HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 279, Issue 45, 46566-46572, November 5, 2004

This Article Abstract Full Text (PDF) All Versions of this Article: 279/45/46566    most recent M406317200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Trencia, A. Articles by Beguinot, F. Search for Related Content PubMed PubMed Citation Articles by Trencia, A. Articles by Beguinot, F. Social Bookmarking                      What's this?

Omi/HtrA2 Promotes Cell Death by Binding and Degrading the Anti-apoptotic Protein ped/pea-15^*

Alessandra Trencia, Francesca Fiory, Maria Alessandra Maitan, Pasquale Vito¶, Alessia Paola Maria Barbagallo, Anna Perfetti, Claudia Miele, Paola Ungaro, Francesco Oriente, Lucia Cilenti||, Antonis S. Zervos||, Pietro Formisano, and Francesco Beguinot**

From the Dipartimento di Biologia e Patologia Cellulare e Molecolare and Istituto di Endocrinologia ed Oncologia Sperimentale del CNR, Università degli Studi di Napoli Federico II, Naples 80131, Italy, the ^¶Dipartimento di Scienze Biologiche ed Ambientali, Università degli Studi del Sannio, Benevento 82100, Italy, and the ^||Department of Molecular Biology and Microbiology, University of Central Florida, Orlando, Florida 32826

Received for publication, June 7, 2004 , and in revised form, August 2, 2004.

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
ped/pea-15 is a ubiquitously expressed 15-kDa protein featuring a broad anti-apoptotic function. In a yeast two-hybrid screen, the pro-apoptotic Omi/HtrA2 mitochondrial serine protease was identified as a specific interactor of the ped/pea-15 death effector domain. Omi/HtrA2 also bound recombinant ped/pea-15 in vitro and co-precipitated with ped/pea-15 in 293 and HeLa cell extracts. In these cells, the binding of Omi/HtrA2 to ped/pea-15 was induced by UVC exposure and followed the mitochondrial release of Omi/HtrA2 into the cytoplasm. Upon UVC exposure, cellular ped/pea-15 protein expression levels decreased. This effect was prevented by the ucf-101 specific inhibitor of the Omi/HtrA2 proteolytic activity, in a dose-dependent fashion. In vitro incubation of ped/pea-15 with Omi/HtrA2 resulted in ped/pea-15 degradation. In intact cells, the inhibitory action of ped/pea-15 on UVC-induced apoptosis progressively declined at increasing Omi/HtrA2 expression. This further effect of Omi/HtrA2 was also inhibited by ucf-101. In addition, ped/pea-15 expression blocked Omi/HtrA2 co-precipitation with the caspase inhibitor protein XIAP and caspase 3 activation. Thus, in part, apoptosis following Omi/HtrA2 mitochondrial release is mediated by reduction in ped/pea-15 cellular levels. The ability of Omi/HtrA2 to relieve XIAP inhibition on caspases is modulated by the relative levels of Omi/HtrA2 and ped/pea-15.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
Apoptosis is mediated by proteolytic activation of caspases. Activated caspases catalytically degrade important intracellular substrates and induce cell death (1, 2). The initial proteolytic cleavage of caspases may be induced by the extrinsic cell-surface pathway through the activation of the tumor necrosis family of receptors, and/or by the intrinsic route through the release of different apoptotic proteins from the mitochondria to the cytoplasm (3, 4). Because of its destructive nature, caspase activity must be tightly regulated inside the cells. However, the identity of the molecules involved in restraining apoptosis and their mechanism of action have been only partially elucidated.

ped/pea-15 is a ubiquitously expressed cytosolic protein exerting a broad anti-apoptotic action (5–10). First, by virtue of its death effector domain (DED),¹ ped/pea-15 binds other DED-containing proteins, preventing formation of the death-inducing signaling complex and inhibiting activation of the caspase cascade (8). Indeed ped/pea-15 blocks apoptotic responses initiated by Fas ligand, tumor necrosis factor-, and tumor necrosis factor-related apoptosis-inducing ligand (7, 8, 10). Second, ped/pea-15 inhibits p38 and JNK activation by stress-inducing agents at a very upstream step in the stress-activated protein kinase activation cascade (9). Thus ped/pea-15 exerts its anti-apoptotic function by acting at multiple steps in the processes leading to caspase activation. Whether ped/pea-15 also affects apoptotic mechanisms triggered upon release of mitochondrial proteins is unknown at the present.

The Omi/HtrA2 serine protease is an antagonist of the inhibitor of apoptosis proteins (IAPs) identified in mammals (11, 12). Omi/HtrA2 is a nuclear-encoded mitochondrial protein. Cellular stresses, such as UV exposure, induces cleavage of the Omi/HtrA2 mitochondrial localization sequence thereby generating a mature active molecule featuring a new apoptogenic NH₂ terminus, termed the IAP-binding motif (13). This motif consists of a short stretch of hydrophobic amino acids. Hence, Omi/HtrA2 is released into the cytosol and competitively binds to the BIR domain of IAPs through the IAP-binding motif (14–16). This event leads to the release and reactivation of the BIR-bound caspases. Thus, Omi/HtrA2 binding displaces IAPs from caspases releasing the suppressive effect on caspase activity. Furthermore, Omi/HtrA2 can also trigger apoptosis in a caspase-independent pathway, which entirely depends on its serine protease function (17–20). However, neither the mechanism nor the significance of this function is clearly understood.

In this article, we show that, upon release into the cytoplasm of 293 cells, Omi/HtrA2 binds to and degrades ped/pea-15, thereby removing its anti-apoptotic action and triggering apoptosis. Thus, in addition to controlling the extrinsic pathway, ped/pea-15 is also embedded into the intrinsic pathway inducing caspase activation. We show that the relative levels of ped/pea-15 and Omi/HtrA2 play an important role in committing the cells to undergo apoptosis or survival.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
Materials—Media, sera, and antibiotics for cell culture and the LipofectAMINE reagent were from Invitrogen. PED polyclonal antibodies have been previously described (6). Rabbit Omi/HtrA2 antisera were raised by PRIMM (Milan, Italy), using the OVA-conjugated peptide NH₂-HRGEKKNSSSGISGSQRRY-COOH. Mouse monoclonal antibodies toward XIAP were purchased from BD Biosciences and caspase 3 antibodies were from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). The pcDNAIII vector encoding Omi/HtrA2 cDNA was a generous gift of Dr. I. Iaccarino (Imperial Cancer Research Fund, London, UK), and was reported by Martins et al. (20). The pGBKT7 yeast expression plasmids encoding FADD and FLICE have been previously reported (21). The yeast strain AH109, the human HeLa cDNA library in the pGADT7 vector, and the Matchmaker Gal4 two-hybrid system 3 were from Clontech (Palo Alto, CA). Generation of pGBKT7 yeast expression plasmids encoding the ped/pea-15 FL or DED cDNAs or the ped/pea-15-(80–130) COOH terminus cDNA were obtained by amplifying ped/pea-15, respectively, with the following sets of primers. ped/pea-15 5' NdeI (5'-GGGAATTCCATATGGTTGAGTACGGG-3') and 3'ped/pea-15 BamHI (5'CGCGGATCCTCAGGCCTTCTTCGCTGG GGGACC-3'); ped/pea-15 5' NdeI (5'GGGAATTCCATATGGTTGAGTAC GGG-3') and ped/pea-15 3' EcoRI (5'CCGGAATTCTCAAACCACCATAGTGAGTAGGTC-3'); ped/pea-15 5' EcoRI (5'CCGGAATTCGACTACAGAA CCCGTGTGCTG-3') and ped/pea-15 3' BamHI (5'CGCGGATCCTCAGGCCTTCTTCGCTGGGGGACC-3'). SDS-PAGE reagents were purchase from BioRad. Radiochemicals, Western blotting, and ECL reagents were from Amersham Biosciences. All other chemicals were from Sigma.

Cell Culture and Transfection, Cell Death, and Caspase 3 Cleavage Assays—The 293 kidney embryonic cells stably expressing ped/pea-15 cDNA have been previously described (9). The 293 and HeLa cells were grown in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum, 100 IU/ml penicillin, 100 IU/ml streptomycin, and 2% L-glutamine in a humidified CO₂ incubator. Transient transfection experiments with Omi/HtrA2 and ped/pea-15 cDNAs were performed using the LipofectAMINE method according to the manufacturer's instructions (Invitrogen). Briefly, the cells were cultured in 60-mm dishes up to 80% confluence and incubated for 24 h with the indicated amounts of cDNA and 15 µl of LipofectAMINE in serum-free Dulbecco's modified Eagle's medium. An equal volume of Dulbecco's modified Eagle's medium supplemented with 20% fetal calf serum was added for 5 h. The medium was then replaced with Dulbecco's modified Eagle's medium supplemented with 10% serum and the cells were further incubated for 24 h before the assay.

For detecting apoptosis, the cells were exposed to UVC (100 J/m²), as indicated in the description of the individual experiments. Apoptosis was then estimated using the Apoptosis ELISA Plus kit (Roche Diagnostics), according to the manufacturer's instructions. For caspase 3 cleavage, subconfluent cells were exposed to UVC as above. The cells were lysed in 1% Triton X-100, 150 mM NaCl, 10% glycerol, 20 mM Tris-HCl, pH 7.5, 2 mM EDTA, 1 mM phenylmethylsulfonyl fluoride. After centrifugation at 16,000 x g for 15 min at 4 °C, supernatants were subjected to Western blotting with caspase 3 antibodies.

Transformation of Yeast Strains and -Galactosidase Assay—Plasmid DNA transformations were performed using an high efficiency lithium acetate procedure (22). Cotransformants were propagated on Trp^–, Leu^– plates, and potential interacting clones selected in Trp^–, Leu^–, His^–, Ade^– media. After 4 days of incubation at 30 °C, positive clones were further tested for -galactosidase activity by liquid culture assays using the substrate o-nitrophenyl--D-galactopyranoside as described by Miller et al. (23). Clones of interest were analyzed by DNA sequencing and BLAST analysis.

Cell Subfractionation and Western Blot Analysis—Subcellular fractions were obtained as described in Refs. 24 and 25. Briefly, cells were lysed in ice-cold 10 mM HEPES, pH 7.4, 5 mM MgCl₂, 40 mM KCl, 1 mM phenylmethylsulfonyl fluoride, 10 µg/ml aprotinin, 10 µg/ml leupeptin. Lysed cells were centrifuged at 200 x g to pellet nuclei. Supernatants were centrifuged at 10,000 x g to pellet the heavy membrane fraction containing mitochondria, and the resulting liquid phase was further centrifuged at 150,000 x g to pellet plasma membranes. The last supernatant represented the cytosolic fraction (24). Mitochondria were further purified by resuspending heavy membrane pellets in 250 mM mannitol, 0.5 mM EGTA, 5 mM HEPES, pH 7.4, 0.1% bovine serum albumin, and layering on 30% Percoll, 225 mM mannitol, 1 mM EGTA, 25 mM HEPES, pH 7.4, 0.1% bovine serum albumin. After centrifugation at 95,000 x g, mitochondria were recovered from the lower phase (26). Mitochondria were then centrifuged, washed, and resuspended in 50 mM potassium phosphate, pH 7.4, and used in the experiments described below. Purity of the mitochondrial fraction was assessed by assaying succinate dehydrogenase and cytochrome c oxidase activities (27, 28). Results showed that >99% activity of these enzymes associated with the mitochondrial fractions and <1% of the total activities with the other fractions.

For Western blot assays, the cells were solubilized in lysis buffer (50 mM HEPES, pH 7.5, 150 mM NaCl, 4 mM EDTA, 10 mM Na₄PO₇, 2 mM Na₃VO₄, 100 mM NaF, 10% glycerol, 1% Triton X-100, 1 mM phenylmethylsulfonyl fluoride, 100 µg/ml aprotinin, 1 mM leupeptin) for 30 min at 4 °C. Lysates were centrifuged at 5,000 x g for 15 min and solubilized proteins were separated by SDS-PAGE and transferred on 0.45-µm Immobilion-P membranes (Millipore, Bedford, MA). Upon incubation with primary and secondary antibodies, immunoreactive bands were detected by ECL according to the manufacturer's instructions.

In Vitro Interaction of Omi/HtrA2 and ped/pea-15 and Protease Assay—To analyze ped/pea-15 interaction with Omi/HtrA2, a ped/pea-15-glutatione S-transferase (GST) fusion protein was generated as described in Ref. 29. Cell lysates (500 µg of protein) were incubated in the presence of Sepharose-bound GST-ped/pea-15 (2 µg) for 2 h at 4 °C. The beads were washed four times with TNT buffer (0.5% Nonidet P-40, 25 mM Tris, pH 7.5, 30 mM MgCl₂, 40 mM NaCl, 1 mM dithiothreitol) and then resuspended in Laemmli buffer followed by boiling for 4 min and centrifugation at 25,000 x g for 3 min. Supernatants were separated by SDS-PAGE followed by blotting with Omi/HtrA2 antibodies.

Omi/HtrA2 protease activity was assayed by incubating 2 µg of recombinant his-Omi/HtrA2-(134–458) protein with 10 µg of recombinant ped/pea-15 in 20 mM HEPES, pH 7.4, 10 mM KCl, 1.5 mM MgCl₂, 1 mM EDTA, 1 mM EGTA for 1 h at 37 °C. The reactions were stopped with SDS-sample buffer and samples were boiled for 5 min. The reaction products were analyzed be SDS-PAGE followed by Western blot analysis using ped/pea-15 antibodies. Alternatively, the reaction products were resolved by SDS-PAGE followed by Coomassie Blue staining.

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
Isolation and Identification of Omi/HtrA2 as a Novel ped/pea-15 Interacting Protein—To search for proteins that specifically interact with ped/pea-15, a yeast two-hybrid system was established using the full-length (FL) ped/pea-15 gene (pG-BKT7-ped/pea-15) as bait to screen a human HeLa library (Clontech). Upon HIS3 selection, 45 -galactosidase positive cDNA clones were detected. Based upon sequence analysis and BLAST searching, 6 of these clones were shown to match the Omi/HtrA2 serine protease (11, 12, 30).

We also sought to define the region responsible for the interaction of Omi/HtrA2 with ped/pea-15. We generated two further pGBKT7 plasmids encoding either the DED (amino acids 1–80), or the COOH terminus region of ped/pea-15 (amino acids 80–130). We then compared the ability of the pGADT7-Omi/HtrA2 to interact with the full-length, DED, and the COOH terminus regions of ped/pea-15 in the yeast system. Measurement of -galactosidase activity revealed that Omi/HtrA2 interacted with both the FL and ped/pea-15 DED fusion proteins (Fig. 1). However, no Omi/HtrA2 interaction was detected when the ped/pea-15 COOH terminus was used as bait. No interaction was also detected when the DEDs of the FADD or FLICE proteins were used, suggesting that Omi/HtrA2 specifically interacts with the ped/pea-15 death effector domain.

View larger version (21K): [in this window] [in a new window]   FIG. 1. Analysis of Omi/HtrA2 interaction with ped/pea-15 fragments. Measurement of the -galactosidase activity in transformed yeasts is shown. The yeast reporter strain AH109 was cotransformed with the pGADT7 plasmid encoding Omi/HtrA2 full-length cDNA in combination with the pGBKT7 plasmid encoding the FL, DED, or COOH terminus regions of ped/pea-15, or the DED of FADD or FLICE. Transformants were isolated on selective plates. Activation of the LacZ reporter gene was monitored by measuring -galactosidase activity in cell lysates using o-nitrophenyl--D-galactopyranoside as substrate. The activities are expressed in Miller's units (23) and are the average ± S.D. of values obtained with samples prepared from five independent transformants.

View larger version (35K): [in this window] [in a new window]   FIG. 2. Interaction of Omi/HtrA2 with ped/pea-15 in HeLa and 293 cells and in vitro. A, HeLa cells expressing endogenous ped/pea-15 and 293 cells, either expressing transfected ped/pea-15 (293ped/pea-15) or not, were exposed to UVC (100 J/m2) and then solubilized as described under "Experimental Procedures." Lysates were immunoprecipitated (IP) with ped/pea-15 antibodies followed by blotting with Omi/HtrA2 antibodies. B, upon transient transfection with Omi/HtrA2 cDNA, 293 cells were solubilized and lysates incubated for 2 h at 4 °C with Sepharose-GST-bound recombinant ped/pea-15 or GST alone, as indicated. Pulled down proteins and total cell extracts were then blotted with Omi/HtrA2 or JNK antibodies as described under "Experimental Procedures." Blots were revealed by ECL and autoradiography. The autoradiographs shown are representative of four (A) and three (B) independent experiments. WB, Western blot.

Omi/HtrA2 Mitochondrial Release Is Accompanied by Reduced ped/pea-15 Cellular Levels—To further investigate the biological significance of Omi/HtrA2 interaction with ped/pea-15, we performed subcellular fractionation experiments in UV-exposed and unexposed cells. In the absence of UV treatment, Omi/HtrA2 was mainly mitochondrial both in the 293_PED and the ped/pea-15 untransfected cells (Fig. 3, A and B). In both cell types, UV exposure led to an almost complete disappearance of mitochondrial Omi/HtrA2 and a parallel appearance of Omi/HtrA2 in the cytoplasmic fraction. At variance, ped/pea-15 was only detected in the cytoplasm of the 293_PED cells, whether UV-treated or not. Indeed, co-precipitation of Omi/HtrA2 with ped/pea-15 only occurred in the cytoplasmic fraction of the 293_PED cells and only upon UV-induced mitochondrial release (Fig. 3C). Importantly, upon UV exposure, ped/pea-15 cellular levels declined in parallel with the release of Omi/HtrA2 into the cytoplasm (Fig. 3B), raising the possibility that Omi/HtrA2 may reduce stability of ped/pea-15.

View larger version (22K): [in this window] [in a new window]   FIG. 3. Subcellular localization of Omi/HtrA2 and ped/pea-15. 293 cells stably overexpressing ped/pea-15 and control 293 cells were exposed to UVC (100 J/m2) and cytosolic and mitochondrial fractions obtained as described under "Experimental Procedures." 80 µg of proteins from each fraction were blotted with Omi/HtrA2 (A) or ped/pea-15 (B) antibodies or, precipitated with ped/pea-15 antibodies followed by blotting with Omi/HtrA2 antibodies (C). Blots were revealed by ECL and autoradiography. The autoradiographs shown are representative of four (A and B) and three (C) independent experiments. IP, immunoprecipitated; WB, Western blot.

View larger version (28K): [in this window] [in a new window]   FIG. 4. Effect of Omi/HtrA2 overexpression on ped/pea-15 levels. A, 293 cells stably expressing ped/pea-15 and HeLa cells were transiently transfected with Omi/HtrA2 cDNA. The cells were then exposed to UVC (100 J/m2), solubilized, and then blotted with ped/pea-15 antibodies. For control, aliquots of the lysates were also blotted with Omi/HtrA2 antibodies. Blots were revealed by ECL and autoradiography. The autoradiographs shown are representative of four independent experiments. B, the 293ped/pea-15 cells were transiently transfected with Omi/HtrA2 and exposed to UVC (100 J/m2) in the absence or presence of the indicated concentrations of ucf-101. The cells were then solubilized and blotted with ped/pea-15 antibodies. Blots were reveled by ECL and autoradiography. The autoradiograph shown is representative of three independent experiments. WB, Western blot.

View larger version (35K): [in this window] [in a new window]   FIG. 5. Effect of Omi/HtrA2 on ped/pea-15 in vitro. A, recombinant ped/pea-15 (rped/pea-15; 10 mg) was incubated with the recombinant Omi/HtrA2-(134–458) active fragment (rOmi/HtrA2-(134–458); 2 µg) for 60 min at 37 °C. The reaction was stopped with Laemmli buffer at 100 °C and proteins were separated by SDS-PAGE followed by blotting with ped/pea-15 antibodies or Coomassie Blue staining. For control, GST was also incubated with rOmi/HtrA2-(134–458) as above, followed by blotting with GST antibodies (B). Blots were revealed by ECL and autoradiography. The images shown are representative of four (A) and three (B) independent experiments.

View larger version (44K): [in this window] [in a new window]   FIG. 6. Effect of Omi/HtrA2 on ped/pea-15 function. 293 cells stably expressing either the control vector (pc) or ped/pea-15 were transiently transfected with 8 µg of pcDNAIII (293ped/pea-15+pc) or the indicated amounts of Omi/HtrA2 cDNA and further incubated with 20 µM ucf-101 for 60 min, as indicated. The cells were then exposed to UVC (100 J/m2) and apoptosis was quantitated by the ELISA Plus detection kit as described under "Experimental Procedures." For control, aliquots of the samples were solubilized, blotted with Omi/HtrA2 antibodies, and revealed by ECL and autoradiography (top panel). Bars represent the mean ± S.D. of duplicate determinations in four independent experiments. The blot in the top panel represents duplicate controls for Omi/HtrA2 expression in UVC-treated cells and are representative of three independent experiments. WB, Western blot.

View larger version (38K): [in this window] [in a new window]   FIG. 7. Modulation of the anti-apoptotic function of endogenous ped/pea-15 by Omi/HtrA2 in HeLa cells. A, HeLa cells were transiently transfected with the indicated amounts of Omi/HtrA2 cDNA and further incubated with 20 µM ucf-101 for 60 min, as indicated. The cells were then exposed to UVC (100 J/m2) and apoptosis was quantitated by the ELISA Plus detection kit as described under "Experimental Procedures." Aliquots of the samples were solubilized, blotted with ped/pea-15 antibodies (top panel) or, for control, with Omi/HtrA2 antibodies (B) and revealed by ECL and autoradiography (top panel). Bars represent the mean ± S.D. of duplicate determinations in three independent experiments. WB, Western blot.

View larger version (38K): [in this window] [in a new window]   FIG. 8. Effect of ped/pea-15 on Omi/HtrA2 function. 293 cells were transiently transfected with either the control plasmid (293pc) or Omi/HtrA2 cDNA. Co-transfection with the indicated amounts of ped/pea-15 cDNA was also achieved. The cells were then exposed to UVC (100 J/m2) and apoptosis was quantitated by the ELISA Plus detection kit as described under "Experimental Procedures." For control, aliquots of the samples were solubilized, blotted with ped/pea-15 antibodies, and revealed by ECL and autoradiography (top panel). Bars represent the mean ± S.D. of duplicate determinations in four independent experiments. The blots shown are representative of those obtained in the four experiments. WB, Western blot.

View larger version (42K): [in this window] [in a new window]   FIG. 9. Effect of ped/pea-15 on Omi/HtrA2 co-precipitation with XIAP and caspase 3 activation. A, 293 cells were transiently transfected with the indicated amounts of ped/pea-15 cDNA and then exposed to UVC (100 J/m2). The cells were solubilized and precipitated with XIAP antibodies, followed by blotting with Omi/HtrA2 antibodies. For control, aliquots of the cell lysates were also blotted with ped/pea-15 or XIAP antibodies, as indicated. B and C, HeLa cells were transfected with ped/pea-15 cDNA or with a control plasmid. Aliquots of the lysates obtained from unexposed or UVC-exposed cells were either precipitated with XIAP antibodies, followed by blotting with Omi/HtrA2 antibodies (B, top panel) or directly blotted with ped/pea-15 (B, middle panel), XIAP (B, bottom panel), and caspase 3 antibodies (C). Blots were revealed by ECL and autoradiography. The autoradiographs shown are representative of three independent experiments. WB, Western blot.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Omi/HtrA2 binding displaces XIAP from caspases, inhibiting the suppressive effect on caspase activity (13–16). There is also evidence that interaction with IAPs is not the only mechanism involved in Omi/HtrA2-induced cell death, as the serine protease activity of Omi/HtrA2, when localized in the cytosol, is sufficient to cause caspase-independent cell death (17). This evidence led to the concept that protease activity plays an important role in regulation of apoptosis by Omi/HtrA2 (32). Indeed, Srinivasula et al. (34) have shown that IAPs are substrates for Omi/HtrA2 and their degradation may contribute to caspase activation by Omi/HtrA2. However, whether other substrates also play a role in Omi/HtrA2-induced cell death is unknown.

In the present work, we have identified the serine protease Omi/HtrA2 as a novel ped/pea-15 interactor, by yeast two-hybrid screening. Furthermore, we show that the anti-apoptotic protein ped/pea-15 co-precipitates with Omi/HtrA2 in mammalian cell extracts and specifically binds Omi/HtrA2 in pull-down assays. Thus, Omi/HtrA2 may also bind ped/pea-15 in mammalian cells. At variance with ERK, another ped/pea-15-binding protein (35), Omi/HtrA2 interaction requires the DED of ped/pea-15. Indeed, a truncated protein, lacking the entire DED, does not interact with Omi/HtrA2 in yeast. Furthermore, the DED of ped/pea-15 but not that of other DED-containing proteins, is sufficient for the interaction to occur, indicating specificity of Omi/HtrA2 for the DED of ped/pea-15.

Interestingly, the mitochondrial release of Omi/HtrA2 in response to UV exposure was accompanied by a significant decrease in cellular ped/pea-15 levels. This effect was amplified upon overexpression of Omi/HtrA2 cDNA and might have been produced either by Omi/HtrA2 decreasing ped/pea-15 synthesis and/or by increasing its degradation. The latter appeared a more likely possibility based upon the information that Omi/HtrA2 features serine-protease activity (11, 18–20). Consistently, we have shown that, (i) ped/pea-15 is a substrate of Omi/HtrA2 serine protease in vitro; and (ii) the reduction in ped/pea-15 levels accompanying UV-induced release of Omi/HtrA2 from mitochondria is blocked by a specific inhibitor of its serine protease activity. Thus, the evidence indicates that, upon being released into the cytoplasm, Omi/HtrA2 binds to and degrades ped/pea-15.

Degradation of ped/pea-15 by Omi/HtrA2 was accompanied by reduction of the ped/pea-15 apoptosis-inhibiting function. Indeed, the protection from UV-induced apoptosis accomplished by ped/pea-15 in both HeLa and 293 cells was progressively abolished by increasing the expression levels of Omi/HtrA2 in the cell, and this effect was blocked by inhibition of the Omi/HtrA2 serine protease. We suggest therefore that, in part, the caspase-independent cell death induced by cytoplasmic release of Omi/HtrA2 is mediated by ped/pea-15 degradation. The relevance of ped/pea-15 to Omi/HtrA2 apoptosis was further underlined by the finding that, in 293 cells, the ability of Omi/HtrA2 to bind XIAP and induce cleavage and activation of caspase 3 progressively declined in close parallel with increasing ped/pea-15 cellular levels and with increasing protection from UV-induced apoptosis. Thus, the relative concentrations of Omi/HtrA2 and ped/pea-15 in the 293 cell cytoplasm play an important role in committing the cells to apoptosis.

Compartmentalization appears to be a major mechanism through which control of this balance is accomplished in the 293 cells. Indeed, in the present work, we show that Omi/HtrA2 interaction with ped/pea-15 only occurs in the cytoplasm and upon UV-induced release of Omi/HtrA2 from the mitochondria. Apoptotic signals alter Omi/HtrA2 compartmentalization enabling its protease activity toward different cytoplasmic substrates whose cleavage fosters activation of the apoptotic machinery of the cell.

	FOOTNOTES

 
^* This work was supported in part by the European Community (EUDG and EUGENE2 programs), grants from the Associazione Italiana per la Ricerca sul Cancro (AIRC) (to F. B. and P. F.), the Ministero dell'Università e della Ricerca Scientifica (PRIN (to F. B. and P. F.)) and FIRB RBNE0155LB), and Telethon-Italy. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Recipients of fellowships of the Federazione Italiana per la Ricerca sul Cancro.

^** To whom correspondence should be addressed: Dipartimento di Biologia e Patologia Cellulare e Molecolare, Università di Napoli Federico II, Via Sergio Pansini, 5, Naples 80131, Italy. E-mail: beguino{at}unina.it.

¹ The abbreviations used are: DED, death effector domain; JNK, c-Jun NH₂-terminal kinase; IAP, inhibitor of apoptosis proteins; GST, glutathione S-transferase.

	ACKNOWLEDGMENTS

 
We thank Dr. Hervé Chneiweiss (Inserm U114 Collège de France) for critical reading of the manuscript, Dr. D. Liguoro (IEOS, CNR) for technical help, and Dr. R. Stilo (Biogem) for helpful discussion.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 

1. Cryns, V., and Yuan, J. (1998) Genes Dev. 12, 1551–1570[Free Full Text]
2. Thornberry, N. A., and Lazebnik, Y., (1998) Science 281, 1312–1316[Abstract/Free Full Text]
3. Nagata, S. (1997) Cell 88, 355–365[CrossRef][Medline] [Order article via Infotrieve]
4. Wang, X. (2001) Genes Dev. 15, 2922–2933[Free Full Text]
5. Danziger, N., Yokoyama, M., Jay, T., Cordier, J., Glowinski, J., and Chneiweiss, H. (1995) J. Neurochem. 64, 1016–1025[Medline] [Order article via Infotrieve]
6. Condorelli, G., Vigliotta, G., Iavarone, C., Caruso, M., Tocchetti, C. G., Andreozzi, F., Cafieri, A., Tecce, M. F., Formisano, P., Beguinot, L., and Beguinot, F. (1998) EMBO J. 17, 3858–3866[CrossRef][Medline] [Order article via Infotrieve]
7. Kitsberg, D., Formstecher, E., Fauquet, M., Kubes, M., Cordier, J., Canton, B., Pan, G., Rolli, M., Glowinski, J., and Chneiweiss, H. (1999) J. Neurosci. 19, 8244–8251[Abstract/Free Full Text]
8. Condorelli, G., Vigliotta, G., Cafieri, A., Trencia, A., Andalo, P., Oriente, F., Miele, C., Caruso, M., Formisano, P., and Beguinot, F. (1999) Oncogene 18, 4409–4415[CrossRef][Medline] [Order article via Infotrieve]
9. Condorelli, G., Trencia, A., Vigliotta, G., Perfetti, A., Goglia, U., Cassese, A., Musti, A. M., Miele, C., Santopietro, S., Formisano, P., and Beguinot, F. (2002) J. Biol. Chem. 277, 11013–11018[Abstract/Free Full Text]
10. Hao, C., Beguinot, F., Condorelli, G., Trencia, A., Van Meir, E. G., Yong, V. W., Parney, I. F., Roa, W. H., and Petruk, K. C. (2001) Cancer Res. 61, 1162–1170[Abstract/Free Full Text]
11. Gray, C. W., Ward, R. V., Karran, E., Turconi, S., Rowles, A., Viglienghi, D., Southan, C., Barton, A., Fantom, K. G., West, A., Savopoulos, J., Hassan, N. J., Clinkenbeard, H., Hanning, C., Amegadzie, B., Davis, J. B., Dingwall, C., Livi, G. P., and Creasy, C. L. (2000) Eur. J. Biochem. 267, 5699–5710[Medline] [Order article via Infotrieve]
12. Faccio, L., Fusco, C., Chen, A., Martinotti, S., Bonventre, J. V., and Zervos, A. S. (2000) J. Biol. Chem. 275, 2581–2588[Abstract/Free Full Text]
13. Yang, Q. H., Church-Hajduk, R., Ren, J., Newton, M. L., and Du, C. (2003) Genes Dev. 17, 487–496
14. Liu, Z., Sun, C., Olejniczak, E. T., Meadows, R. P., Betz, S. F., Oost, T., Herrmann, J., Wu, J. C., and Fesik, S. W. (2000) Nature 408, 1004–1008[CrossRef][Medline] [Order article via Infotrieve]
15. Wu, G., Chai, J., Suber, T. L., Wu, J. W., Du, C., Wang, X., and Shi, Y. (2000) Nature 408, 1008–1012[CrossRef][Medline] [Order article via Infotrieve]
16. Srinivasula, S. M., Hegde, R., Saleh, A., Datta, P., Shiozaki, E., Chai, J., Lee, R. A., Robbins, P. D., Fernandes-Alnemri, T., Shi, Y., and Alnemri, E. S. (2001) Nature 410, 112–116[CrossRef][Medline] [Order article via Infotrieve]
17. Li, W., Srinivasula, S. M., Chai, J., Li, P., Wu, J. W., Zhang, Z., Alnemri, E. S., and Shi, Y. (2002) Nat. Struct. Biol. 9, 436–441[CrossRef][Medline] [Order article via Infotrieve]
18. Suzuki, Y., Imai, Y., Nakayama, H., Takahashi, K., Takio, K., and Takahashi, R. (2001) Mol. Cell 8, 613–621[CrossRef][Medline] [Order article via Infotrieve]
19. Hegde, R., Srinivasula, S. M., Zhang, Z., Wassell, R., Mukattash, R., Cilenti, L., DuBois, G., Lazebnik, Y., Zervos, A. S., Fernandes-Alnemri, T., and Alnemri, E. S. (2002) J. Biol. Chem. 277, 432–438[Abstract/Free Full Text]
20. Martins, L. M., Iaccarino, I., Tenev, T., Gschmeissner, S., Totty, N. F., Lemoine, N. R., Savopoulos, J., Gray, C. W., Creasy, C. L., Dingwall, C., and Downward, J. (2002) J. Biol. Chem. 277, 439–444[Abstract/Free Full Text]
21. Guiet, C., and Vito, P. (2000) J. Cell Biol. 148, 1131–1140[Abstract/Free Full Text]
22. Gietz, D., St. Jean, A., Woods, R. A., and Schiestl, R. H. (1992) Nucleic Acids Res. 20, 1425[Free Full Text]
23. Miller, J. H. (1972) Experiments in Molecular Genetics, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
24. Ruvolo, P. P., Deng, X., Carr, B. K., and May, W. S. (1998) J. Biol. Chem. 273, 25436–25442[Abstract/Free Full Text]
25. Wang, H. G., Rapp, U. R., and Reed, J. C. (1996) Cell 87, 629–638[CrossRef][Medline] [Order article via Infotrieve]
26. Hovius, R., Lambrechts, H., Nicolay, K., and de Kruijff, B. (1990) Biochim. Biophys. Acta. 1021, 217–226[Medline] [Order article via Infotrieve]
27. Gateau, O., Morelis, R., and Louisot, P. (1978) Eur. J. Biochem. 88, 613–622[Medline] [Order article via Infotrieve]
28. Pennington, R. (1961) Biochem. J. 80, 649–654[Medline] [Order article via Infotrieve]
29. Trencia, A., Perfetti, A., Cassese, A., Vigliotta, G., Miele, C., Oriente, F., Santopietro, S., Giacco, F., Condorelli, G., Formisano, P., and Beguinot, F. (2003) Mol. Cell. Biol. 23, 4511–4521[Abstract/Free Full Text]
30. van Loo, G., van Gurp, M., Depuydt, B., Srinivasula, S. M., Rodriguez, I., Alnemri, E. S., Gevaert, K., Vandekerckhove, J., Declercq, W., and Vandenabeele, P. (2002) Cell Death Differ. 9, 20–26[CrossRef][Medline] [Order article via Infotrieve]
31. Condorelli, G., Vigliotta, G., Trencia, A., Maitan, M. A., Caruso, M., Miele, C., Oriente, F., Santopietro, S., Formisano, P., and Beguinot, F. (2001) Diabetes 50, 1244–1252[Abstract/Free Full Text]
32. Cilenti, L., Lee, Y., Hess, S., Srinivasula, S., Park, K. M., Junqueira, D., Davis, H., Bonventre, J. V., Alnemri, E. S., and Zervos, A. S. (2003) J. Biol. Chem. 278, 1489–1494
33. Jones, J. M., Datta, P., Srinivasula, S. M., Ji, W, Gupta, S., Zhang, Z., Davies, E., Hajnoczky, G., Saunders, T. L., Van Keuren, M. L., Fernandes-Alnemri, T., Meisler, M. H., and Alnemri, E. S. (2003) Nature 425, 721–727[CrossRef][Medline] [Order article via Infotrieve]
34. Srinivasula, S. M., Gupta, S., Datta, P., Zhang, Z., Hegde, R., Cheong, N., Fernandes-Alnemri, T., and Alnemri, E. S. (2003) J. Biol. Chem. 278, 31469–31472[Abstract/Free Full Text]
35. Formstecher, E., Ramos, J. W., Fauquet, M., Calderwood, D. A., Hsieh, J. C., Canton, B., Nguyen, X. T., Barnier, J. V., Camonis, J., Ginsberg, M. H., and Chneiweiss, H. (2001) Dev. Cell 1, 239–250[CrossRef][Medline] [Order article via Infotrieve]

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				F. Viparelli, A. Cassese, N. Doti, F. Paturzo, D. Marasco, N. A. Dathan, S. M. Monti, G. Basile, P. Ungaro, M. Sabatella, et al. Targeting of PED/PEA-15 Molecular Interaction with Phospholipase D1 Enhances Insulin Sensitivity in Skeletal Muscle Cells J. Biol. Chem., August 1, 2008; 283(31): 21769 - 21778. [Abstract] [Full Text] [PDF]

				V. Buggia-Prevot, J. Sevalle, S. Rossner, and F. Checler NF{kappa}B-dependent Control of BACE1 Promoter Transactivation by A{beta}42 J. Biol. Chem., April 11, 2008; 283(15): 10037 - 10047. [Abstract] [Full Text] [PDF]

				L. Yang, M. Sun, X.-m. Sun, G. Z. Cheng, S. V. Nicosia, and J. Q. Cheng Akt Attenuation of the Serine Protease Activity of HtrA2/Omi through Phosphorylation of Serine 212 J. Biol. Chem., April 13, 2007; 282(15): 10981 - 10987. [Abstract] [Full Text] [PDF]

				J. Dunys, T. Kawarai, J. Sevalle, V. Dolcini, P. St. George-Hyslop, C. A. Da Costa, and F. Checler p53-dependent Aph-1 and Pen-2 Anti-apoptotic Phenotype Requires the Integrity of the {gamma}-Secretase Complex but Is Independent of Its Activity J. Biol. Chem., April 6, 2007; 282(14): 10516 - 10525. [Abstract] [Full Text] [PDF]

				A. Perfetti, F. Oriente, S. Iovino, A. T. Alberobello, A. P. M. Barbagallo, I. Esposito, F. Fiory, R. Teperino, P. Ungaro, C. Miele, et al. Phorbol Esters Induce Intracellular Accumulation of the Anti-apoptotic Protein PED/PEA-15 by Preventing Ubiquitinylation and Proteasomal Degradation J. Biol. Chem., March 23, 2007; 282(12): 8648 - 8657. [Abstract] [Full Text] [PDF]

				H.-J. Park, S.-S. Kim, Y.-M. Seong, K.-H. Kim, H. G. Goo, E. J. Yoon, D. S. Min, S. Kang, and H. Rhim beta-Amyloid Precursor Protein Is a Direct Cleavage Target of HtrA2 Serine Protease: IMPLICATIONS FOR THE PHYSIOLOGICAL FUNCTION OF HtrA2 IN THE MITOCHONDRIA J. Biol. Chem., November 10, 2006; 281(45): 34277 - 34287. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 279/45/46566    most recent M406317200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Trencia, A. Articles by Beguinot, F. Search for Related Content PubMed PubMed Citation Articles by Trencia, A. Articles by Beguinot, F. Social Bookmarking