleared of insoluble material by ultracentrifugation at 100,000 x g for 30 min. The protein content was determined by the Bradford reagent (Bio-Rad). The proteins were separated on 12% SDS-PAGE and transferred onto polyvinylidene difluoride membrane. The Western blotting was performed according to the procedure suggested by the manufacturer (Roche Applied Science) using the anti-CRCK1 antibody. The preimmune serum was used as a control.

Isolation of Knockout Plants—The seeds of Salk_063349 with a possible T-DNA insertion in exon 5 of At5g58940 were obtained from the Arabidopsis Biological Resource Center (Fig. 1A). The CRCK1 insertion mutants were identified by PCR using two gene-specific primers, TCTGGTGATGTATGCCGACCA/TCTGCCATTTCAAGGCGGTTA, and a T-DNA left border primer as suggested (35). The amplified fragment was sequenced, and the T-DNA insertion site was determined. The mutant plants were further verified by Northern analysis by using full-length CRCK1 cDNA as a probe. Furthermore, Western analysis was performed by using the anti-CRCK1 antibody. CRCK1 was not detected in homozygous mutants but appeared in heterozygous mutants.



View larger version (103K):
[in this window]
[in a new window]
  		FIG. 1.
Structural features of Arabidopsis CRCK1. A, CRCK1 is a transcript from the gene At5g58940. Note that CRCK1 is different from the predicted transcript because of differences in the sites of exons (E) 2 and 3. The T-DNA insertion site in Salk_063349 is indicated. LB, left border; RB, right border. B, alignment of amino acid sequences of CRCK1 and other RLCKs. Only the region around the conserved kinase domain is shown. The identical amino residues are shaded in black and conserved changes in gray. Dashes represent gaps introduced to maximize alignment. The CaM-binding region in CRCK1 is marked with a dotted line; the subdomains of catalytic domain are marked by a solid line, and the conserved lysine residue for ATP binding is marked by a triangle. The GenBankTM accession numbers are as follows: alfalfa CRCK, AY563141 [GenBank] ; Arabidopsis CRCK1, AY568379 [GenBank] ; CRCK2, At4g00330; CRCK3, At2g11520; tomato Pto, A49332 [GenBank] ; Arabidopsis PBS1, AF314176 [GenBank] .

 
Protein Autophosphorylation and Substrate Phosphorylation Assays—The kinase assay was performed as described (36) with modification. The autophosphorylation assay was carried out by using an incubation mixture that contained 500 nM CRCK1, 25 mM HEPES, pH 7.5, 10 mM MgCl2, and 2 µCi of [{gamma}-32P]ATP (3000 Ci/mmol). The substrate phosphorylation assay was performed by using 250 nM CRCK1, 2 µg of histone IIIS (Sigma), and 10 µM ATP containing 2 µCi of [{gamma}-32P]ATP. The reaction was carried out at 25 °C for 20 min and terminated using 2x SDS-PAGE sample buffer. For the ATP dependence assay, 500 nM of fusion protein was incubated with 0.1–10 µM of ATP containing 2 µCi of [{gamma}-32P]ATP, and the incorporation was measured by P81 filter binding method (37). The Lineweaver-Burk plot was generated by using Hyper version 1.1w hyperbolic regression program (homepage.ntlworld.com/john.easterby/software.html). Phosphoamino acid analysis was carried out as described (26). Briefly, the autophosphorylated CRCK1 was excised from the gel and was hydrolyzed by 6 N HCl at 110 °C for 2 h and subjected to paper chromatography using propionic acid, 1 M NH4OH, and isopropyl alcohol (45:17.5:17.5) as a solvent. Phosphoserine and phosphothreonine (5 mg/ml) were used as standards.

Immunoprecipitation of the CRCK1 Complex—CRCK1 was immunoprecipitated from total plant protein extracts as described (38) with modification. Briefly, 10-day-old plants were homogenized in an extraction buffer containing 25 mM Tris-HCl, pH 7.5, 15 mM MgCl2, 5 mM EGTA or 1 mM CaCl2, 150 mM NaCl, 0.1% Tween 20, 1 mM dithiothreitol, and complete protease inhibitor mixture, which was then centrifuged at 20,000 x g. The supernatants were collected and dialyzed against 10 mM Tris, pH 7.5, and either 1 mM EGTA or 1 mM CaCl2. One mg of total protein per ml was then incubated with 40 µl of the anti-CRCK1 antibody or preimmune serum overnight on ice with gentle shaking. 300 µg of protein A beads (Sigma) were then added, and the samples were shaken for an additional 6 h at 4 °C and washed five times with the dialysis buffer.

The immunoprecipitated complex was subjected to autophosphorylation in the reaction buffer containing 25 mM HEPES, pH 7.5, 10 mM MgCl2, and 5 µCi of [{gamma}-32P]ATP for 30 min at room temperature, and the reaction was terminated by adding SDS-PAGE buffer. The proteins were then separated by 10% SDS-PAGE. For the co-immunoprecipitation assay, the beads were suspended in SDS-PAGE buffer, and the samples were subjected to Western analysis against an anti-CaM antibody (Santa Cruz Biotechnology).


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
Isolation of CRCK1—The cold-treated A. thaliana and Medicago sativa cDNA libraries were screened with 35S-labeled CaM. Over 400 positive clones were obtained from 1.5 x 106 recombinant phages. These include known CaM-binding proteins, such as glutamate decarboxylase (39), kinesin (40, 41), CCaMK (27), and SAUR (42). One positive clone from each library was identified, which encodes for a polypeptide with high homology to plant RLCK, and were therefore named Arabidopsis CRCK1 and alfalfa CRCK. The nucleotide sequences of Arabidopsis CRCK1 in the coding region are the same as At5g58940 of the data base between 1–244 and 410-end, but are different between 245 and 409. A comparison of the cDNA and genomic sequences in the data base revealed that this is a result of an incorrect prediction of the 2nd intron site in the data base (Fig. 1A). Another possibility is that At5g58940 has two transcripts by alternative splicing, but no other transcripts were identified by using reverse transcriptase-PCR-based cloning, suggesting that the data base prediction is not correct. Arabidopsis CRCK1 encodes for a peptide with 468 amino acids, has a molecular mass of ~52.65 kDa, and a pI of 10.37, whereas alfalfa CRCK encodes for a peptide with 456 amino acids, has a molecular mass of 51.38 kDa, and a pI of 10.19. These two CRCKs exhibit 64.4% similarity and 54.3% identity for their deduced amino acid sequences, suggesting that they are orthologs (Fig. 1B). They have conserved kinase domains with all 11 subdomains of the serine/threonine kinase. BLAST comparison indicates that CRCKs have higher homology to plant RLKs including Pto, PBS1, BRI 1, and CLV1 than other CaM kinases from plants and animals, suggesting CRCKs are plant-specific RLKs (43). For example, the overall homology (identity) is 51.05% (41.26%) with Pto and 52.84% (41.14%) with PBS1. However, there is less than 40% homology (26% identity) with rat CaMKII{alpha}, lily CcaMK, and a soybean CDPK. CDPKs are a family of plant protein kinases containing a CaM domain directly fused to the kinase domain (44). It is notable that At4g00330 and At2g11520 in the Arabidopsis genome show high overall homology to CRCK1 (Fig. 1B), suggesting that they are CRCK1 homologs and are thus named CRCK2 and CRCK3. Other than the conserved kinase domain in the central portion, other portions of CRCK1 have no significant homology to any known functional domains in the data base. In addition, CRCKs have no extracellular domain or transmembrane domain based on the protein structure prediction programs, suggesting that CRCKs are cytoplasmic RLKs (43).

CRCKs Are Calcium-dependent CaM-binding Proteins—To verify further that CRCKs are CaM-binding proteins, total proteins from an E. coli strain containing the full length of Arabidopsis CRCK1 and the alfalfa homolog were subjected to 35S-labeled CaM binding assays. CaM binds to the recombinant CRCK1 (Fig. 2A) and alfalfa CRCK (data not shown) in the presence of 0.1 mM CaCl2. However, in the presence of 2 mM EGTA, a calcium chelator (Fig. 2A), or 1 mM MgCl2 (data not shown), the CaM binding was not observed, suggesting that the CaM-binding properties of CRCKs are Ca2+-dependent. Western blot analysis using the anti-CRCK1 antibody was performed to confirm the identity of CRCK1 (Fig. 2A).



View larger version (37K):
[in this window]
[in a new window]
  		FIG. 2.
CRCK1 is a calcium-dependent CaM-binding protein. A, CaM binds to CRCK1. Recombinant CRCK1 was subjected to SDS-PAGE and transferred onto a nitrocellulose membrane. The membrane was incubated with 35S-labeled CaM in a buffer containing either 2 mM EGTA or 0.1 mM CaCl2. B, saturation curve of 35S-labeled CaM binding to purified CRCK1. Four pmol of recombinant protein were spotted on a membrane (Millipore) and incubated with different amounts of 35S-labeled CaM. The amount of bound CaM at each point was represented as a percentage of the maximal binding. A Scatchard plot of data indicated that the binding ratio of CaM to CRCK1 is 1:1. C, gel mobility shift assay shows CaM binding to a 24-mer synthetic peptide (amino acids 160–183 in CRCK1). The conserved lysine residue (Lys173) for ATP binding is underlined.

 
The CaM binding affinity of CRCK1 was measured by blotting CRCK1 on a filter and incubating with varying concentrations of 35S-labeled CaM in the presence of 0.1 mM CaCl2. The labeled CaM binds to CRCK1 with a saturation at ~130 nM (Fig. 2B), indicating the presence of a saturable high affinity binding site in CRCK1. Based on the Scatchard plot analysis of the saturation curve, the dissociation constant (Kd) of CaM for CRCK1 was estimated to be about 20.5 nM. The binding of CaM to CRCK1 was completely blocked in the presence of 2 mM EGTA. The Scatchard analysis also indicated that the C-terminal portion of CRCK1 has a single CaM-binding site.

The CaM-binding Site of CRCK1 Is Located Inside the Catalytic Domain—Most characterized CaM-binding proteins have a secondary structural feature, a basic amphiphilic {alpha}-helix, even though the amino acid residues in the CaM-binding region of these proteins are not conserved (45, 46). A helical wheel projection of the peptide sequences predicted that the amino acids 160–183 around subdomain II of the CRCK1 kinase domain contain the CaM-binding structural feature. The amino acid residues 160–183 form an {alpha}-helix with a hydrophobic face and a basic hydrophilic face. In particular, a hydrophobic residue, here Ile172, embedded in a context of basic residues Lys173 and Arg174, is a common feature in known CaM targets (46, 47). A peptide with 24 residues corresponding to the putative CaM-binding region (amino acids 160–183) was incubated with bovine CaM or PCM6. The 24-mer peptide is capable of forming a stable complex with either bovine CaM or plant CaM (PCM6) in the presence of Ca2+ but not in the presence of EGTA (Fig. 2C). Without adding the peptide, a single free CaM band was observed. After the peptide was added, another band representing the peptide-CaM complex appeared. When the ratio of peptide to CaM was equal, the free CaM band disappeared and the intensity of the peptide-CaM complex increased. No free CaM was detected as a molar ratio of peptide/CaM is 1.5. These observations indicate that the CaM-binding site is located onto amino acids 160–183 in CRCK1. Most interestingly, the CaM-binding site is located around subdomain II of the kinase domain, which contains a conserved lysine residue (Lys173) for ATP binding (48).

Alignment of the CaM-binding site of CRCK1 with other kinases indicates that CRCK1 and its alfalfa ortholog CRCK have almost identical amino acid residues (Fig. 1B). Two other putative Arabidopsis CRCKs, CRCK2 and CRCK3, contain a domain similar to the CaM-binding domain of CRCK1, suggesting that they are also CaM-binding protein kinases. In contrast, the corresponding regions of Pto and PBS1 show less homology to CRCKs (Fig. 1B). However, helical wheel projection indicates that the corresponding region can form an amphiphilic helix (data not shown), suggesting that they are also CaM-binding kinases. It should be noted that alignment with other kinases in this region does not show high homology, suggesting that CaM binding is unique to CRCK-like kinases.

CaM Up-regulates the Kinase Activity—To investigate the kinase activity of CRCK1, CRCK1 fused with the His tag was overexpressed in E. coli, purified to homogeneity by nickel-nitrilotriacetic acid, and verified by silver staining. CRCK1 was shown to autophosphorylate in the presence of 10 mM Mg2+ (Fig. 3A), and the autophosphorylation was completed after about 20–30 min (Fig. 3B). However, no activity was observed in the presence of either Mn2+ or Ca2+ (Fig. 3A). CRCK1 exhibits standard Michaelis-Menten kinetics with respect to ATP. The Km and Vmax values for ATP, determined by a Lineweaver-Burk plot, are 1 µM and 33.6 pmol/mg/min, respectively (Fig. 3D). To confirm whether CRCK1 is a serine/threonine kinase, a phosphoamino acid analysis was performed. The phosphoamino acid analysis reveals that CRCK1 autophosphorylates at the threonine residue(s), but no detectable phosphorylation was observed in serine and tyrosine residues (Fig. 4C).



View larger version (69K):
[in this window]
[in a new window]
  		FIG. 3.
Ca2+/CaM up-regulates the kinase activity of CRCK1. A, comparison of the effect of divalent cations (10 mM) on CRCK1 autophosphorylation. 500 nM CRCK1 was used. B, time course of autophosphorylation. C, site of autophosphorylation. D, Lineweaver-Burk plot of ATP dependence in the absence and presence of 5 µM CaM. E, effect of CaM on autophosphorylation (upper band) and substrate phosphorylation (lower band) of CRCK1. The purified recombinant protein (250 nM) was incubated with 2 µg of histone IIIS as described under "Experimental Procedures." The kinase activity of CRCK1 was increased by adding different concentrations of CaM but decreased when the Ca2+ chelator EGTA, CaM antagonist chlorpromazine (CPZ), or the peptide corresponding to the CaM-binding region (amino acids 160–183) was added. These assays were performed in the presence of 5 µM CaM.

 



View larger version (55K):
[in this window]
[in a new window]
  		FIG. 4.
CRCK1 is a cytosolic protein kinase with Ca2+/CaM binding property in planta. A, CRCK1 is a cytosolic protein. 20 µgof total and soluble proteins and 5 µg of the microsomal proteins from wild-type plants and 20 µg of total proteins from crck1 knockout plants were subjected to Western analysis by using the anti-CRCK1 antibody. B, CRCK1 complex was immunoprecipitated from the wild-type plant and crck1 knockout plants, and the immunoprecipitants were subjected to autophosphorylation assay. The arrow indicates the autophosphorylated CRCK1. C, CaM interacts with CRCK1 in planta. CRCK1 was immunoprecipitated from the total proteins of wild-type (WT) and crck1 knockout (KO) plants. The immunoprecipitants were subjected to Western analysis by using an anti-CaM antibody. The arrow indicates CaM.

 
To study further the role of Ca2+/CaM in regulating the kinase activity, CRCK1 was subjected to autophosphorylation and substrate phosphorylation in the presence of CaM. It was observed that increasing concentrations of CaM enhanced both autophosphorylation and substrate phosphorylation. There was about a 10-fold increase in kinase activity in the presence of CaM (Fig. 3E). The Vmax of the reaction in the presence of CaM increased from 33.6 to 289 pmol/min/mg of protein, but no significant change in Km was observed (Fig. 3D). A similar result was observed in the case of {gamma}-subunit of phosphorylase kinase, which is a CaM-dependent kinase (49). Furthermore, the effect on kinase activity by CaM was inhibited with increasing concentrations of the Ca2+ chelator EGTA and the CaM antagonist chlorpromazine (Fig. 3E). These results suggest that Ca2+/CaM positively regulates the kinase activity. To verify whether CaM regulates activity by directly interacting with the kinase, the synthetic peptide corresponding to the CaM-binding site (amino acids 160–183) was added to the assay mixture in the presence of CaM. The kinase activity was observed to decrease when peptide concentration was increased (Fig. 3E), suggesting that CaM directly interacts with amino acids 160–183 of the kinase and increases its activity.

CRCK1 Is a CaM-binding Cytosolic Protein Kinase in Planta—Western analysis results showed that only a protein of ~52 kDa, matching the size of CRCK1, was specifically recognized by the anti-CRCK1 antibody in the total proteins of wild-type plants (Fig. 4A). To confirm further the specificity of the anti-CRCK1 antibody, and to clarify the identity of this protein, the crck1 knockout mutant was isolated from Salk_063349 (data not shown). The band of 52 kDa recognized by anti-CRCK1 in the wild-type plants was absent in the knockout plants (Fig. 4A), indicating that the antibody specifically recognizes plant CRCK1. In addition, the CRCK1 protein appeared in the soluble fraction but not in the microsomal fraction by Western analysis (Fig. 4A), suggesting that CRCK1 is a cytosolic protein. Note that the intensity of CRCK1 protein in the soluble fraction is less than the total protein extraction. This could be the result of difference in the protein purification methods for total protein and soluble protein preparations. Another possibility may be the CRCK1 degradation during soluble protein purification.

The anti-CRCK1 antibody was also used for immunoprecipitation of plant CRCK1 from total proteins of wild-type plants. The immunoprecipitated proteins were subjected to an auto-phosphorylation assay, and a phosphorylated band around 52 kDa was observed that matches the predicted size of CRCK1 (Fig. 4B). However, no phosphorylated band was detected in the crck1 knockout plants. There is a faint smaller phosphorylated band in the immunoprecipitated proteins from the wild-type plants. This band may be a degraded product of CRCK1. The immunoprecipitants were also subjected to Western analysis against an anti-CaM antibody. An ~17-kDa protein band similar to CaM in size was detected in the preparation with CaCl2. A weaker band of even smaller size was also detected, which could represent another CaM isoform because Arabidopsis has 11 CaM genes that encode for seven isoforms (16, 21), which share a homology ranging from 50 to 98%. However, no CaM band appeared in the immunoprecipitated protein from crck1 knockout plants (Fig. 4C). Furthermore, no CaM was detected in the preparation with EGTA (Fig. 4C), suggesting that Ca2+/CaM interacts with CRCK1 in vivo as well. No band was observed in the samples with the preimmune serum for immunoprecipitation (data not shown).

Stress Signals Induce Increased Expression of CRCK1—The expression pattern of CRCK1 was further investigated by Northern analysis using the full length of CRCK1 as a probe. A band of ~1.8 kb was detected with very low expression levels in all tissues (data not shown). Because CRCK1 was isolated from a cold-treated cDNA library, the effect of cold on CRCK1 expression was further studied. An increase in CRCK1 mRNA expression was observed after cold treatment (Fig. 5A), as well as increased expression of CRCK1 protein (Fig. 5B). The expression level of CRCK1 mRNA and proteins also increased following salt, H2O2, and ABA treatments (Fig. 5, A and B), suggesting that this kinase is involved in the transduction of cold, salt, and possibly other stress signals related to osmotic and oxidative stress. It is becoming clear that the signal transduction involving cold and salt stress as well as signal molecules such as H2O2 and stress hormones such as ABA share common pathways (18).



View larger version (52K):
[in this window]
[in a new window]
  		FIG. 5.
Expression analysis of CRCK1 in plants. A, Northern blot analysis of stress-induced expression of CRCK1 mRNA. Three-week-old plants were treated with cold (4 °C), NaCl (200 mM), H2O2 (10 mM), and ABA (100 µM) for various times as indicated. 10 µg of total RNA were subjected to Northern analysis by using the full length of CRCK1 as a probe. The 18 S RNA was used as a control to show equal loading. B, increased expression of CRCK1 protein under stressed conditions. Plants were treated as described above. Plants treated with water were used as a control. 20 µg of total proteins were subjected to Western analysis by using the anti-CRCK1 antibody.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
RLCKs are a class of kinases that contain similar kinase domains as RLKs but lack the extracellular receptor domains (2, 43). More than 200 RLCKs are present in the Arabidopsis genome, but the functions of most RLCKs are unclear. The results reported here describe the isolation and characterization of a novel plant-specific CaM-binding protein CRCK1 from Arabidopsis that contains structural features of RLCKs. We have also isolated a CRCK1 ortholog from alfalfa (M. sativa), suggesting that this gene is present in other plants. In addition, there are two CRCK1 homologs, CRCK2 and CRCK3 (Fig. 1B), in the Arabidopsis genome, suggesting that CRCKs belongs to a small gene family. All of these proteins contain a conserved CaM-binding site, suggesting that they are CaM-binding proteins. CRCK1 also has reasonable homology to two previously characterized RLCKs, tomato Pto (10) and Arabidopsis PBS1 (11). Both Pto and PBS1 are involved in conferring plant resistance to specific pathogen infections in plants. Analysis of the secondary structure of Pto and PBS1 in the region corresponding to the CaM-binding site of CRCK1 indicates that they can form an amphiphilic helix structure, a typical CaM-binding motif. A CaM binding prediction program (calcium/uhnres.utoronto.ca) also consistently predicts a putative CaM-binding site in this region, suggesting that Pto and PBS1 are CaM-binding kinases. Exploring the possible link between Ca2+/CaM and Pto and PBS1 and their role in plant disease resistance will be of great interest to plant scientists.

Recently, AtCaMRLK and SRK29, two CaM-binding RLKs from plants, have been reported (51, 52). Both AtCaMRLK and SRK29 contain an extracellular domain, a transmembrane domain, and a kinase domain. The CaM-binding site is located near the transmembrane domain in AtCaMRLK (At5g45800) and in subdomain VIa in SRK29 (Fig. 6). However, the Ca2+/CaM binding affinity is relatively low (Kd = 120 nM for AtCaM-RLK), and Ca2+/CaM does not affect the kinase activity (51, 52). In contrast, Ca2+/CaM has a high affinity for CRCK1 (Kd = 20.5 nM), and the kinase activity of CRCK1 is stimulated upon Ca2+/CaM binding to the CaM-binding region (Figs. 2 and 3). It is noteworthy that the CaM-binding site in CRCK1 is located around subdomain II of the kinase domain, which contains a conserved lysine residue (here Lys173) for ATP binding (Fig. 1B). In contrast, the CaM-binding regions in mammalian CaM kinases are adjacent to or overlap the autoinhibitory domains that are usually outside of the catalytic domain (Fig. 6). Ca2+/CaM binding to the kinase induces a conformational rearrangement that displaces the pseudosubstrate inhibitory domain and allows for full enzyme activity (45, 53, 54). Although CRCK1 exhibits Ca2+/CaM-dependent changes in kinase activity, the underlying control mechanism is unclear. In addition to the relieving autoinhibition model, there are at least two other CaM activation models that have been observed, indicating the conformational flexibility of CaM (16, 45). One is active site remodeling, as in the case of activation of anthrax adenylyl cyclase (edema factor). Upon Ca2+/CaM binding, a helical domain of edema factor undergoes a rotation away from the catalytic core, which stabilizes a disordered loop and leads to enzyme activation (45, 55). Another model is CaM-induced dimerization. Two CaM molecules interact with two K+ channel domains of a potassium channel upon Ca2+ binding. The C-terminal EF hands mediate tethering to the channel, and the N-terminal EF hands are responsible for Ca2+-induced dimerization leading to channel gating and direct coupling between changes in intracellular Ca2+ concentrations and altered membrane potential (45, 56). It is apparent that the role of CaM binding to CRCK1 is unlike animal CaM kinases because the CaM-binding site in CRCK1 is inside the catalytic domain of the kinase. CaM binding to CRCK1 increases the Vmax by ~9-fold, but without the expected decrease in Km values as in most CaM-binding kinases. Lanciotti and Bender (49) reported a similar result for the {gamma}-subunit of phosphorylase kinase which is a CaM-dependent kinase, where CaM stimulation was claimed to increase the Vmax of the {gamma}-subunit without any associated decrease in Km values. This phenomenon is not well understood and may represent a novel mechanism for the regulation of CaM-stimulated kinases. Further biochemical studies are necessary to determine the possible mechanism of the Ca2+/CaM regulation on CRCK1 activity.



View larger version (28K):
[in this window]
[in a new window]
  		FIG. 6.
Schematic showing the location of CaM-binding sites in various CaM-regulated protein kinases. The GenBankTM accession numbers are as follows: CRCK1, AY568379 [GenBank] ; Arabidopsis At-CaMRLK, At5g45800; Brassica SRK29, CAA82930 [GenBank] rat brain CaMKII{alpha} subunit, J02942 [GenBank] ; lily CCaMK, U24188 [GenBank] .

 
In plants, a variety of environmental and hormonal signals, such as cold, salt, ABA, and hydrogen peroxide trigger changes in cytosolic free Ca2+ levels (17–20). The cytosolic Ca2+ changes are then perceived by Ca2+ receptors such as CaM, which in turn regulate the downstream signal cascade and lead to physiological responses in plants (13, 16, 21). The importance of Ca2+/CaM-meidated protein phosphorylation has been recognized in animals (23, 45). Until recently, the understanding of the function of plant CaM-regulated kinases has been hindered by limited molecular and genetic tools (25). Characterization of CRCK1 and its homologs as CaM-regulated RL-CKs is an important initial step in understanding the role of Ca2+/CaM-mediated phosphorylation in plants. Most interestingly, the expression of CRCK1 itself is up-regulated by cold and salt stresses, as well as the stress molecules ABA and hydrogen peroxide (Fig. 4), suggesting that CRCK1 may be involved in osmotic and oxidative stress signal transduction pathways in plants. Thus, it is likely that CRCK1 responds to environmental or hormonal signals in two ways; by increasing the protein expression level, and by stimulating its kinase activity through Ca2+/CaM in response to signal-induced changes in cytosolic Ca2+ levels. It should be noted that in contrast to animals, plants possess a repertoire of multiple CaM genes that encode for several CaM isoforms (13, 16, 21). For example, Arabidopsis has 11 CaM genes that encode for seven CaM isoforms. The different CaM isoforms differ in their ability to bind and activate known CaM-regulated enzymes in vitro (57, 58). In this study, potato CaM PCM6 and bovine CaMs were used, and no significant differences were found in CaM binding and enzyme activation. However, it is not known whether CRCK1 can be activated by all Arabidopsis CaM isoforms or specific isoforms. In addition, CRCK1 may be regulated by other modulators similar to Pto, which can be activated by avrPto, a polypeptide from P. syringae pv. tomato gene avrPto that induces hypersensitive response in plants (10). Further studies on the functional significance of CRCK1 and its homologs should assist in understanding the role of Ca2+/CaM-mediated stress signaling in plants and how this helps plants to survive and adapt to the changing environment.


   FOOTNOTES
 
* This work was supported by National Science Foundation Grant MCB-0082256 and the United States Department of Agriculture Grant 2002-00741. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EBI Data Bank with accession number(s) AY568379 [GenBank] and AY563141 [GenBank] . Back

{ddagger} To whom correspondence should be addressed: Center for Integrated Biotechnology and Dept. of Horticulture, Washington State University, Pullman, WA 99164-6414. Tel.: 509-335-2487; Fax: 509-335-8690; E-mail: poovaiah{at}wsu.edu.

1 The abbreviations used are: RLK, receptor-like kinase; RLCK, receptor-like cytoplasmic kinase; CaM, calmodulin; CCaMK, chimeric calcium/calmodulin-dependent kinase; CRCK, calmodulin-regulated receptor-like cytoplasmic kinase; ABA, abscisic acid; T-DNA, transfer DNA. Back


   ACKNOWLEDGMENTS
 
We thank Dr. Daisuke Takezawa for providing cDNA libraries of A. thaliana and M. sativa and other members of this laboratory, especially Kanda Kumar, for their assistance during this investigation.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Hardie, D. G. (1999) Annu. Rev. Plant Physiol. Plant Mol. Biol. 50, 97–131[CrossRef]
  2. Shiu, S. H., and Bleecker, A. B. (2001) Science's STKE http:/www.stke.org/cgi/content/full/OC_sigtrans;2001/RE22
  3. Tichtinsky, G., Vanoosthuyse, V., Cock, J. M., and Gaude, T. (2003) Trends Plant Sci. 8, 231–237[CrossRef][Medline] [Order article via Infotrieve]
  4. Becraft, P. W. (2002) Annu. Rev. Cell Dev. Biol. 18, 163–192[CrossRef][Medline] [Order article via Infotrieve]
  5. Li, J., and Chory, J. (1997) Cell 90, 929–938[CrossRef][Medline] [Order article via Infotrieve]
  6. Scheer, J. M., and Ryan, C. A., Jr. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, 9585–9590[Abstract/Free Full Text]
  7. Kachroo, A., Nasrallah, M. E., and Nasrallah, J. B. (2002) Plant Cell 14, S227–238[Free Full Text]
  8. Song, W. Y., Wang, G. L., Chen, L. L., Kim, H. S., Pi, L. Y., Holsten, T., Gardner, J., Wang, B., Zhai, W. X., Zhu, L. H., Fauquet, C., and Ronald, P. C. (1995) Science 270, 1804–1806[Abstract/Free Full Text]
  9. Clark, S. E., Williams, R. W., and Meyerowitz, E. M. (1997) Cell 89, 575–585[CrossRef][Medline] [Order article via Infotrieve]
  10. Tang, X., Frederick, R. D., Zhou, J., Halterman, D. A., Jia, Y., and Martin, G. B. (1996) Science 274, 2060–2063[Abstract/Free Full Text]
  11. Swiderski, M. R., and Innes, R. W. (2001) Plant J. 26, 101–112[CrossRef][Medline] [Order article via Infotrieve]
  12. Poovaiah, B. W., and Reddy, A. S. (1993) CRC Crit. Rev. Plant Sci. 12, 185–211[Medline] [Order article via Infotrieve]
  13. Reddy, A. S. (2001) Plant Sci. 160, 381–404[Medline] [Order article via Infotrieve]
  14. Trewavas, A. J., and Malho, R. (1998) Curr. Opin. Plant Biol. 1, 428–433[CrossRef][Medline] [Order article via Infotrieve]
  15. Poovaiah, B. W., and Reddy, A. S. (1987) CRC Crit. Rev. Plant Sci. 6, 47–103[Medline] [Order article via Infotrieve]
  16. Yang, T., and Poovaiah, B. W. (2003) Trends Plant Sci. 8, 505–512[CrossRef][Medline] [Order article via Infotrieve]
  17. Knight, H. (2000) Int. Rev. Cytol. 195, 269–324[Medline] [Order article via Infotrieve]
  18. Xiong, L., Schumaker, K. S., and Zhu, J. K. (2002) Plant Cell 14, 165–183[Abstract/Free Full Text]
  19. Pei, Z. M., Murata, Y., Benning, G., Thomine, S., Klusener, B., Allen, G. J., Grill, E., and Schroeder, J. I. (2000) Nature 406, 731–734[CrossRef][Medline] [Order article via Infotrieve]
  20. Price, A. H., Taylor, A., Ripley, S. J., Griffiths, A., Trewavas, A. J., and Knight, M. R. (1994) Plant Cell 6, 1301–1310[Abstract]
  21. Snedden, W., and Fromm, H. (2001) New Physiologist 151, 35–66[CrossRef]
  22. Zielinski, R. E. (1998) Annu. Rev. Plant Physiol. Plant Mol. Biol. 49, 697–725[CrossRef]
  23. Hanson, P. I., and Schulman, H. (1992) Annu. Rev. Biochem. 61, 559–601[CrossRef][Medline] [Order article via Infotrieve]
  24. Veluthambi, K., and Poovaiah, B. W. (1984) Science 223, 167–169[Abstract/Free Full Text]
  25. Zhang, L., and Lu, Y. (2003) Trends Plant Sci. 8, 123–127[CrossRef][Medline] [Order article via Infotrieve]
  26. Takezawa, D., Ramachandiran, S., Paranjape, V., and Poovaiah, B. W. (1996) J. Biol. Chem. 271, 8126–8132[Abstract/Free Full Text]
  27. Patil, S., Takezawa, D., and Poovaiah, B. W. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 4797–4801
  28. Levy, J., Bres, C., Geurts, R., Chalhoub, B., Kulikova, O., Duc, G., Journet, E. P., Ane, J. M., Lauber, E., Bisseling, T., Denarie, J., Rosenberg, C., and Debelle, F. (2004) Science 303, 1361–1364[Abstract/Free Full Text]
  29. Hua, W., Liang, S., and Lu, Y. T. (2003) Biochem. J. 376, 291–302[CrossRef][Medline] [Order article via Infotrieve]
  30. Yang, T., and Poovaiah, B. W. (2000) J. Biol. Chem. 275, 38467–38473[Abstract/Free Full Text]
  31. Yang, T., and Poovaiah, B. W. (2002) J. Biol. Chem. 277, 45049–45058[Abstract/Free Full Text]
  32. Ausubel, F., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., and Struhl, K. (eds) (1995) Short Protocols in Molecular Biology, 3rd Ed., pp. 11.26–11.27, John Wiley & Sons, Inc., New York
  33. Zheng, H., Bednarek, S. Y., Sanderfoot, A. A., Alonso, J., Ecker, J. R., and Raikhel, N. V. (2002) Plant Physiol. 129, 530–539[Abstract/Free Full Text]
  34. Smith, J. A., Krauss, M. R., Borkird, C., and Sung, Z. R. (1988) Planta 174, 462–472
  35. Alonso, J. M., Stepanova, A. N., Leisse, T. J., Kim, C. J., Chen, H., Shinn, P., Stevenson, D. K., Zimmerman, J., Barajas, P., Cheuk, R., Gadrinab, C., Heller, C., Jeske, A., Koesema, E., Meyers, C. C., Parker, H., Prednis, L., Ansari, Y., Choy, N., Deen, H., Geralt, M., Hazari, N., Hom, E., Karnes, M., Mulholland, C., Ndubaku, R., Schmidt, I., Guzman, P., Aguilar-Henonin, L., Schmid, M., Weigel, D., Carter, D. E., Marchand, T., Risseeuw, E., Brogden, D., Zeko, A., Crosby, W. L., Berry, C. C., and Ecker, J. R. (2003) Science 301, 653–657[Abstract/Free Full Text]
  36. Schulze-Muth, P., Irmler, S., Schroder, G., and Schroder, J. (1996) J. Biol. Chem. 271, 26684–26689[Abstract/Free Full Text]
  37. Sathyanarayanan, P. V., Siems, W. F., Jones, J. P., and Poovaiah, B. W. (2001) J. Biol. Chem. 276, 32940–32947[Abstract/Free Full Text]
  38. Lechner, E., Xie, D., Grava, S., Pigaglio, E., Planchais, S., Murray, J. A., Parmentier, Y., Mutterer, J., Dubreucq, B., Shen, W. H., and Genschik, P. (2002) J. Biol. Chem. 277, 50069–50080[Abstract/Free Full Text]
  39. Baum, G., Chen, Y., Arazi, T., Takatsuji, H., and Fromm, H. (1993) J. Biol. Chem. 268, 19610–19617[Abstract/Free Full Text]
  40. Wang, W., Takezawa, D., Narasimhulu, S. B., Reddy, A. S., and Poovaiah, B. W. (1996) Plant Mol. Biol. 31, 87–100[CrossRef][Medline] [Order article via Infotrieve]
  41. Reddy, A. S., Safadi, F., Narasimhulu, S. B., Golovkin, M., and Hu, X. (1996) J. Biol. Chem. 271, 7052–7060[Abstract/Free Full Text]
  42. Yang, T., and Poovaiah, B. W. (2000) J. Biol. Chem. 275, 3137–3143[Abstract/Free Full Text]
  43. Shiu, S. H., and Bleecker, A. B. (2003) Plant Physiol. 132, 530–543[Abstract/Free Full Text]
  44. Cheng, S. H., Willmann, M. R., Chen, H. C., and Sheen, J. (2002) Plant Physiol. 129, 469–485[Abstract/Free Full Text]
  45. Hoeflich, K. P., and Ikura, M. (2002) Cell 108, 739–742[CrossRef][Medline] [Order article via Infotrieve]
  46. O'Neil, K. T., and DeGrado, W. F. (1990) Trends Biochem. Sci. 15, 59–64[CrossRef][Medline] [Order article via Infotrieve]
  47. Arazi, T., Baum, G., Snedden, W. A., Shelp, B. J., and Fromm, H. (1995) Plant Physiol. 108, 551–561[Abstract]
  48. Hanks, S. K., and Quinn, A. M. (1991) Methods Enzymol. 200, 38–62[Medline] [Order article via Infotrieve]
  49. Lanciotti, R. A., and Bender, P. K. (1994) Biochem. J. 299, 183–189
  50. van Der Luit, A. H., Olivari, C., Haley, A., Knight, M. R., and Trewavas, A. J. (1999) Plant Physiol. 121, 705–714[Abstract/Free Full Text]
  51. Charpenteau, M., Jaworski, K., Ramirez, B. C., Tretyn, A., Ranjeva, R., and Ranty, B. (2004) Biochem. J. 379, 841–848[CrossRef][Medline] [Order article via Infotrieve]
  52. Vanoosthuyse, V., Tichtinsky, G., Dumas, C., Gaude, T., and Cock, J. M. (2003) Plant Physiol. 133, 919–929[Abstract/Free Full Text]
  53. Chin, D., and Means, A. R. (2000) Trends Cell Biol. 10, 322–328[CrossRef][Medline] [Order article via Infotrieve]
  54. Means, A. R. (1988) Recent Prog. Horm. Res. 44, 223–286[Medline] [Order article via Infotrieve]
  55. Drum, C., Yan, S., Bard, J., Shen, Y., Lu, D., Soelaiman, S., Grabarek, Z., Bohm, A., and Tang, W. J. (2002) Nature 415, 396–402[CrossRef][Medline] [Order article via Infotrieve]
  56. Schumacher, M., Rivard, A., Bachinger, H., and Adelman, J. (2001) Nature 410, 1120–1124[CrossRef][Medline] [Order article via Infotrieve]
  57. Lee, S. H., Johnson, J. D., Walsh, M. P., Van Lierop, J. E., Sutherland, C., Xu, A., Snedden, W. A., Kosk-Kosicka, D., Fromm, H., Narayanan, N., and Cho, M. J. (2000) Biochem. J. 350, 299–306
  58. Choi, J. Y., Lee, S. H., Park, C. Y., Heo, W. D., Kim, J. C., Kim, M. C., Chung, W. S., Moon, B. C., Cheong, Y. H., Kim, C. Y., Yoo, J. H., Koo, J. C., Ok, H. M., Chi, S. W., Ryu, S. E., Lee, S. Y., Lim, C. O., and Cho, M. J. (2002) J. Biol. Chem. 277, 21630–21638[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 Mol PlantHome page
S. Vij, J. Giri, P. K. Dansana, S. Kapoor, and A. K. Tyagi
The Receptor-Like Cytoplasmic Kinase (OsRLCK) Gene Family in Rice: Organization, Phylogenetic Relationship, and Expression during Development and Stress
Mol Plant, September 1, 2008; 1(5): 732 - 750.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
S. C. Popescu, G. V. Popescu, S. Bachan, Z. Zhang, M. Seay, M. Gerstein, M. Snyder, and S. P. Dinesh-Kumar
Differential binding of calmodulin-related proteins to their targets revealed through high-density Arabidopsis protein microarrays
PNAS, March 13, 2007; 104(11): 4730 - 4735.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
279/41/42552    most recent
M402830200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yang, T.
Right arrow Articles by Poovaiah, B. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yang, T.
Right arrow Articles by Poovaiah, B. W.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2004 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement