| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
J. Biol. Chem., Vol. 279, Issue 45, 46595-46605, November 5, 2004
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the Department of Biochemistry and Molecular Biology, College of Medicine, University of South Alabama, Mobile, Alabama 36688
Received for publication, July 22, 2004 , and in revised form, August 20, 2004.
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
In humans, there are four major families of MAPKs, the extracellular signal-regulated protein kinases (ERK1/2), the c-Jun N-terminal kinases/stress-activated protein kinases (JNK1/2/3), the p38 family of kinases (p38
/
/
/
), and ERK5 (1). The ERKs are generally responsive to growth factors and contribute to proliferation, development, differentiation, and cell survival. Both the JNKs and the p38s are activated in response to cytokines and stress, with the activation of JNKs contributing to apoptosis, inflammation, and tumorigenesis. The activation of p38s affects cell motility, apoptosis, chromatin remodeling, and osmoregulation (1). In addition to the direct activation of designated downstream kinases, there is considerable cross-talk among the various MAP kinase signaling cascades.
Since the MAPKs, MAPKKs, and MAPKKKs are activated by phosphorylation, the protein phosphatases that act to dephosphorylate these kinases represent critical elements in the control of MAPK-signaling networks. Surprisingly, little is known about the phosphatases involved, especially at the level of the MAPKKs and MAPKKKs. Ser/Thr phosphatase 5 (PP5) is an okadaic acid/microcystin/calyculin A-sensitive phosphatase (2, 3) that belongs to the PPP family of enzymes (3, 4). Like the other PPP-phosphatases (PP1, PP2A, PP2B/calcineurin, PP4, PP6, and PP7), PP5 is highly conserved among species, and PP5 is expressed in most, if not all, mammalian cells. In vitro PP5 can dephosphorylate many phosphoproteins associated with the propagation of cellular responses to stress (i.e. p53 (5, 6), apoptosis signal-regulating kinase 1 (ASK-1) (7), ATM (8), and DNA-PK (9)). However, recent structural studies indicate that the catalytic site of PP5 is located in a shallow pocket on the surface that could easily accommodate nonphysiological substrates in vitro (10). Thus, the ability to dephosphorylate a protein in vitro may not accurately reflect a specific role for PP5 in vivo. Nonetheless, PP5 associates with many proteins that affect cellular signaling networks, including the glucocorticoid receptor (GR)-heat shock protein 90 (Hsp-90) heterocomplex (11, 12), the CDC16/CDC27 subunits of the anaphase-promoting complex (13), cryptochrome 2 (14), Hsp90-dependent heme-regulated eukaryotic initiation factor 2 kinase (15), apoptosis signal-regulating kinase 1 (ASK-1) (7, 16), the A-regulatory subunit of protein phosphatase type 2A (16, 17), the G12/G13 subunits of heterotrimeric G proteins (18), DNA-dependent protein kinase (9), and hRad17/ATM (8). These associations suggest that PP5 may play an underappreciated role in the regulation of signal transduction cascades that regulate cellular responses to stress.
In a MCF-7 mouse xenograph tumor model, the overexpression of PP5 is associated with a marked increase in the rate of tumor growth, with a statistical difference in tumor size noted in <14 days (19). This suggested that the overexpression of PP5 aids xenograph tumor growth. Since the vascular system in mouse xenograph tumors is usually aberrant and provides poor blood flow to the developing tumor, regions within the tumors become hypoxic. Here, we show that hypoxia induces a transient increase in ASK-1/MKK4/JNK activity and that PP5 acts to turn off ASK-1/MKK-4/JNK signaling. Together, the studies presented suggest that the growth advantage of MCF-7 xenograph tumors in which PP5 expression is constitutively elevated (19) may be derived from PP5 acting as a negative regulator of an ASK-1/MKK4/JNK signaling cascade that facilitates an apoptotic response in hypoxic cells.
|
EXPERIMENTAL PROCEDURES |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
) were purchased from BD Transduction Laboratories (Lexington, KY). Antibodies recognizing p38, c-Jun, and proteins phosphorylated at specific sites (c-Jun at Ser-63; SEK1/MKK4 at Thr-261; and p38 MAPK at Thr-180/Tyr-182, p44/p42-MAPK/ERK1/2 at Thr-202/Tyr-204, and JNK at Thr-183/Tyr-185)) and anti-poly(ADP-ribose) polymerase antibody were purchased from Cell Signaling (Beverly, MA). Antibodies recognizing ASK-1 and hemagglutinin (HA) were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA) and Sigma. Anti-HA affinity matrix was purchased from Roche Applied Science. Microcystin-Sepharose was purchased from Upstate (Waltham, MA). Tissue culture medium, Lipofectin®, and TRIzol® were purchased from Invitrogen. Rabbit polyclonal antibodies recognizing PP5 were generated against a synthetic 15-amino acid peptide identical to the C-terminal region of PP5 (20, 21). Cell Culture—Human A549 lung carcinoma cells, Hep3B hepatoma, HEK 293, and MCF-7 breast carcinoma cell lines were obtained from the American Type Tissue Collection. MCF-7 and A549 cells were cultured in Dulbecco's modified Eagle's medium (DMEM) containing L-glutamine supplemented with 10% fetal calf serum, streptomycin (0.1 µg/ml), and penicillin (100 units/ml). Hep3B cells were cultured in minimal essential medium with L-glutamine and supplemented with 10% fetal calf serum, pyruvate (1 mM), and nonessential amino acids (0.1 mM). All cell cultures were routinely passed when 85–90% confluent unless indicated otherwise. MCF-7-PP5h1 cells were developed and cultured as described previously (20).
Western Blotting—Cells grown in 60-mm plates were washed twice with ice-cold phosphate-buffered saline and then lysed by scraping in 250 µl of lysis buffer (120 mM Tris-HCl, pH 7.4, 20% glycerol, 4% SDS, 10 mM -glycerol phosphate, and 1 µl/ml protease inhibitor mixture (Sigma)). Lysates were clarified by centrifugation at 13,000 x g for 5 min, and an aliquot of the supernatant was removed for protein determination. Protein concentrations were determined using a Bio-Rad Dc protein assay, using bovine serum albumin for standards. The remaining supernatant was added to an equal volume of 2x sample buffer (120 mM Tris-HCl, pH 7.4, 200 mM dithiothreitol, 20% glycerol, 4% SDS, and 0.02% bromphenol blue). Typically, 25–50 µg of protein was then separated by electrophoresis on 10% SDS-polyacrylamide gels. Proteins were then electrophoretically transferred to Immobilon-P (Millipore Corp.) and placed in blocking buffer (Tris-HCl, pH 7.4, 150 mM NaCl, and 5% nonfat milk or 5% bovine serum albumin) for 1 h. Immunoblotting was performed with the indicated primary antibody using either goat anti-mouse (Pharmingen, San Diego, CA) or goat anti-rabbit secondary (Promega, Madison, WI) antibodies. Antibody association was detected employing ECL (Amersham Biosciences) or Super Signal West Dura (Pierce) Western blotting detection reagents following the protocols of the manufacturer. Quantification of the signal was achieved using a Fuji-LAS-1000 imaging system.
Electrophoretic Mobility Shift Assay—Nuclear extracts for electrophoretic mobility shift assay assays were prepared essentially as described previously (21). Briefly, Hep3B or A549 cells were cultured in 60-mm dishes (three dishes per group) and treated with the indicated agents. At the times indicated, the cells were washed with ice-cold phosphate-buffered saline, scraped in 0.5 ml of ice-cold phosphate-buffered saline, and collected by centrifugation at 4 °C for 10 min at 2000 x g. The pellet was washed with five packed cell volumes of buffer A (10 mM Tris-HCl, pH 7.5, 1.5 mM MgCl2, 10 mM KCl, 2 mM DTT, 400 µM phenylmethylsulfonyl fluoride, 2 µg/ml leupeptin, 2 µg/ml pepstatin, and 1 mM activated Na3VO4) and resuspended in 4 packed cell volumes of buffer A. After sitting on ice for 10 min, the nuclei were collected by centrifugation at 10,000 x g for 10 min at 4 °C. The nuclear fraction was washed twice, and the nuclei were resuspended in 3 packed nuclear volumes of buffer C (0.42 M KCl, 20 mM Tris-HCl, 20% (v/v) glycerol, 1.5 mM MgCl2, pH 7.5). The suspension was rotated for 30 min at 4 °C and then subjected to centrifugation at 15,000 x g for 30 min at 4 °C. The supernatant was aliquoted and stored at –80 °C. Double-stranded DNA probes for electrophoretic mobility shift assay were generated by radiolabeling synthetic oligonucleotides encoding the HRE contained in the promoter of PP5 or erythropoietin (EPO) (sequences provided in Fig. 2) using a DECA-Prime® labeling kit (Ambion). Binding reactions were performed under stringent conditions by incubating 5.0 µg of nuclear extract with 
1.0 ng of 32P-labeled probe (104 cpm) in buffer D (25 mM Tris-HCl, 100 mM KCl, 0.2 mM EDTA, 20% glycerol, 1 mM dithiothreitol, 1 mM phenylmethylsulfonyl fluoride, and 1.2 mM sodium vanadate, pH 7.6; final volume 19 µl) for 5 min at room temperature and then for 15 min on ice. For competition experiments, unlabeled probes (in 20-fold excess) were added to the mixture. For shift analysis, after the addition of probe, 0.25 µg of HIF-1 antibody was added to the mixture, and binding was conducted on ice for 20 min. Samples were separated by electrophoresis on a 4% native polyacrylamide gel and visualized by autoradiography. The sequence of the sense strand for each probe is listed: RH309, CCTGCGCAGGCGCGT-GAAGGGC, PP5 wild type; RH325, GCCCTACGTGCTGTCTCA, EPO HIF-1 response element; RH335, CCAGCGCAGGCGAAAGAAGGGC, RH309 with the consensus HIF-1 binding site altered in three positions; RH337, CGGCGATGGCCTGCGAGCGGAC, PP5 scramble control (random order of nucleotides contained in RH309).
|
N and pcDNA3-ASK1-K HA expression plasmids were generously provided by Dr. Jacques Landry, Centre de Recherché en Cancerologie de l'Universite Laval, L'Hotel-Dieu de Quebec.
Transient Transfections and Luciferase Assay—Cell transfections and Luciferase assays were conducted as described previously (20). Briefly, A549 cells were plated at a density of 2 x 105 cells/60-mm tissue culture dish and incubated overnight in DMEM supplemented with 10% fetal calf serum. After 24 h, the cells were transfected with 1.0 µg of plasmid DNA using LipofectAMINE (Invitrogen) as described previously (20). After 4 h, the transfection medium was replaced with fresh media, and the cells were incubated for another 20 h prior to treatment with the agents indicated. Hypoxic conditions were achieved by incubating cell cultures in an anaerobic pouch (GasPack Pouch; Becton Dickinson). At the times indicated, luciferase activity was measured using the enhanced luciferase assay kit (PharMingen) with a Monolight 2010 luminometer. The ratio of luciferase activity to total protein (as measured with a Bio-Rad Dc assay) was calculated.
Measurement of ASK-1 Activity—ASK-1 activity was measured using myelin basic protein (MBP; Sigma) as a substrate as described previously (22). Briefly, cell lysate, 500 µg of protein, was mixed with 5 µgof anti-ASK1 antibody (Santa Cruz Biotechnology) and 20 µl of protein A/G plus agarose (Santa Cruz Biotechnology) at 4 °C with gentile rocking for 16 h. ASK-1 was collected by centrifugation (3000 x g for 1 min). The pellet was washed three times with IP buffer (20 mM Tris-HCl, pH 7.5, 150 mM NaCl, 5 mM EGTA, 1% Nonidet P-40, 1 mM DTT, 1 mM activated sodium orthovanadate, 2 µl/ml protease inhibitor mixture, 5 µM cantharidin, 5 mM NaF, and 10 mM -glycerophosphate) and then one time with kinase buffer (25 mM Tris-HCl, pH 7.5, 5 mM -glycerol phosphate 1 mM sodium orthovanadate, 2 mM DTT, 10 mM MgCl2). Myelin basic protein (3 µg) was then added, and the kinase reaction was initiated by the addition of ATP (50 µM) containing 1–5 µCi of [-32P]ATP. The reaction was allowed to proceed for 20 min at 30 °C. The reaction was then terminated by the addition of 30 µl of 2x SDS-PAGE sample buffer and heating. Unincorporated 32P was separated by electrophoresis (SDS-PAGE) using 12% gels. Radioactivity incorporated into MBP was quantified using a Fuji FLA-5000 phosphor-imaging system. ASK-1 activity is reported as the ratio of the amount of phosphate incorporated into MBP divided by the amount of ASK-1 protein in the assay.
Microcystin-Sepharose Pull-down Assays—Microcystin pull-down assays were conducted essentially as described previously (23). Briefly, cells were seeded at a density of 300,000 cells/dish in 60-mm dishes and allowed to grow for 48 h. The dishes were washed twice with phosphate-buffered saline and scraped from the dish in 400 µl of extraction buffer (50 mM Tris-HCl, pH 7.0, 2 mM EDTA, 2 mM EGTA, 2 mM MgCl2, 1 mM DTT, 6.3 µg/ml aprotinin, 2 µg/ml leupeptin, 5 mM benzamidine, 1 mM phenylmethylsulfonyl fluoride, 2 µg/ml pepstatin A). The cells were then lysed on ice with a Kontes tissue grinder (30 strokes in a 2-ml tube). The lysates were subjected to centrifugation (15,000 x g for 10 min), the supernatant was collected, and protein concentration in the crude lysate was determined using a Bio-Rad Dc protein assay. Aliquots of lysate containing 1 mg of protein were then mixed with 30 µl of 50% Sepharose 4B slurry and mixed at 4 °C for 1 h to remove nonspecific binding. The Sepharose 4B was collected by centrifugation, and the supernatant was mixed with 30 µl of microcystin-Sepharose (equilibrated with extraction buffer) by circular end-over-end rotation at 4 °C for 16 h. The microcystin-Sepharose was collected by centrifugation (10,000 x g for 10 min), and the pellet was washed six times with 600 µl of washing buffer (150 mM NaCl, 20 mM Tris-HCl, pH 7.0, 0.1 mM EGTA, 1 mM DTT, 6.3 µg/ml aprotinin, 4 µg/ml leupeptin, 10 mM benzamidine, 1 mM phenylmethylsulfonyl fluoride, 4 µg/ml pepstatin A). Proteins were eluted from the pellets with 2x SDS sample buffer and separated by SDS-PAGE using 10% gels.
Real Time PCR—Total RNA was extracted from cells with TRIzoL (Invitrogen). First strand cDNAs were synthesized using 0.6 µg RNA as template, random hexamer primers (2.5 µM), and murine leukemia virus reverse transcriptase at 42 °C using GeneAmp (Applied Biosystems, Foster City, CA) according to the procedures provided by the manufacturer. Primers for the amplification of PP5 and -actin are as follows: PP5, 5'-atggggaacaaagcctcctaca-3' and 5'-cgtcacctcacatcattc-ctagc-3'; -actin, 5'-tgtgcccatctacgaggggtatgc-3' and 5'-ggtacatggtggt-gccgccagaca-3'. Reverse transcription-PCR was performed (95 °C for 3 min, 40 cycles of 95 °C for 10 s, 55 °C for 45 s) using an iCycler iQ (Bio-Rad) with SYBR green.
Suppression of PP5 Expression with Double-stranded RNA (siRNA)—siRNA-mediated suppression of PP5 was achieved as described previously (24). Briefly, polyribonucleotides (21 bases in length) were synthesized in both the sense and antisense orientation, with 19 bases homologous to the target mRNA and two 2'-deoxythymidine nucleotides at 3'-ends that produce 3'-overhangs upon annealing. The oligonucleotides were annealed to produce siRNA by placing the complementary ribonucleotides (20 µM) in RNase-free annealing buffer (100 mM potassium acetate, 30 mM HEPES-KOH at pH 7.4, 2 mM magnesium acetate) for 1 min at 90 °C and then at 37 °C for 1 h. The sense strand of the siRNA that effectively suppressed PP5 (PP5TG2) is 5'-GAG GGU GAG GUG AAG GCC ATT-3'. For a control, the order of the bases was scrambled. The sense strand for the mismatched control (PP5 TG2MM) is 5'-GGU AGG ACG AGA GGU AGG CTT-3'. For treatment, A549 cells were plated at 200,000–300,000 cells/60-mm dish. Twenty-four hours later, the annealed double-stranded RNA oligonucleotides were transfected using Lipofectin® (Invitrogen), employing the same methods used for the addition of antisense oligonucleotides (6, 20, 21). Briefly, the day after plating, the cells were washed with DMEM and incubated with 1 ml of DMEM containing 15 µl/ml Lipofectin and 2.5 µg of siRNA that was mixed in a Falcon tube via shaking by hand for 1 min just prior to the addition. After incubation at 37 °C for 4 h, the DMEM was removed and replaced with fresh media supplemented as described above (see "Cell Culture").
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
|
758 base pairs 5' of the coding region, and a deletion series of PP5-pLucLink V.2 luciferase reporter plasmids was constructed and tested in transient transfection assays (20). The region between –184 and –110 was identified as an important regulatory domain in the PP5 promoter (i.e. PP5-Luc-184 demonstrated comparable luciferase activity to the "full-length" promoter, whereas PP5-Luc-110 had levels similar to the control Luc link vector (20)). A search for sequences with possible biological significance within this region revealed a single estrogen response element (ERE), which has been shown to produce a similar 1.5–2.0-fold induction of PP5 expression in estrogen-responsive tumor cells (20). The region also contains a consensus HIF-1 response element (Fig. 2) (25–27), and both the HRE and the ERE are contained in a similar orientation in the 5'-flanking region of exon 1 in the mouse PP5 gene.
To determine if the HRE contained in the PP5 promoter is functional, we first performed electrophoretic mobility shift analysis using nuclear extracts from hypoxic cells (in which HIF-1 is transcriptionally active) and from control cells (cultured with 21% oxygen and having minimal HIF-1 activity). In these studies, the binding of a doubled-stranded DNA probe encoding the putative HRE from the PP5 promoter (–143 to –124) was compared with the binding of a well characterized double-stranded oligonucleotide containing the HRE present in the EPO gene (W18 as described in Ref. 28). As seen in Fig. 3A, when added to nuclear extracts produced from hypoxic cells, the mobility shift obtained with the PP5 probe (lanes 2 and 7) was similar to the shift produced with the EPO probe (lane 11). In contrast, when probes were added to nuclear extracts produced from control cell cultures, the shift was greatly reduced or not detected (lanes 1, 6, and 10). To test the specificity of binding, competition studies were performed assessing 1) the ability of unlabelled EPO probe to compete with the binding of the [32P]PP5 probe, 2) the ability of unlabeled PP5 probe to compete with the binding of the [32P]EPO probe, 3) the ability of an unlabeled scrambled probe (same oligonucleotide composition as the PP5 probe constructed in a random order) to compete with the binding of the [32P]PP5 probe, 4) the ability of a mutated PP5 probe (having three altered bases in the core of the consensus HRE) to compete with the binding of the [32P]PP5 probe, and 5) the effect produced by the addition of an HIF-1 specific antibody to the binding assay. These competition studies revealed that the EPO probe was an effective competitor with the PP5 probe and vice versa (compare lane 2 with lane 3, lane 7 with lane 8, and lane 11 with lane 12). Binding was also sequence-specific, for unlike the EPO probe, the scrambled PP5 probe was not an efficient competitor with the PP5 probe (compare lanes 2, 3, and 5), and mutation of three bases in the core of the PP5 HRE (lane 4) diminished competition. The addition of an antibody that specifically recognizes HIF-1 also inhibited the mobility shift produced by both the EPO and the PP5 probe (lanes 9 and 13). Together, these findings suggest that HIF-1 obtained from the nuclear extract of hypoxic cells can recognize and bind to the HRE (–133 to –130) contained in the 5'-flanking region of PP5.
|
Enhanced PP5 Luciferase Activity Correlates with the Activation of HIF-1—In addition to hypoxia, HIF-1 transcriptional activity can be activated by treatment with chemicals suspected of mimicking some aspect of hypoxia (i.e. cobalt chloride (CoCl2) and DFO). HIF-1-dependent gene transcription can also be inhibited by treatment with agents (i.e. 2,3,7,8-tetrachlorodibenzo-p-dioxin) that activate aryl hydrocarbon receptors, which recruit HIF-1/aryl hydrocarbon receptor nuclear translocator protein into a complex with the aryl hydrocarbon receptor and prevents the HIF-1/aryl hydrocarbon receptor nuclear translocator protein subunit from forming an active dimer with HIF-1 (29). To further characterize the relationship between HIF-1 and PP5, we conducted transient transfection studies in A549 cells using both the PP5-Luc-184 and PP5-Luc-184m reporter plasmids in combination with agents that alter HIF-1 transcriptional activity. Transfection studies conducted 24 h after treatment with CoCl2 or DFO or 8 h after the onset of hypoxia revealed PP5-Luc-184 luciferase activity that was 170, 230, and 284% of control level, respectively. In contrast, studies with PP5-Luc-184m revealed little change in luciferase activity following hypoxia or treatment with CoCl2 or DFO (Fig. 3C). Mutation of the HRE also produced a decrease in the basal expression of PP5-luciferase activity, as did treatment with dioxin. Cumulatively, the studies discussed above indicate that transcription of PP5 is responsive to hypoxia and can be mediated by HIF-1.
Hypoxia Induces the Activation of ASK-1—In mammals, hypoxia is associated with the activation of several stress-induced protein kinases, including JNK, p38, and ERK (30). In addition, in a yeast two-hybrid screen PP5 was identified as a binding partner for ASK-1, a MAPKKK that is activated by oxidative stress and has been reported to lead to the activation of both p38 and JNK (7). Therefore, it was suggested that PP5 may act as a negative regulator of ASK1 signaling (7). Still, to date, hypoxia had not been reported to activate ASK-1. Furthermore, the roles of ASK-1 activation in cellular responses to oxidative stress are not clear, for the activation of JNK is generally associated with the promotion of stress-induced apoptosis, whereas the activation of p38 is often associated with an increased chance of cell survival.
To determine if hypoxia influences ASK-1 signaling, we tested the effect of hypoxia on A549 cells, measuring 1) changes in ASK-1 kinase activity directly using [32P]ATP with MBP as a substrate and 2) changes in the phosphorylation of MKK-4 (an immediate downstream target of ASK-1) in cell lysates using Western analysis with antibodies that recognize MKK4 phosphorylated at Thr-261. As seen in Fig. 4A, after 1 h in a hypoxic environment, ASK-1 activity is induced, suggesting that ASK-1 is indeed activated by hypoxia in A549 cells. Furthermore, time course studies measuring MKK phosphorylation at Thr-261 indicate that hypoxia is associated with a rapid increase in MKK4 phosphorylation that peaks in 1 h, returns to basal levels by 3–5 h, and remains at basal levels for at least 24 h (Fig. 4B).
|
|
3 h (lanes 5 and 7), whereas JNK remained highly phosphorylated in cells where PP5 expression was suppressed by treatment with PP5TG2 (lane 6). These studies suggest that in hypoxic cells, PP5 acts to "turn off" hypoxia-induced activation of an ASK1/MKK-4 signaling cascade, leading to the phosphorylation of JNK.
To further characterize the relationship of PP5 and hypoxia, we next tested the effect of PP5 suppression on the phosphorylation/activation of several additional MAPKKs, MAPKs, and transcription factors (22, 33) using Western analysis with phosphorylation site-specific antibodies. As seen in Fig. 5C, the suppression of PP5 is associated with an increase in the phosphorylation of MKK4 (Thr-261), JNK-(Thr-183/Tyr-185), and c-Jun (Ser-63), yet it had no apparent affect on the phosphorylation of p38 MAPK (Thr-180/Tyr-182), p44/p42MAPK-ERK1/2 (Thr-202/Tyr-204), or total c-Jun protein levels. These findings are consistent with the concept that PP5 acts as a negative regulator of an ASK-1 signaling cascade that leads to the activation of JNK and the phosphorylation of c-Jun at Ser-63, with PP5 acting upstream of JNK and MKK4. However, the relationship between HIF-1-induced PP5 expression and the inactivation of MKK-4/JNK signaling was not clear, because the inactivation of MKK-4 (observed in <3 h) occurs prior to HIF-1-induced PP5 expression, which is not statistically significant until 5 h after the onset of hypoxia.
Hypoxia Induces the Association of PP5 with ASK-1—To further explore the relationship between PP5 and ASK-1, co-immunoprecipitation studies were conducted using polyclonal anti-ASK-1 antibodies to immunoprecipitate ASK-1 from cell lysates followed by Western analysis to measure PP5-protein levels in the immunoprecipitates and vice versa. When antibodies to ASK-1 were used to immunoprecipitate proteins from A549 cell extracts, PP5 was identified by Western blotting of the precipitates (Fig. 6A). Similarly, when antibodies to PP5 were used to immunoprecipitate proteins from crude cell extracts, ASK-1 was identified by Western analysis (Fig. 6B). Immunoprecipitation studies indicate that the association between PP5 and ASK-1 is increased by hypoxia (Fig. 6D), and the suppression of PP5 expression with PP5TG2 results in a slight increase in ASK-1 activity (Fig. 6E). Together, these findings are consistent with PP5 acting as a negative regulator of hypoxia-induced activation of ASK-1. Nonetheless, since the activation of ASK-1 in response to hypoxia is greater than the response induced by the suppression of PP5 expression alone, PP5 does not appear to act as an inhibitor of ASK-activation. Rather, PP5 may function to inactivate ASK-1, preventing the either "accidental" or sustained activation of ASK-1.
|
N-HA), and an HA-tagged kinase domain deletion mutant of ASK-1 (ASK-1 K-HA) were used to transfect A549 cells. The transfected cells were then lysed, and anti-HA antibodies were used to immunoprecipitate protein from the crude cell lysates. Western analysis of the immunoprecipitates found PP5 in association with both the N-terminal and kinase domain-deficient forms of ASK-1, indicating that PP5 associates with the C-terminal (residues 936–1375) region of ASK-1 (Fig. 7). Therefore, PP5 does not appear to bind ASK-1 directly at the N-terminal Trx-binding site.
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
and the Fas death receptor adapter protein, Daxx, can also induce the activation of ASK-1, and the activation of ASK-1 by either mechanism is linked to the onset/propagation of an apoptotic response (36–38). Still, the molecular mechanism(s) regulating ASK-1-mediated apoptosis is not entirely clear. Once activated, ASK-1 has been implicated in the phosphorylation/activation of both MKK4 and MKK3/6 (22). The activation of MKK4 leads to the activation of JNK, the subsequent phosphorylation of c-Jun at Ser63, and a cascade culminating in apoptosis (39). In contrast, the activation of MKK3/6 results in the activation of p38 MAPK, which is often associated with increased cell survival during stress (1, 40).
The data presented here indicate that hypoxia induces a transient activation of ASK-1/MKK4/JNK that peaks after 1 h and returns to basal levels by 3 h. More importantly, our studies suggest that PP5 acts to turn off hypoxia-induced activation of ASK-1/MKK4/JNK via two related, yet distinct, processes. First, in a fairly rapid response, hypoxia augments the interaction of PP5 and ASK-1, with PP5 binding to the C-terminal region of ASK-1. The suppression of PP5 expression results in an increase in ASK-1 activity, and in vitro PP5 can dephosphorylate Thr-845, a site that becomes phosphorylated in association with the activation of ASK-1 (7, 22, 40). Therefore, our data support the hypothesis that PP5 acts as a negative regulator of ASK-1. Nonetheless, the suppression of PP5 expression does not prevent or augment hypoxia-induced MKK4/JNK activity, and the association of ASK-1 and PP5 is still observed (to a lesser extent) under normoxic conditions. This suggests that PP5 does not prevent ASK-1 activation. Rather, PP5 appears to act at the inactivation phase of the cycle, "turning off" hypoxia-induced activation of ASK-1/MKK4/JNK and thereby preventing hypoxia from inducing the sustained activation of ASK-1.
In a second phase, the expression of PP5 is induced by hypoxia. During prolonged periods of hypoxia (>30 min to 1 h), HIF-1, a heterodimeric transcriptional activator, becomes activated (41–45). Our studies indicate that the activation of HIF-1 induces the expression of PP5 by binding to a HIF-1 response element contained in the PP5 promoter, which results in an 2-fold increase in both PP5 mRNA and protein levels. This suggests that HIF-1-induced PP5 expression may have a protective role during periods of chronic hypoxia by suppressing the sustained activation of ASK-1 triggered by the production of reactive oxygen species (Fig. 8). The suppression of PP5 expression with siRNA results in an increase in the activity of both MKK4 and JNK. However, the association of PP5 with ASK-1 may argue that PP5 act upstream of MKK4/JNK at the level of ASK-1. This concept is consistent with a recent study suggesting that rapamycin, by suppressing the activity of PP5, produces a response that also leads to the sustained activation of ASK-1 (16). Therefore, PP5 may represent a key regulator of ASK-1. Still, although the activation of ASK-1 commonly results in the activation of both MKK4/JNK- and MKK3/MKK6/p38 signaling cascades, our studies indicate that the actions of PP5 are limited to the MKK4/JNK arm of the pathway, for the suppression of PP5 had no apparent effect on phosphorylation/activation on p38 MAPK, p44/p42-MAPK/ERK1/2, or total c-Jun protein levels. Still, at present it is not yet clear how PP5 directs the actions of ASK-1 toward MKK4/JNK without affecting p38.
|
and p53, where the interaction of HIF-1 and p53 has been reported to facilitate either a proapoptotic response or an antiapoptotic response (46–49). Like HIF-1, p53 acts as a transcription factor that becomes stabilized following cellular stress (including hypoxia) and regulates the expression of many gene products that coordinate a wide variety of cellular responses (50). In proliferating cells, short term p53 activation is often associated with the induction of the cyclin kinase inhibitor protein, p21WAF1/Cip1 and G1/S phase growth arrest. In contrast, prolonged p53 activation, triggered by severe or irreversible genomic damage, can induce an apoptotic response. The activation of p53 is achieved by an increase in p53 levels and by modifications of the p53 protein (e.g. phosphorylation and acetylation). p53 is inactivated via a feedback mechanism in which p53 induces the expression of Mdm2 (an E-3 ligase; murine double minute-2) that facilitates p53 nuclear export and degradation via the ubiquitin-proteasome pathway (51). However, whereas the stability of HIF-1 is regulated principally by hydroxylation, the association of p53 with Mdm2 is regulated principally by phosphorylation. During hypoxia, p53 is phosphorylated at Ser-15 via a mechanism that is induced following replication arrest and facilitated by the activation of ATR-kinase (52, 53). Ser-15 phosphorylation affects p53 in several ways: 1) it decreases the binding affinity between Mdm2 and p53, which disrupts the negative feedback loop leading to proteolytic degradation; 2) it increases the transcriptional efficiency of certain p53-responsive genes (50); and 3) it allows the nuclear accumulation of p53 by blocking a nuclear export signal contained near the amino terminus of p53 (54). Other studies have shown that in the nucleus, p53 can form a complex with HIF-1 (46, 55), which suppresses the nuclear export and degradation of HIF-1 and may facilitate the actions of both p53 and HIF-1. Thus, the phosphorylation of p53 at Ser-15 may also affect the actions of HIF-1. Previous studies with ISIS 15534, a potent and specific suppressor of PP5 expression (20), have shown that the inhibition of PP5 expression aids both p53-induced (6) and GR-induced (21) growth suppression. This resulted in the hypothesis that PP5 acts as a suppressor of both p53- and GR-mediated signaling cascades that affect cell growth. Recently, the p53 and GR pathways were linked when it was shown that 1) ISIS 15534 augments dexamethasone-induced p53 phosphorylation at Ser-15 and 2) dexamethasone-induced growth suppression is dependent on p53 (5). Thus, PP5 is probably acting upstream of p53, possibly acting to suppress the expression/activation of a GR-responsive kinase that acts on p53 and phosphorylates Ser-15. The observation that HIF-1 regulates the expression of PP5 further links GR/p53- and HIF-1-induced signaling cascades, suggesting that HIF-1-induced PP5 expression contributes to a negative feedback mechanism that suppresses both ASK-1- and GR/p53-mediated responses. Under physiological conditions, HIF-1-induced PP5 expression may represent a protective response that prevents or delays cell death following oxidative stress during hypoxia. This may aid cell survival in hypoxic tissues before and during the growth of new blood vessels into the ischemic area. However, during tumor development, HIF-1-induced PP5 expression may have pathological consequences by aiding tumor cell survival in an ischemic environment while also suppressing actions of the p53 tumor suppressor protein (6) and glucocorticoids (21). Clearly, future studies to determine the role of PP5 tumor development seem warranted, and studies to determine if PP5 is indeed a positive factor in human tumor progression are in progress.
|
FOOTNOTES |
|---|
To whom correspondence should be addressed: Dept. of Biochemistry and Molecular Biology, MSB 2430, University of South Alabama, Mobile, AL 36688. Tel.: 251-460-6859; Fax: 251-460-6127; E-mail: honkanen{at}sungcg.usouthal.edu.
1 The abbreviations used are: MAPK, mitogen-activated protein kinase; MAP, mitogen-activated protein; MAPKK, MAPK kinase; MAPKKK, MAPKK kinase; ERK, extracellular signal-regulated kinase; JNK, c-Jun N-terminal kinase; PP5, serine/threonine protein phosphatase type 5; GR, glucocorticoid receptor; DFO, deferoxamine mesylate salt; DMEM, Dulbecco's modified Eagle's medium; DTT, dithiothreitol; MBP, myelin basic protein; IP, immunoprecipitation; siRNA, small interfering RNA; ERE, estrogen response element; HIF, hypoxia-inducible factor; Trx, thioredoxin; HA, hemagglutinin; ASK, apoptosis signal-regulating kinase; EPO, erythropoietin.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
