Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M405288200 on August 26, 2004

J. Biol. Chem., Vol. 279, Issue 45, 47081-47091, November 5, 2004
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
279/45/47081    most recent
M405288200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Liu, C.-j.
Right arrow Articles by Di Cesare, P. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liu, C.-j.
Right arrow Articles by Di Cesare, P. E.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Leukemia/Lymphoma-related Factor, a POZ Domain-containing Transcriptional Repressor, Interacts with Histone Deacetylase-1 and Inhibits Cartilage Oligomeric Matrix Protein Gene Expression and Chondrogenesis*

Chuan-ju Liu{ddagger}, Lisa Prazak{ddagger}, Marc Fajardo{ddagger}, Shuang Yu§, Neetu Tyagi{ddagger}, and Paul E. Di Cesare{ddagger}

From the {ddagger}Musculoskeletal Research Center, New York University-Hospital for Joint Diseases Department of Orthopedic Surgery, New York, New York 10003 and the §Department of Medicine, Yale University School of Medicine, New Haven, Connecticut 06520

Received for publication, May 12, 2004 , and in revised form, August 9, 2004.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Mutations in the human cartilage oligomeric matrix protein (COMP) gene have been linked to the development of pseudoachondroplasia and multiple epiphyseal dysplasia. We previously cloned the promoter region of the COMP gene and delineated a minimal negative regulatory element (NRE) that is both necessary and sufficient to repress its promoter (Issack, P. S., Fang, C. H., Leslie, M. P., and Di Cesare, P. E. (2000) J. Orthop. Res. 18, 345–350; Issack, P. S., Liu, C. J., Prazak, L., and Di Cesare, P. E. (2004) J. Orthop. Res. 22, 751–758). In this study, a yeast one-hybrid screen for proteins that associate with the NRE led to the identification of the leukemia/lymphoma-related factor (LRF), a transcriptional repressor that contains a POZ (poxvirus zinc finger) domain, as an NRE-binding protein. LRF bound directly to the NRE both in vitro and in living cells. Nine nucleotides (GAGGGTCCC) in the 30-bp NRE are essential for binding to LRF. LRF showed dose-dependent inhibition of COMP-specific reporter gene activity, and exogenous overexpression of LRF repressed COMP gene expression in both rat chondrosarcoma cells and bone morphogenetic protein-2-treated C3H10T1/2 progenitor cells. In addition, LRF also inhibited bone morphogenetic protein-2-induced chondrogenesis in high density micromass cultures of C3H10T1/2 cells, as evidenced by lack of expression of other chondrocytic markers, such as aggrecan and collagen types II, IX, X, and XI, and by Alcian blue staining. LRF associated with histone deacetylase-1 (HDAC1), and experiments utilizing the HDAC inhibitor trichostatin A revealed that LRF-mediated repression requires deacetylase activity. LRF is the first transcription factor found to bind directly to the COMP gene promoter, to recruit HDAC1, and to regulate both COMP gene expression and chondrogenic differentiation.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
The differentiation of uncommitted mesenchymal cells into musculoskeletal tissues, including chondrocytes, osteoblasts, tenocytes, and ligament cells, is a fundamental molecular event of both embryonic development and repair of cartilage, ligament, tendon, and bone (1, 2). After commitment to the chondrocyte lineage, mesenchymal cells undergo condensation, cease expression of type I collagen, and differentiate into a chondrocytic phenotype characterized by expression of collagen types II, IX, and XI and the proteoglycan aggrecan (1, 2). During this process, there appears to be transition cells between type I collagen (expressing mesenchymal cells) and type II collagen (expressing chondrocytes) that are characterized by lack of expression of type II collagen and abundant expression of cartilage oligomeric matrix protein (COMP)1 (311). These cells may represent musculoskeletal precursor cells that have the potential subsequently to differentiate into a variety of musculoskeletal cell types; however, little is known about the generation of these potential precursor cells.

The gene for COMP encodes a pentameric non-collagenous matrix protein (3, 9, 10, 12, 13) that is expressed predominantly in articular cartilage (3, 911, 14). Mutations in the human COMP gene have been linked to the development of pseudoachondroplasia and multiple epiphyseal dysplasia (1527), autosomal dominant forms of short-limb dwarfism characterized by short stature, normal facies, epiphyseal abnormalities, and early onset osteoarthrosis (reviewed in Refs. 2830). Accumulating evidence suggests that COMP may function to stabilize the extracellular matrix of articular cartilage by specific cation-dependent interactions with matrix components, including collagen types II and IX and fibronectin (31, 32).

COMP is synthesized by chondrocytes, osteoblasts, tenocytes, and ligament cells, but not by undifferentiated mesenchymal cells (311, 3338). To delineate cis-elements in the COMP promoter necessary for expression in any of these tissues, we cloned the murine COMP promoter and identified cis-elements necessary for expression in the chondrocytic cell line Swarm rat chondrosarcoma (RCS) (35). We have shown that COMP mRNA and protein are expressed in RCS cells, but not in NIH3T3 fibroblasts. A COMP promoter fragment containing ~1.9 kb of 5'-flanking sequence is specifically active in RCS cells. In cell culture experiments, deletion analysis of the distal region of the COMP promoter identified a silencer region situated between –1775 and –1716 that specifically binds protein complexes expressed in non-chondrocytic cells, but not in RCS cells. Competition gel shift experiments localized the binding site to within 30 bp (–1775 to –1746; negative regulatory element (NRE)). This site is necessary and sufficient to repress COMP expression in fibroblast cell lines (35, 39).

Yeast one-hybrid screening has proven to be an effective tool to identify DNA-binding proteins (40, 41), including the rat fibronectin gene (42) and Fgf3 promoter (43). To identify proteins that interact with the NRE in the promoter region of the COMP gene, we screened a yeast expression cDNA library using a tandem repeat of four NREs as bait. These experiments identified the leukemia/lymphoma-related factor (LRF) transcriptional repressor as a binding protein at the NRE. LRF is a nuclear protein with an N-terminal POZ (poxvirus zinc finger) domain and a C-terminal Krüppel-like zinc finger DNA-binding domain (44). LRF was found to be the mouse counterpart of human FBI-1 (factor that binds to the HIV-1 inducer of short transcripts) (4547) and the rat osteoclast-derived zinc finger (OCZF) protein (48), with identical functionally important molecular domains.

Many transcription factors repress transcription by recruiting histone deacetylases (HDACs) to chromatin. HDACs are classified into two groups based on structural and functional similarities. Class I HDACs, including HDAC1, are expressed in the nuclei of cells in most tissues (49). In this study, we discovered the transcriptional repressor LRF as a novel regulator controlling COMP gene expression and chondrogenesis and demonstrate that HDAC1 is involved in LRF-mediated gene transcription. LRF, which associates with HDAC1, is the first transcription factor found to bind directly to the COMP gene promoter and to regulate COMP gene expression and chondrogenic differentiation.


    EXPERIMENTAL PROCEDURES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Plasmid Constructs—Yeast reporter vectors (pHISi, pHISi-1, and pLacZi; Clontech) were used to generate NRE-specific reporter constructs. Briefly, a synthetic DNA oligomer containing four tandem repeats of the NRE sequence (AGCCTGGGAGAGGGTCCCTGCCCTATGGAA) was cloned into the EcoRI/XbaI sites of pHISi, pHISi-1, and pLacZi to produce pHISi-4NRE, pHISi-1-4NRE, and pLacZi-4NRE, respectively.

The bacterial expression vector pGEX-3X (Invitrogen) was used to produce recombinant proteins in Escherichia coli. cDNA fragments encoding a segment of LRF (amino acids (aa) 207–277) located between the POZ domain and zinc fingers motifs and two segments of HDAC1 (aa 51–452 and 51–467) were amplified by PCR and subcloned in-frame into the BamHI/EcoRI sites of pGEX-3X to produce plasmids pGEX-LRF-(207–277), pGEX-HDAC1-(51–452), and pGEX-HDAC1-(51–467), respectively, which express glutathione S-transferase (GST) fusion proteins in bacteria.

The COMP-specific luciferase expression reporter constructs (–1925COMPluc, –1775COMPluc, and –592COMPluc) have been described previously (35). The –{Delta}1925COMPluc plasmid, in which the NRE was deleted, was generated by fusion PCR. Two primers with deletion flanking sequences complementary to one another (5'-GACAGCAGGGAGAGGTTGTCCAATTGTAAGAGCCCCAGC-3' and 5'-CTTACAATTGGACAACCTCTCCCTGCTGTCCCCTCCCTA-3') were used in combination with end primers 5'-CGGGGTACCACTGGAGGCCTGGAGGAG-3' and 5'-GTTGGGCCCTAAAGGGAGCTGTGGGAAAG-3' to generate fragments on either side of the region to be deleted. The two fragments were then annealed to one another in a second PCR using the primers at each end of the sequence. The resultant fragment was digested with KpnI and ApaI and subcloned into the KpnI/ApaI sites in –1925COMPluc to generate the –{Delta}1925COMPluc plasmid. The 4xN-REpGL2-Promoter plasmid contains four tandem repeats of the NRE inserted upstream of the SV40 promoter. This construct was generated by subcloning PCR-amplified tandem repeats of four 30-bp sequences (–1775 to –1746) into the KpnI/XhoI sites in the polylinker of the pGL2-Promoter vector (Promega, Madison, WI). The mammalian expression constructs pFLAG-LRF and pFLAG-LRF{Delta}POZ were kindly provided by Drs. R. L. Widom and A. Zelent (44). All constructs were verified by DNA sequencing.

Yeast One-hybrid Screening—A one-hybrid library screen (Clontech) was performed according to the manufacturer's protocol. The pHISi-4NRE, pHISi-1-4NRE, and pLacZi-4NRE bait plasmids were linearized and integrated into the genome of yeast strain YM4271 by homologous recombination. The yeast strain was then transformed with a pPC86 vector-based mouse embryo day 10.5 cDNA library (Invitrogen). Approximately 2.5 x 106 yeast transformants were plated on synthetic complete medium lacking histidine and tryptophan and supplemented with 45 mM 3-amino-1,2,4-triazole. Selected clones were subjected to the {beta}-galactosidase assay using the colony lift filter method. Plasmids from putative positive clones were recovered from yeast and individually transformed into E. coli DH10B cells for amplification. To eliminate false-positive results, these plasmids were separately introduced into yeast cells containing either bait or the p53-binding site (Clontech), and transformants were tested by {beta}-galactosidase assay. Inserts were sequenced, and the DNA sequences were used to query the GenBankTM/EBI Data Bank.

Expression and Purification of GST Fusion Proteins—For expressing GST fusion proteins, plasmid pGEX-LRF-(207–277), pGEX-HDAC1-(1–432), pGEX-HDAC1-(51–482), pGEX-HDAC1-(51–452), or pGEX-LRF-(51–467) was transformed into E. coli DH5{alpha} (Invitrogen). The GST fusion protein was affinity-purified on glutathione-agarose beads as described previously (5054).

Preparation and Characterization of Affinity-purified Anti-LRF Antibodies—The GST-LRF-(207–277) fusion protein, encoding a segment (aa 207–277) between the POZ domain and zinc finger motifs of LRF, was expressed in E. coli DH5{alpha}, purified on a glutathione-Sepharose column, and subjected to preparative scale SDS-PAGE. The major band was excised and used to immunize rabbits for polyclonal antiserum production (Zymed Custom Antibody, Zymed Laboratories Inc., South San Francisco, CA). To affinity-purify anti-LRF antibodies, the anti-GST activity in the rabbit antiserum was depleted using GST protein immobilized on glutathione-agarose beads. The depleted serum was incubated with Affi-Gel-10 beads (Bio-Rad) to which purified GST-LRF-(207–277) was covalently linked. The bound antibodies were eluted from the beads with 0.15 M glycine buffer (pH 2.5) and immediately neutralized with 1.5 M Tris-HCl buffer (pH 8.0) (55). The affinity-purified antibodies were characterized using in vitro translated LRF in a rabbit reticulocyte lysate (Promega).

Preparation of Nuclear Extracts—Nuclear extracts were prepared from C3H10T1/2 cells and RCS cell lines transfected with the pFLAG-LRF expression plasmid. Cells were harvested by trypsinization, washed with phosphate-buffered saline, pelleted, and resuspended in lysis buffer (10 mM Tris-HCl (pH 8.0), 60 mM KCl, 1 mM EDTA, 1 mM dithiothreitol, proteinase inhibitors, and 0.3% Nonidet P-40). After 5 min on ice, the lysates were centrifuged at 1000 x g for 5 min at 4 °C, and the pelleted nuclei were washed with lysis buffer without Nonidet P-40. The nuclear pellet was resuspended in an equal volume of nuclear extraction buffer (20 mM Tris-HCl (pH 8.0), 420 mM NaCl, 1.5 mM MgC12, 0.2 mM EDTA, and 25% glycerol), and NaCl was added to obtain a final concentration of 400 mM. After incubation at 4 °C for 10 min, the nuclei were centrifuged at 25,000 x g for 5 min. The supernatant fraction was used as the nuclear extract.

Electrophoretic Mobility Shift Assay (EMSA)—Complementary oligonucleotides for the NRE and its serial mutants (see Fig. 5A for sequences) were synthesized and annealed by heating to 70 °C for 5 min and then slowly cooled to room temperature. Probes were prepared by end labeling oligonucleotides with [{gamma}-32P]ATP and T4 polynucleotide kinase. The binding reaction was achieved by preincubating nuclear extracts with 1 µg of poly(dI-dC)/poly(dI-dC) (Amersham Biosciences) in buffer containing 20 mmol/liter HEPES (pH 7.9), 70 mmol/liter NaCl, 5 mmol/liter MgCl2, 0.05% Nonidet P-40, 10% glycerol, 0.5 mmol/liter dithiothreitol, and 5 µmol/liter p-amidinophenylmethylsulfonyl fluoride at room temperature for 20 min as described previously (51). Three nanograms of end-labeled probes were added to the reaction mixture containing the nuclear extract and incubated for 15 min at room temperature. For competition experiments, excess unlabeled DNA was incubated with the reaction mixture for 15 min before the addition of the radiolabeled probe. In supershift assays, 5 µg of anti-FLAG monoclonal antibody M2 (Sigma) were incubated with the reaction mixture for 15 min before the addition of the radiolabeled probe. The samples were subjected to 4% PAGE in 0.5% buffer (45 mM Tris borate and 1 mM EDTA) at 15 V/cm for 3 h at room temperature. The gel was dried, and autoradiography was performed at –70 °C.



View larger version (57K):
[in this window]
[in a new window]
 
FIG. 5.
Identification of the LRF-binding motif in the NRE of the COMP promoter. A, sequences of the wild-type (Wt) and mutant (Mut) probes used in B. Mutant nucleotides are lowercase and underlined. The binding intensity of LRF to these probes is indicated: ++, stronger binding; +, binding; -, no binding. B, EMSA with the same protein fractions as in Fig. 3. Probes are as indicated above the lanes. The specific protein·DNA band is indicated by the arrow.

 
Chromatin Immunoprecipitation (ChIP)—In vivo binding of LRF to the NRE of the COMP promoter was investigated using the ChIP assay kit (Upstate Biotechnology, Inc., Lake Placid, NY). Confluent human embryonic kidney (HEK) 293 cells were transfected with the COMP-specific reporter construct –1925COMPluc and expression plasmid pFLAG-LRF. These transformed HEK cells and murine C3H10T1/2 progenitor cells were cultured on 10-mm dishes and then treated with formaldehyde (1% final concentration) to cross-link LRF to the DNA. Cells were washed with cold phosphate-buffered saline and lysed in SDS lysis buffer (1% SDS, 10 mM EDTA, and 50 mM Tris-HCl (pH 8.1)). The lysate was sonicated to shear DNA to a length between 200 and 1000 bp. The sonicated supernatant was diluted 10-fold with ChIP dilution buffer (0.01% SDS, 1% Triton X-100, 2 mM Tris-HCl (pH 8.1), and 150 mM NaCl) and incubated with anti-FLAG antibody (Stratagene, La Jolla, CA), anti-LRF or anti-HDAC1 antibody (Santa Cruz Biotechnology, Santa Cruz, CA), or preimmune serum overnight at 4 °C with rotation. To collect DNA/proteins complexes, salmon sperm DNA/protein A-agarose slurry was added to the mixture and incubated for 1 h at 4 °C with rotation, and the DNA/protein A-agarose was pelleted by centrifugation. After extensive washing of the pellet with a series of wash buffers, the pellet was dissolved with 250 µl of elution buffer and centrifuged to remove the agarose. The supernatant was treated with 20 µl of 5 M NaCl and heated to 65 °C for 4 h to reverse the LRF-DNA cross-link. After treatment with EDTA and proteinase K, the supernatant was extracted with phenol/chloroform and precipitated with ethanol to recover the DNA. For PCR of the COMP promoter region using the chromatin-immunoprecipitated DNA, one-tenth of the DNA was PCR-amplified using forward primer 5'-GTAGTCAATAGGCCTGGGAAGA and reverse primer 5'-GGAAAGGGAGTCAGAACTGAAG. Thirty-five cycles of PCR at 94 °C for 30 s, 55 °C for 30 s, and 72 °C for 30 s were performed. PCR products were analyzed on 1% agarose gel.

Reporter Gene Assay—RCS cells grown to ~50% confluence in 35-mm culture dishes were transfected with 1 µg of reporter construct (-1925COMPluc, –1775COMPluc, –{Delta}1925COMPluc, –592COMPluc, or 4xNREpGL2-Promoter) along with 1 µg of pSVGal plasmid (internal control) and various amounts of pFLAG-LRF expression plasmid. To examine whether HDACs are involved in the LRF-mediated repression, various amounts of trichostatin A (TSA) (see Fig. 10C) were added to the medium. At 48 h after transfection, the cultures were harvested and lysed. Luciferase assays were performed using 20 µl of cell extract and 100 µl of luciferin substrate (Promega). {beta}-Galactosidase assays were performed using a {beta}-galactosidase assay kit (Tropix Inc., Foster City, CA) following the manufacturer's protocol. {beta}-Galactosidase and luciferase activities were measured using a Mini-Lum luminometer (Bioscan, Inc., Washington, D. C.).



View larger version (39K):
[in this window]
[in a new window]
 
FIG. 10.
LRF associates with HDAC1, and its repression is sensitive to the HADC inhibitor TSA. A, LRF associates with HDAC1 in vivo (co-immunoprecipitation assay). Cell extracts were incubated with anti-LRF (lane 2) or anti-HDAC1 (lane 3) antibody or with control IgG (lane 4), followed by protein A/G-agarose. The immunoprecipitated (IP) protein complex and cell extracts (lane 1, which provides a positive control) were examined by immunoblotting with anti-HDAC1 antibody. B, LRF associates with HDAC1 in vitro (GST pull-down assay). Purified GST (lane 2), GST-HDAC1-(51–482) (lane 3), and GST-HDAC1-(1–432) (lane 4) immobilized on glutathione-Sepharose beads were incubated with in vitro translated (IVT) LRF (lane 1). Bound proteins were examined by immunoblotting with anti-LRF antibodies. C, 20 amino acids of HDAC1 (aa 433–452) are required for interacting with LRF. The procedure described for B was followed. D, the LRF·HDAC1 complex is detectable in the COMP promoter. C3H10T1/2 cells treated with formaldehyde were lysed, and DNA was sheared by sonication. Cell lysates were subjected to immunoprecipitation with anti-LRF (lane 2) or anti-HDAC1 (lane 4) antibody or with control IgG (lane 3). DNA recovered from the immunoprecipitation was amplified by PCR. Input DNA (lane 1) was used as a positive control. E, repression by LRF is sensitive to the HDAC inhibitor TSA. RCS cells were transfected with 2 µg of –1925COMPluc with or without 4 µg of pFLAG-LRF expression plasmid as well as a pSVGal internal control plasmid in the presence or absence of the indicated concentrations of TSA. Luciferase values were corrected for transfection efficiency with {beta}-galactosidase values. The change in repression (n-fold) was calculated relative to that in cells transfected with –1925COMPluc alone. F, TSA treatment stimulates COMP gene expression in C3H10T1/2 cells. RNAs isolated from C3H10T1/2 cells treated with various amounts of TSA, as indicated, were reverse-transcribed, and the mRNA expression of COMP and GAPDH was examined by RT-PCR.

 
Magnetic Bead Assay—The magnetic bead assay was performed as described previously (50). Briefly, a 592-nucleotide proximal region (-592 to –1) and a 400-nucleotide distal region (–1925 to –1526, containing the NRE and used as a positive control) of the COMP promoter were labeled with biotin using the Promega random-primed DNA labeling kit (DNA probes). Five-picomole aliquots of the DNA probe were conjugated to 20 µl of streptavidin-coupled magnetic beads (Promega) in 20 mM HEPES (pH 7.9), 100 mM NaCl, 0.5 mM EDTA, 10% glycerol, and 0.01% Nonidet P-40 and incubated with 500 µg of nuclear extracts prepared from RCS cell lines transfected with expression plasmid pFLAG-LRF in 300 µl of the same buffer at room temperature for 20 min. Bound FLAG-UBF1 was detected by SDS-PAGE and immunoblotting with anti-FLAG antiserum (Santa Cruz Biotechnology).

Generation of LRF Stable Lines—Murine C3H10T1/2 progenitor cells were cultured in tissue culture dishes in Dulbecco's modified Eagle's medium supplemented with 10% heat-inactivated fetal calf serum, 0.2 mM L-glutamine, and antibiotics. C3H10T1/2 cells were plated 1 day before transfection at a density of 1.5 x 105 cells/30-mm dish. Transfection was carried out using Superfect transfection reagent (QIAGEN Inc., Valencia, CA) following the manufacturer's instructions. The LRF expression plasmid pFLAG-LRF or the empty pFLAG-F4 vector (51) was added together with the selective plasmid pMiniHgh (provided by Dr. X. Y. Fu), which conferred hygromycin-resistance upon the cells, at a ratio of 10:1. Two days after transfection, cells were split into 100-mm dishes at a density of 105 cells/dish in 10 ml of Dulbecco's modified Eagle's medium containing hygromycin at 200 µg/ml. After 14 days in selective medium (medium changed every 3 days), cloning cylinders dipped in sterile vacuum grease were placed around individual colonies, and 0.3 ml of 0.1% trypsin and EDTA were added to dissociate the colonies from the plates. Cells were plated in 12- and 6-well plates and 35- and 100-mm dishes for expansion in Dulbecco's modified Eagle's medium containing hygromycin at 200 µg/ml. The FLAG-tagged LRF levels were examined by immunoblotting using anti-FLAG antibody.

RNA Preparation and Reverse Transcription (RT)-PCR—Total RNA was prepared from micromass cultures of cloned LRF stable lines, control lines, and parental C3H10T1/2 cells maintained in Ham's F-12 medium (Invitrogen) containing 10% fetal calf serum in the presence of 100 ng/ml recombinant BMP-2 (Genetics Institute, Cambridge, MA) for 7 days using the QIAGEN RNeasy minikit and reverse-transcribed using oligo(dT) primers with the SuperScript preamplification system (Invitrogen) following the manufacturer's instructions. PCR was performed in a volume of 25 µl for 25 cycles at 94 °C for 30 s, 58 °C for 45 s, and 70 °C for 90 s. The pairs of oligonucleotides used were as follows: 5'-GAGAGAGCTGTTGCGACACGA-3' and 5'-GACGCAGGACCTCGCCCTAC-3' for mouse COMP, 5'-CAACTTTGACCAGAGTGACAGC-3' and 5'-CCTGTAGAGGACTTGACAGCCT-3' for rat COMP, 5'-TGCTACTTCATCGACCCCAT-3' and 5'-AAAGACCTCACCCTCCATCT-3' for mouse aggrecan, 5'-TACGGTGTCAGGGCCAGGATGC-3' and 5'-CCTTGTCACCACGATCACCTCT-3' for mouse type II collagen, 5'-GTGGAACCTGGTTTCTTCTCAC-3' and 5'-TCTAGTGGCTCCTCATCACAGA-3' for mouse type IX collagen, 5'-CAGGAAAACCTGGACAGCAG-3' and 5'-ACCCTTAGGACCATTGAGAC-3' for mouse type X collagen, 5'-CACACCGGAAAACTATCCTCTC-3' and 5'-ACAGGACCTGGTCTTCCAGTAA-3' for mouse type XI collagen, 5'-CCACCCATGGCAAATTCCATGGCA-3' and 5'-TCTAGACGGCAGGTCAGGTCCACC-3' for mouse glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and 5'-GTTCTAGAGACAGCCGCATCTT-3' and 5'-ACAGTCTTCTGAGTGGCAGTGA-3' for rat GAPDH. PCR products were visualized on 1% agarose gels containing 0.1 mg/ml ethidium bromide using ultraviolet light. The identity of each targeted PCR amplification product was confirmed by DNA sequence analysis of gel-purified bands (QIAGEN Inc.).

Immunoblot Analysis—To characterize anti-LRF serum, 20 µg of total cell lysates prepared from HEK293 cells transfected with pFLAG-LRF were mixed with 5x sample buffer (312.5 mM Tris-HCl (pH 6.8), 5% {beta}-mercaptoethanol, 10% SDS, 0.5% bromphenol blue, and 50% glycerol). Proteins were resolved on a 5–15% SDS-polyacrylamide gel and electroblotted onto nitrocellulose membrane. After blocking in 5% nonfat dry milk in 10 mM Tris-HCl (pH 8.0), 150 mM NaCl, and 0.5% Tween 20, blots were incubated with anti-FLAG monoclonal antibody (1:500), preimmune serum (1:500), or anti-LRF antiserum (1:500) for 1 h. After washing, the secondary antibody (horseradish peroxidase-conjugated anti-mouse immunoglobulin for the anti-FLAG probe and anti-rabbit immunoglobulin for preimmune serum and anti-LRF antiserum; 1:2000 dilution) was added. Blots were visualized using an enhanced chemiluminescence kit (Amersham Biosciences). To screen the LRF stable lines, cell lysates were prepared from cloned LRF stable lines and control lines, and FLAG-tagged LRF levels were examined with the anti-FLAG probe using the procedures described above.

To examine COMP protein expression in the BMP-2-induced chondrogenic differentiation of C3H10T1/2 cells, 25 µg of cell lysates prepared from micromass cultures of cloned LRF stable lines, control lines, and parental C3H10T1/2 cells maintained in Ham's F-12 medium in the presence of 100 ng/ml recombinant BMP-2 for 7 days were used to perform an immunoblot assay with rabbit polyclonal antiserum to COMP (1:500 dilution), followed by horseradish peroxidase-conjugated anti-rabbit IgG (1:1000 dilution).

Alcian Blue Staining—To assess the extent of chondrogenesis, micromass cultures of cloned LRF stable lines, control lines, and parental C3H10T1/2 cells maintained in Ham's F-12 medium containing 10% fetal calf serum in the presence of 100 ng/ml recombinant BMP-2 for 14 days were fixed in Kahle's fixative, washed with water, and stained overnight with 1% Alcian blue 8GX (Sigma) (56).

In Vitro GST Pull-down Assay—To examine whether LRF binds to HDAC1 in vitro, glutathione-Sepharose beads (50 µl) preincubated with 0.5 µg of purified GST (serving as a control), GST-HDAC1-(1–432), GST-HDAC1-(51–452), GST-HDAC1-(51–467), or GST-HDAC1-(51–482) were incubated with in vitro translated LRF expressed in a rabbit reticulocyte transcription/translation system (Promega) in 150 µl of buffer containing 10 mM Tris-HCl (pH 7.9), 10% glycerol, 100 mM KCl, and 0.5 mg/ml bovine serum albumin. The bound proteins were denatured in sample buffer and separated by 12% SDS-PAGE, and protein was detected by Western blotting with affinity-purified anti-LRF antibodies.

Co-immunoprecipitation—Approximately 500 µg of cell lysates prepared from LRF stable lines were incubated with anti-LRF (25 µg/ml) or anti-HDAC1 (20 µg/ml) antibody or with control rabbit IgG (25 µg/ml) for 1 h, followed by incubation overnight with 30 µl of protein A-agarose (Invitrogen) at 4 °C. After washing five times with immunoprecipitation buffer, bound proteins were released by boiling in 20 µl of 2x SDS loading buffer for 3 min (51). Released proteins were examined by Western blotting with anti-HDAC1 antibody, and the signal was detected using the ECL chemiluminescence system (Amersham Biosciences).


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
The Yeast One-hybrid System Identifies the Transcriptional Repressor LRF as an NRE-binding Protein—To identify the repressors that bind to the NRE located at –1775 to –1746 in the mouse COMP gene promoter, yeast one-hybrid screening was carried out according to the Matchmaker one-hybrid protocol. For this purpose, four tandem repeats of the NRE sequence (AGCCTGGGAGAGGGTCCCTGCCCTATGGAA) from the COMP gene promoter were ligated into the yeast integration and reporter vectors pHISi and pLacZi to generate pHISi-4NRE and pLacZi-4NRE, respectively. Each pHISi-4NRE and pLacZi-4NRE reporter construct was linearized and integrated sequentially into the genome of the competent yeast strain YM4271. The resulting yeast cells with integrated pHISi-4NRE and pLacZi-4NRE were used for one-hybrid screening with a mouse embryonic cDNA/VP16 activation domain fusion library. Screening of 2.5 x 106 clones from a mouse embryonic cDNA library generated seven positive clones. Positive colonies were selected on synthetic complete medium lacking histidine and tryptophan and supplemented with 45 mM 3-amino-1,2,4-triazole and transformed into E. coli DH5{alpha}. Each cDNA insert was sequenced and analyzed by a BLAST search of the GenBankTM/EBI Data Bank. Two of the positive clones were identical and contained a 1793-bp insert. The nucleotide sequences of these clones contain an open reading frame of 1698 bp, with the first ATG surrounded by an appropriate Kozak consensus sequence (57). The predicted open reading frame encodes a protein of 566 amino acid residues that is identical to mouse LRF (GenBankTM/EBI accession number AF086830 [GenBank] ) (44). LRF is the mouse counterpart of human FBI-1 (47) and the rat OCZF protein (48), with identical matches in three functionally important domains (alignment not shown): the N-terminal POZ domain (aa 1–120), four Cys2-His2 zinc fingers (aa 379–478), and a nuclear localization sequence (aa 483–496, CXX-VXXRXXRKXXX) (44, 47, 48, 58). LRF is a highly conserved transcription factor; mouse LRF and rat OCZF are 90 and 96% identical at the nucleotide and amino acid levels, respectively, whereas mouse LRF and human FBI-1 sequences are 89% identical at the amino acid level (data not shown).

The yeast one-hybrid assay was repeated to verify the binding of LRF to the NRE. The plasmid encoding p53 (control) and LRF fused to the VP16 activation domain were retransformed into the yeast cells with integrated pHISi-4NRE, pHISi-53BE (p53-binding elements), pLacZi-4NRE, and pLacZi-53BE. The resulting HIS+ clones were subjected to {beta}-galactosidase and growth phenotype assays (Fig. 1). The results show that p53 bound to the p53-binding elements, but not to the NRE, and that LRF bound to the NRE, but not to the p53-binding elements based on the activation of the lacZ reporter gene (Fig. 1A) and growth on the culture plates lacking histidine and tryptophan but containing 45 µM 3-amino-1,2,4-triazole (Fig. 1B).



View larger version (26K):
[in this window]
[in a new window]
 
FIG. 1.
Yeast one-hybrid assay to test the binding of LRF to the NRE of the COMP promoter. Plasmid encoding protein fused to VP16 (p53 and LRF) in the pPC86 vector (i.e. pPC86-p53 or pPC86-LRF) was transformed into yeast cells with integrated pLacZi-4NRE (A, NRE), pLacZi-53BE (A, 53BE; p53-binding elements), pHISi-4NRE (B, NRE), or pHISi-53BE (B, 53BE). Yeast transformants were selected on synthetic complete medium lacking histidine and tested for {beta}-galactosidase activity (A) and growth phenotype (B) on plates lacking histidine and containing 45 µM 3-amino-1,2,4-triazole. The known interaction between p53 and p53-binding elements was used as a positive control.

 
Preparation and Characterization of Anti-LRF Antibodies— The GST-LRF-(207–277) fusion protein, encoding a segment (aa 207–277) between the POZ domain and zinc finger motifs of LRF, was expressed in bacteria, purified on a glutathione-Sepharose column; and subjected to preparative scale SDS-PAGE. The major band was excised and used to immunize rabbits (Zymed Custom Antibody). To generate affinity-purified anti-LRF antibodies, the GST-absorbed anti-LRF serum was incubated with Affi-Gel-10 beads to which purified GST-LRF-(207–277) was covalently linked. The bound antibodies were eluted at low pH and neutralized.

Western blotting was performed using in vitro translated LRF and nuclear extracts prepared from C3H10T1/2 progenitor cells to characterize the anti-LRF antiserum (Fig. 2B). The results show that affinity-purified anti-LRF antibodies specifically recognized endogenous LRF in C3H10T1/2 cells, with a similar size as in vitro translated LRF (compare lanes 2 and 3); no bands were resolved in the control reaction using empty vector as template (lane 1).



View larger version (41K):
[in this window]
[in a new window]
 
FIG. 2.
Characterization of affinity-purified polyclonal antibodies against LRF. A, schematic structure of LRF. The numbers refer to amino acid residues in LRF. The POZ domain, zinc finger motifs, and nuclear localization signal (NLS) are indicated. The segment (aa 207–277) used to generate anti-LRF antiserum is also indicated. B, Western blot assay. In vitro translated (IVT) products in a rabbit reticulocyte lysate using either the pcDNA3 vector (lane 1) or pcDNA3-LRF (lane 2) as a template and nuclear extracts (NE) prepared from C3H10T1/2 cells (lane 3) were separated by SDS-PAGE and detected with affinity-purified anti-LRF antibodies. The arrow indicates LRF; the arrowhead indicates an unknown protein in the rabbit reticulocyte lysate.

 
LRF Binds to the NRE in the COMP Promoter in Vitro— Interactions identified in yeast must be verified using independent procedures because 1) the yeast one-hybrid system may produce false interactions, and 2) true interactions in yeast in which post-translational modifications are absent might be lost in the mammalian cells if post-translational modifications are involved in the associations. We first confirmed the binding of LRF to the NRE in EMSA (Fig. 3). Incubation of the 32P-labeled NRE probe with the nuclear extracts prepared from RCS cells transfected with the mammalian expression plasmid pFLAG-LRF resulted in a specific FLAG-LRF·NRE complex (lane 3). The binding of probe to FLAG-LRF in vitro (lane 3) was completely competed by excess unlabeled oligodeoxynucleotide (lane 1). The FLAG-LRF·NRE band was supershifted with antibodies to FLAG (lane 4).



View larger version (35K):
[in this window]
[in a new window]
 
FIG. 3.
LRF binds to the NRE of the COMP promoter in vitro (EMSA). Ten micrograms of nuclear extracts (NE) prepared from RCS cells transfected with pFLAG-LRF were mixed in the reaction buffer (20 µl). For competition experiments, a 100-fold excess of wild-type NRE oligodeoxynucleotide was added. For supershift assays, anti-FLAG IgG (0.5 µg) was included. After 15 min of incubation, the 32P-labeled NRE probe was added, and the reaction mixture was incubated for an additional 15 min and analyzed by gel electrophoresis. The positions of the supershifted IgG·FLAG-LRF·NRE complex (supershift), the FLAG-LRF·NRE complex (shift), and the free DNA probe (probe) are indicated.

 
LRF Binds to the NRE in the COMP Gene Promoter in Living Cells—To determine whether LRF also binds to the NRE in vivo, we performed ChIP assays, which are important for defining interactions of factors with specific DNA elements in living cells. ChIP was first carried out in HEK293 cells transfected with the COMP-specific reporter construct –1925COM-Pluc and plasmid pFLAG-LRF. After cross-linking with formaldehyde, cell lysates were immunoprecipitated with control IgG (negative control) or with anti-FLAG or anti-LRF antibody, and the DNA purified from this coprecipitation was analyzed by PCR with PCR primers spanning the NRE in the COMP promoter. As shown in Fig. 4A, we observed a clear PCR product using DNA isolated from immunoprecipitated complexes with both anti-FLAG (lane 2) and anti-LRF (lane 3) antibodies, but not with control IgG (lane 1), indicating that FLAG-tagged LRF binds to the NRE of the COMP promoter in transfected living cells.



View larger version (23K):
[in this window]
[in a new window]
 
FIG. 4.
LRF binds to the NRE of the COMP promoter in living cells (ChIP). A, FLAG-tagged LRF binds to the transfected COMP-specific reporter construct –1925COMPluc. HEK293 cells transfected with –1925COMPluc and the expression plasmid pFLAG-LRF were cross-linked by formaldehyde treatment and lysed. Cell lysates were subjected to immunoprecipitation with control IgG (lane 1) or with anti-FLAG (lane 2) or anti-LRF (lane 3) antibody. Purified DNA from the cell lysate (Input DNA; upper panel) and DNA recovered from immunoprecipitation (IP; lower panel) were amplified by PCR. B, endogenous LRF binds to the NRE of the COMP gene. C3H10T1/2 cells treated with formaldehyde were lysed, and DNA was sheared by sonication. Cell lysates were subjected to immunoprecipitation with either preimmune serum (Preimmuno.; lane 2) or anti-LRF polyclonal antibodies (lane 3). DNA recovered from the immunoprecipitation was amplified by PCR. Input DNA (lane 1) was used as positive control.

 
ChIP also provides information on native chromatin structure and the endogenous factors bound to regulatory elements in different functional states (37). ChIP assays were performed in C3H10T1/2 progenitor cells, which express LRF (Fig. 2). Endogenous protein·DNA complexes were then covalently cross-linked with formaldehyde, and after cell lysis, the chromatin was sheared by sonication. Endogenous LRF·DNA complexes were immunoprecipitated with either preimmune serum (negative control) (Fig. 4B, lane 2) or anti-LRF antibody (lane 3), and the DNA purified from these coprecipitations and input DNA (positive control) (lane 1) were analyzed by PCR. We observed amplified products of the COMP promoter from input DNA and DNA isolated from anti-LRF antibody-precipitated (but not from preimmune serum-precipitated) complexes. These results demonstrate that endogenous LRF binds to the native NRE in the COMP gene.

Identification of the LRF-binding Element (LBE) in the NRE—Once the interaction between LRF and the NRE became clear, we sought to identify the LBE in the 30-bp NRE by performing EMSA again using wild-type and serial mutant NRE probes. All probes were incubated with nuclear extracts prepared from pFLAG-LRF-transfected RCS cells; the binding of LRF to various probes is summarized in Fig. 5A and shown in Fig. 5B. Mutants 1 and 5, in which the first six nucleotides (AGCTGG) and the last six nucleotides (ATGGAA) were mutated, respectively, bound to LRF as strongly as the wild-type NRE probe (Fig. 5B, compare lanes 1, 2, and 6); however, mutants 2 and 3, in which the second six nucleotides (GGAGAG) and the third six nucleotides (GGTCCC) were altered, respectively, totally abolished the binding of LRF (lanes 3 and 4), clearly demonstrating that these 12 nucleotides (GGAGAGGGTCCC) are essential for binding to LRF. Interestingly, mutant 4, in which the fourth six nucleotides (TGCCCT) were replaced, still bound to LRF, but the binding intensity was weaker (lane 5). Twelve nucleotides (GGAGAGGGTCCC) identified above in the NRE contain a typical consensus binding site (G(A/G)GGG(T/C)(C/T)(T/C)(C/T)) (59) of FBI-1, a human counterpart of mouse LRF. To confirm whether the flanking sequences of the consensus binding site are involved in the binding of LRF to the NRE, an additional three mutants of NRE (lanes 7–9) were constructed and tested. Mutant 6, in which three 5'-nucleotides (GGA) flanking the "consensus sequence" were mutated, bound to the LRF as well as the wild-type probe, indicating that these three nucleotides are not required for LRF-NRE association. Mutants 7 and 8, in which the first three nucleotides (TGC) and the last three nucleotides (CCT) of six 3'-nucleotides flanking the consensus sequences were changed, respectively, still bound to LRF with reduced affinity, as did mutant 4, in which these six nucleotides were replaced. These data indicate that the identified core DNA-binding site for LRF is in accordance with the published consensus sequence for FBI-1. It is also possible that the six 3'-nucleotides of this consensus site might enhance the association of LRF with the consensus sequences.

LRF Inhibits COMP-specific Reporter Construct Activities and Endogenous COMP Gene Expression—To determine whether LRF represses transcription of the COMP promoter using reporter gene assays, four COMP-specific reporter gene plasmids (–1925COMPluc, –1775COMPluc, –{Delta}1925COM-Pluc, and –592COMPluc) were generated in which segments with or without an NRE from the 5'-flanking region of the COMP gene were linked to the upstream end of a region encoding luciferase in the pGL2-Basic vector, and one NRE-specific reporter construct (4xNREluc) was generated in which a tandem repeat of four NREs was inserted upstream of the SV40 promoter in the pGL2-Promoter vector (Fig. 6A). We transfected RCS cells with these reporter constructs together with the mammalian expression plasmid pFLAG-LRF. As shown in Fig. 6B, LRF produced >90% inhibition of the reporter constructs with an NRE (–1925COMPluc and –1775COMPluc), and this repression was dose-dependent (Fig. 6D); as expected, LRF also significantly repressed the activity of 4xNREpGL2-Promoter (which contains four tandem repeats of NRE) (Fig. 6C), indicating that the NRE is sufficient for LRF binding in the transfected cells. Given that LRF also repressed the activity of two other reporter constructs without an NRE (–{Delta}1925COMPluc and –592COMPluc), but to a lesser degree (~40% inhibition) (Fig. 6B), we next examined whether LRF also binds to the proximal region of the COMP promoter using a magnetic bead assay. Both a 592-bp proximal region of the COMP promoter (–592 to –1) and a 400-bp distal region of the COMP promoter (–1925 to –1526) were labeled with biotin. Streptavidin-coupled magnetic beads conjugated to these biotin-labeled probes were incubated with nuclear extracts expressing pFLAG-LRF. Bound FLAG-LRF was detected by immunoblotting with anti-FLAG antibody. As shown in Fig. 6E, the NRE-containing distal region bound to LRF, but the proximal region did not, indicating that LRF cannot directly bind to the proximal region of the COMP promoter.



View larger version (16K):
[in this window]
[in a new window]
 
FIG. 6.
Inhibition by LRF of COMP-specific reporter constructs and endogenous COMP gene expression. A, schematic structures of four COMP-specific reporter constructs and one NRE-specific reporter construct. The indicated segments from the 5'-flanking region of the COMP gene were linked to a DNA segment encoding luciferase (Luc; open boxes). Numbers indicate distances in nucleotides from the first nucleotide of intron 1. The NRE is represented by ovals. B, LRF inhibits COMP-specific reporter construct activities. The indicated reporter gene was transfected into RCS cells with 4 µg of pFLAG-LRF expression plasmid as well as a pSVGal internal control plasmid. At 48 h after transfection, the cultures were lysed, and the {beta}-galactosidase and luciferase activities were determined. The activity of –1925COMPluc was arbitrarily set to 1 in the absence of LRF. rel., relative. C, LRF represses NRE-containing pGL2-Promoter activity. 4xNREpGL2-Promoter (containing four tandem repeats of NRE) was transfected into RCS cells with or without 4 µg of pFLAG-LRF expression plasmid as well as a pSVGal internal control plasmid. D, LRF-mediated repression is dose-dependent. The reporter gene –1925COMPluc was transfected into RCS cells together with the indicated amount of pFLAG-LRF expression plasmid as well as a pSVGal internal control plasmid. E, LRF does not bind to the proximal region of the COMP promoter (magnetic bead assay). Five picomoles of the biotin-tagged proximal region (–592 to –1) and distal region (–1925 to –1526) of the COMP promoter were conjugated to streptavidin-coupled magnetic beads and incubated with 500 µg of nuclear extracts expressing FLAG-LRF. The FLAG-LRF bound to the beads was subjected to SDS-PAGE and immunoblotting with anti-FLAG antiserum. The FLAG-LRF band is indicated by the arrow. F, exogenous expression of LRF reduces COMP gene expression in RCS cells (RT-PCR). RNAs isolated from untransfected RCS cells or from RCS cells transfected with 30 µg of pFLAG-LRF expression plasmid or control pCMV vector were reverse-transcribed, and the mRNA expression of COMP and GAPDH (serving as an internal control) was examined by RT-PCR.

 
To confirm whether exogenous expression of LRF represses expression of the endogenous COMP gene, we transfected RCS cells, which express COMP, with the pFLAG-LRF expression plasmid and performed RT-PCR to determine the COMP mRNA levels. As shown in Fig. 6F, COMP gene expression was inhibited in the pFLAG-LRF-transfected RCS cells, in contrast with untransfected cells and cells transfected with the control pCMV vector.

Generation of an LRF Stable Line in Which LRF Is Constitutively Overexpressed—To determine whether stable overexpressed LRF affects the expression of endogenous COMP, we generated LRF stable lines in murine C3H10T1/2 progenitor cells, which undergo chondrogenic differentiation in the presence of inducers for chondrocyte differentiation. C3H10T1/2 cells were transfected with either an empty vector (for generating a control line) or the expression plasmid pFLAG-LRF together with the selective marker pMiniHgh, which confers hygromycin resistance upon transfected cells; the resultant clones were selected and amplified, and the level of ectopically expressed FLAG-LRF was examined by Western blotting with the anti-FLAG probe. As shown in Fig. 7, FLAG-LRF was clearly expressed in three selected LRF stable clones, i.e. clones 1, 9, and 11 (lanes 4–6, respectively), and absent in both parental C3H10T1/2 cells (lane 1) and the control stable lines pc1 and pc2 (lanes 2 and 3, respectively).



View larger version (38K):
[in this window]
[in a new window]
 
FIG. 7.
Expression of FLAG-LRF in LRF stable lines. C3H10T1/2 cells transfected with the expression plasmid pFLAG-LRF or empty vector were incubated with hygromycin. Individual colonies were isolated, and FLAG-LRF expression was analyzed by immunoblotting. Twenty micrograms of lysate prepared from parental C3H10T1/2 (10T1/2) cells, control lines (pc1 and pc2), and LRF stable lines (clones 1, 9, and 11) were subjected to SDS-PAGE and immunoblotting with anti-FLAG antibody. The band corresponding to FLAG-LRF is indicated by the arrow.

 
LRF Overexpression Inhibits Endogenous COMP Gene Expression—To determine the effects of stable overexpressed LRF on the expression of COMP, we first performed RT-PCR using micromass cultures of C3H10T1/2, control, and LRF stable lines exposed to recombinant BMP-2 for 1 week (Fig. 8A). COMP mRNA was expressed in the BMP-2-treated micromass cultures of parental C3H10T1/2 cells and the control stable lines pc1 and pc2 (lanes 1–3, respectively), whereas BMP-2-induced COMP expression in the course of chondrogenic differentiation was totally inhibited in LRF stable lines (lanes 4–6). We next performed Western blotting with anti-COMP antibodies using the same micromass cultures (Fig. 8B). In agreement with PCR data, the COMP protein was expressed in the control stable lines (lanes 1–3), but not in the LRF stable lines (lanes 4–6). Taken together, these results demonstrate that overexpression of LRF represses endogenous BMP-2-induced COMP expression.



View larger version (28K):
[in this window]
[in a new window]
 
FIG. 8.
Effects of LRF overexpression on BMP-2-induced COMP expression in C3H10T1/2 micromass cultures. A, RT-PCR. Total RNA was prepared from micromass cultures of control lines (C3H10T1/2 (10T1/2), pc1, and pc2) or LRF stable lines (clones 1, 9, and 11) in the presence of 100 ng/ml recombinant BMP-2 for 7 days, and the mRNA expression of COMP and GAPDH (serving as an internal control) was examined by RT-PCR. Similar results were obtained in repeated studies. B, Western blot assay. Twenty-five micrograms of cell lysates prepared from the same cultures as A were used to perform immunoblot assay with anti-COMP polyclonal antiserum, followed by horseradish peroxidase-conjugated anti-rabbit IgG. The COMP band is indicated by the arrow.

 
LRF Overexpression Inhibits Chondrocyte Differentiation in C3H10T1/2 Micromass Cultures—In addition to COMP, several other extracellular matrix molecules of cartilage, such as aggrecan and collagen types II, IX, X, and XI, are hallmarks for monitoring the process of chondrogenic differentiation (60, 61). Type X collagen is indicative of hypertrophic chondrocytes (62, 63). We next performed RT-PCRs using the mRNAs isolated from micromass cultures of C3H10T1/2, control, and LRF stable lines exposed to recombinant BMP-2 for 1 week with the specific primers for collagen types II, IX, X, and XI; aggrecan; and GAPDH (used as an internal control). As shown in Fig. 9A, aggrecan and collagen types II, IX, X, and XI were expressed in the BMP-2-treated cultures (lanes 1–3), but expression of collagen type II, IX, and X mRNAs during BMP-2-induced chondrogenic differentiation was completely repressed in the presence of ectopically expressed FLAG-LRF (lanes 4–6). Although aggrecan and type XI collagen mRNAs were still positive in the LRF stable lines (lanes 4–6), these levels were lower compared with the controls (lanes 1–3).



View larger version (43K):
[in this window]
[in a new window]
 
FIG. 9.
Effects of LRF overexpression on BMP-2-induced chondrogenesis in C3H10T1/2 micromass cultures. A, total RNA was prepared from micromass cultures of control lines (C3H10T1/2 (10T1/2), pc1, and pc2) or LRF stable lines (clones 1, 9, and 11) in the presence of 100 ng/ml recombinant BMP-2 for 7 days. The mRNA expression of collagen types II, IX, X, and XI; aggrecan; and GAPDH (serving as an internal control) was examined by RT-PCR. Similar results were obtained in repeated studies. B, shown are the results from whole mount Alcian blue histochemistry. Staining was performed on the micromass cultures of control lines (C3H10T1/2, pc1, and pc2) or LRF stable lines (clones 1, 9, and 11) treated with 100 ng/ml recombinant BMP-2 for 14 days.

 
We also performed Alcian blue staining to confirm the repression of BMP-2-induced chondrogenesis by LRF overexpression using the micromass cultures of C3H10T1/2, control, and LRF stable lines exposed to recombinant BMP-2 for 2 weeks (Fig. 9B). Positive staining in the control lines (upper) was strongly inhibited in the LRF stable lines (lower). The results from these assays show that stable overexpression of LRF inhibited BMP-2-induced chondrogenesis in C3H10T1/2 micromass cultures.

LRF Associates with HDAC1, and Its Repression Requires Deacetylase Activity—LRF contains a POZ domain, which is a conserved protein-protein interaction motif found in many transcription factors, and the most striking common property of the POZ domain-containing transcription factors is their ability to repress transcription via interaction with other key regulatory proteins such as HDACs (64, 65). A co-immunoprecipitation assay was first performed to determine whether LRF binds to HDAC1 in vivo (Fig. 10A). The cell extracts were first incubated with anti-LRF (lane 2) or anti-HDAC1 (lane 3) antibody or with control IgG (lane 4), and the immunoprecipitated complexes were detected with anti-HDAC1 antibody. A specific HDAC1 band was present in the immunoprecipitated complexes brought down by anti-LRF (lane 2) and anti-HDAC1 (lane 3) antibodies, but not by control IgG (lane 3), demonstrating that LRF associates with HDAC1 in vivo.

The interaction between LRF and HDAC1 was confirmed using an in vitro protein-protein interaction assay (an in vitro GST pull-down assay) (Fig. 10B). Briefly, affinity-purified GST as well as N-terminally (aa 51–482) and C-terminally (aa 1–432) truncated HDAC1 fused to GST that was immobilized on glutathione-Sepharose beads were incubated with in vitro translated LRF and, after washing, resolved by Western blotting. Similar to the GST control (lane 2), C-terminally truncated GST-HDAC1-(1–432) did not pull down the LRF protein (lane 4), whereas N-terminally truncated GST-HDAC1-(51–482) efficiently pulled down LRF (lane 3), indicating that the C-terminal (but not N-terminal) 50 amino acids of HDAC1 contain LRF-binding domains. To narrow down the LRF-binding sequences in the C terminus of HDAC1, two additional mutants were generated, and the same in vitro binding assay was performed (Fig. 10C). Removal of 15 amino acids from the C terminus (compare GST-HDAC1-(51–467) with GST-HDAC1-(51–482)) did not affect interaction, nor did further removal of the other 15 amino acids from the C terminus (GST-HDAC1-(51–452)). Given that mutant HDAC1-(1–432) failed to bind LRF (Fig. 10B, lane 4), it appears that 20 amino acids (aa 433–452) of HDAC1 are essential for interacting with LRF.

To determine whether the LRF·HDAC1 protein complex is detectable in the NRE of the COMP promoter, ChIP assays were performed in C3H10T1/2 progenitor cells, which express both LRF and HDAC1. Endogenous HDAC1·LRF·DNA complexes were immunoprecipitated with control IgG (negative control) (Fig. 10D, lane 3), anti-LRF antibody (positive control) (lane 2), or anti-HDAC1 antibody (lane 4), and the DNA purified from these coprecipitations and input DNA (lane 1) were analyzed by PCR. We observed amplifications of COMP promoter DNA from input DNA and DNAs isolated from both anti-LRF and anti-HDAC1 antibody-precipitated (but not control IgG-precipitated) complexes. These results demonstrate that the LRF·HDAC1 complex is detectable in the NRE of the COMP gene promoter.

To examine whether HDACs are required for the LRF-mediated repression of the COMP reporter construct, RCS cells transfected with the COMP-specific reporter construct –1925COMPluc and the mammalian expression plasmid pFLAG-LRF were cultured in the presence of different concentrations of TSA for 48 h, and luciferase and {beta}-galactosidase activities were measured. As shown in Fig. 10E, LRF inhibition of the COMP promoter was attenuated when TSA was added to the medium, demonstrating that HDACs are involved in the LRF-mediated repression of COMP promoter activity.

We next tested whether COMP gene expression in C3H10T1/2 cells can be stimulated by TSA. As revealed by RT-PCR (Fig. 10F), COMP mRNA was detectable in the TSA-treated (but not untreated) C3H10T1/2 cells, indicating that TSA induces COMP gene expression and that this induction is dose-dependent.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Our previous studies identified an NRE located between –1775 and –1746 of the 5'-flanking region of the murine COMP gene (35, 39). In this study, a yeast one-hybrid screen was used to identify transcription factors that bind to this NRE. We present comprehensive evidence that LRF, which contains a POZ domain, a conserved 120-amino acid motif involved in transcriptional repression and dimerization, and four Krüppel-like zinc finger DNA-binding motifs (44), binds directly to the NRE in the promoter of the COMP gene. We also present evidence that repression of the COMP promoter by LRF blocks both endogenous COMP gene expression as well as chondrogenesis of C3H10T1/2 micromass cultures. The molecular mechanism underlying LRF-mediated gene transcription appears to involve the association of LRF with HDAC1.

Although a 9-bp guanidine-rich LBE (GAGGGTCCC) in the 30-bp NRE (identified via an EMSA with a series of mutant NRE probes) of the mouse COMP promoter is essential for binding to LRF, the following six nucleotides (GGTCCC) also appear to be involved in the association between LRF and the LBE because its mutation reduces binding intensity (Fig. 5). These results suggest that these six nucleotide (GGTCCC) may act as the surrendering matrix sequence of the core-binding sequence and facilitate the binding of LRF/FBI-1 to DNA. Sequence analysis revealed that the human COMP gene promoter also contains a typical consensus site (GGGGGCCTC, –1294 to –1302) (59) for binding LRF/FBI-1, indicating that FBI-1 is very likely to repress COMP gene expression in human as LRF does in mouse.

It has also been reported that FBI-1 binds to DNA in a flexible manner (58, 59) and that OCZF, the rat homolog of LRF, binds to both the cKrox tandem site and the Egr-1 single site, albeit with weaker affinity than their cognate proteins (48). The cKrox gene family, including human cKrox-{alpha}, cKrox-{beta} (another name for FBI-1), and cKrox-{gamma} as well as the murine cKrox-{beta} homolog, LRF, was found to repress transcription driven by promoters for the type I and II collagen, fibronectin, and elastin genes (66, 67). LRF also inhibits the BMP-2-induced endogenous expression of COMP; collagen types II, IX, X, and XI; and aggrecan (Figs. 8 and 9), suggesting that LRF acts as a general transcriptional repressor that regulates multiple extracellular matrix genes, probably via binding to the regulatory regions of those genes. It remains to determine whether each of these genes has LBE or LBE-like sequences in the regulatory regions and, if not, to identify the alternative LBEs in the promoters of these genes.

In addition to producing dose-dependent inhibition of the NRE-containing COMP-specific reporter genes, LRF also repressed the activities of two other COMP-specific reporter constructs without an NRE (-{Delta}1925COMPluc and –592COM-Pluc) to a lesser degree (~40% inhibition) (Fig. 6B), which raises the possibility that LRF may also bind to DNA elements other than the NRE in the COMP promoter. A magnetic bead assay (50) was performed to address this possibility. In this assay, the NRE-containing distal region retained LRF, but the proximal region did not, demonstrating that the LRF does not directly bind to the proximal region of the COMP promoter (Fig. 6E). Thus, inhibition of NRE-lacking COMP-specific reporter constructs by LRF might be due to the indirect regulation by LRF of the COMP promoter; for example, LRF may exert its effects via cooperating with some as yet unidentified transcription factors that directly associate with the proximal region of the COMP promoter.

LRF contains a POZ domain, which is a well defined, conserved protein-protein interaction motif found in many transcription factors, oncogenic proteins, and ion channel proteins and in some actin-associated proteins (68, 69). The most striking and common property of the POZ domain-containing transcription factors is their ability to repress transcription (64, 65, 68, 70, 71). The ability of the domain to interact with other key regulatory proteins such as corepressor proteins and other transcription factors appears to be important for repression (64, 65). In particular, the POZ domains of human PLZF (promyelocytic leukemia zinc finger transcription factor) and Bcl-6 (B-cell lymphoma transcription factor-6) have been shown to interact with other factors as well as with HDAC (65, 71). It has been suggested that "chromatin remodeling" by the HDAC complex recruited by the POZ domain represses transcription (65, 72, 73). LRF binds to HDAC1 through an Asp/Glu-rich 20-amino acid unique segment (aa 433–452) in the C terminus of HDAC1 (Fig. 10, B and C) other than the LXCXE-like motif (IACEE, aa 415–419) that is required for interactions between HDAC1 and the pocket protein family, including Rb, p107, and p130 (7476). LRF inhibition of the COMP promoter was attenuated when TSA was added to the medium, demonstrating the potential involvement of HDACs in the LRF-mediated repression of COMP promoter activity. Given that TSA could not completely overcome LRF inhibition, the independent pathways of HDAC might be also involved in LRF-mediated gene repression.

It appears that LRF functions as a universal transcriptional repressor and regulates multiple biological processes. FBI-1, the human homolog of LRF (first purified as a cellular factor that binds to the human immunodeficiency virus inducer), has been shown to modulate human immunodeficiency virus type 1 Tat transactivation and repression of some cellular genes (45, 47, 58). OCZF, the rat homolog of LRF, is highly expressed in osteoclasts, and antisense OCZF cDNA suppresses the formation of osteoclast-like multinucleated cells in bone marrow culture (48). These results suggest that OCZF plays an important role in the late stage of osteoclastogenesis. LRF was reported to repress the promoter activity of several extracellular genes (66). Our unbiased genetic screen and EMSA as well as ChIP showed that LRF directly binds to the NRE in the promoter region of the COMP gene and associates with HDAC1, and our functional assays demonstrated that LRF regulates COMP gene expression and chondrogenesis of high density micromass cultures of C3H10T1/2 cells.


    FOOTNOTES
 
* This work was supported by research grants from the Orthopaedic Research and Education Foundation and the New York Chapter of the Arthritis Foundation and by National Institutes of Health Grant RO1 AR45612-01A2. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

To whom correspondence should be addressed: Musculoskeletal Research Center, Hospital for Joint Diseases, Rm. 1500, 301 East 17th St., New York, NY 10003. Tel.: 212-598-6567; Fax: 212-598-6096; E-mail: PEDiCesare{at}aol.com.

1 The abbreviations used are: COMP, cartilage oligomeric matrix protein; RCS, rat chondrosarcoma; NRE, negative regulatory element; LRF, leukemia/lymphoma-related factor; OCZF, osteoclast-derived zinc finger; HDAC, histone deacetylase; aa, amino acids; GST, glutathione S-transferase; EMSA, electrophoretic mobility shift assay; ChIP, chromatin immunoprecipitation; HEK, human embryonic kidney; TSA, trichostatin A; RT, reverse transcription; BMP-2, bone morphogenetic protein-2; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; LBE, LRF-binding element. Back


    ACKNOWLEDGMENTS
 
We thank Drs. R. L. Widom and A. Zelent for providing the pFLAG-LRF and pFLAG-LRF{Delta}POZ plasmids, Dr. Tony Kouzarides for providing the pGEX-HDAC1-(1–432) and pGEX-HDAC1-(51–482) plasmids, Dr. Paul Issack for scientific discussion, and William Green for technical assistance.



    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Ferguson, C. M., Miclau, T., Hu, D., Alpern, E., and Helms, J. A. (1998) Ann. N. Y. Acad. Sci. 857, 33-42[CrossRef][Medline] [Order article via Infotrieve]
  2. Erlebacher, A., Filvaroff, E. H., Gitelman, S. E., and Derynck, R. (1995) Cell 80, 371-378[CrossRef][Medline] [Order article via Infotrieve]
  3. Di Cesare, P. E., Morgelin, M., Mann, K., and Paulsson, M. (1994) Eur. J. Biochem. 223, 927-937[Medline] [Order article via Infotrieve]
  4. Di Cesare, P., Hauser, N., Lehman, D., Pasumarti, S., and Paulsson, M. (1994) FEBS Lett. 354, 237-240[CrossRef][Medline] [Order article via Infotrieve]
  5. Di Cesare, P. E., Carlson, C. S., Stollerman, E. S., Chen, F. S., Leslie, M., and Perris, R. (1997) FEBS Lett. 412, 249-252[CrossRef][Medline] [Order article via Infotrieve]
  6. Di Cesare, P. E., Fang, C., Leslie, M. P., Tulli, H., Perris, R., and Carlson, C. S. (2000) J. Orthop. Res. 18, 713-720[CrossRef][Medline] [Order article via Infotrieve]
  7. Di Cesare, P. E., Fang, C., Leslie, M. P., Della Valle, C. J., Gold, J. M., Tulli, H., Perris, R., and Carlson, C. S. (1999) J. Orthop. Res. 17, 437-445[CrossRef][Medline] [Order article via Infotrieve]
  8. Di Cesare, P. E., Carlson, C. S., Stolerman, E. S., Hauser, N., Tulli, H., and Paulsson, M. (1996) J. Orthop. Res. 14, 946-955[CrossRef][Medline] [Order article via Infotrieve]
  9. Hedbom, E., Antonsson, P., Hjerpe, A., Aeschlimann, D., Paulsson, M., Rosa-Pimentel, E., Sommarin, Y., Wendel, M., Oldberg, A., and Heinegard, D. (1992) J. Biol. Chem. 267, 6132-6136[Abstract/Free Full Text]
  10. Morgelin, M., Engel, J., Heinegard, D., and Paulsson, M. (1992) J. Biol. Chem. 267, 14275-14284[Abstract/Free Full Text]
  11. Shen, Z., Heinegard, D., and Sommarin, Y. (1995) Matrix Biol. 14, 773-781[CrossRef][Medline] [Order article via Infotrieve]
  12. Efimov, V. P., Engel, J., and Malashkevich, V. N. (1996) Proteins 24, 259-262[CrossRef][Medline] [Order article via Infotrieve]
  13. Kajava, A. V. (1996) Proteins 24, 218-226[CrossRef][Medline] [Order article via Infotrieve]
  14. Di Cesare, P. E., Morgelin, M., Carlson, C. S., Pasumarti, S., and Paulsson, M. (1995) J. Orthop. Res. 13, 422-428[CrossRef][Medline] [Order article via Infotrieve]
  15. Kawaji, H., Nishimura, G., Watanabe, S., Mabuchi, A., Ikeda, T., Ohashi, H., Sasaki, A., Sano, T., and Ikegawa, S. (2002) Skeletal Radiol. 31, 730-737[Medline] [Order article via Infotrieve]
  16. Hashimoto, Y., Tomiyama, T., Yamano, Y., and Mori, H. (2003) Am. J. Pathol. 163, 101-110[Abstract/Free Full Text]
  17. Nakayama, H., Endo, Y., Aota, S., Sato, M., Fujita, T., and Kikuchi, S. (2003) Oncol. Rep. 10, 871-873[Medline] [Order article via Infotrieve]
  18. Song, H. R., Lee, K. S., Li, Q. W., Koo, S. K., and Jung, S. C. (2003) J. Hum. Genet. 48, 222-225[CrossRef][Medline] [Order article via Infotrieve]
  19. Mabuchi, A., Manabe, N., Haga, N., Kitoh, H., Ikeda, T., Kawaji, H., Tamai, K., Hamada, J., Nakamura, S., Brunetti-Pierri, N., Kimizuka, M., Takatori, Y., Nakamura, K., Nishimura, G., Ohashi, H., and Ikegawa, S. (2003) Hum. Genet. 112, 84-90[CrossRef][Medline] [Order article via Infotrieve]
  20. Kleerekoper, Q., Hecht, J. T., and Putkey, J. A. (2002) J. Biol. Chem. 277, 10581-10589[Abstract/Free Full Text]
  21. Briggs, M. D., Rasmussen, I. M., Weber, J. L., Yuen, J., Reinker, K., Garber, A. P., Rimoin, D. L., and Cohn, D. H. (1993) Genomics 18, 656-660[CrossRef][Medline] [Order article via Infotrieve]
  22. Briggs, M. D., Hoffman, S. M., King, L. M., Olsen, A. S., Mohrenweiser, H., Leroy, J. G., Mortier, G. R., Rimoin, D. L., Lachman, R. S., and Gaines, E. S. (1995) Nature 10, 330-336
  23. Briggs, M. D., Mortier, G. R., Cole, W. G., King, L. M., Golik, S. S., Bonaventure, J., Nuytinck, L., De Paepe, A., Leroy, J. G., Biesecker, L., Lipson, M., Wilcox, W. R., Lachman, R. S., Rimoin, D. L., Knowlton, R. G., and Cohn, D. H. (1998) Am. J. Hum. Genet. 62, 311-319[CrossRef][Medline] [Order article via Infotrieve]
  24. Hecht, J. T., Francomano, C. A., Briggs, M. D., Deere, M., Conner, B., Horton, W. A., Warman, M., Cohn, D. H., and Blanton, S. H. (1993) Genomics 18, 661-666[CrossRef][Medline] [Order article via Infotrieve]
  25. Hecht, J. T., Nelson, L. D., Crowder, E., Wang, Y., Elder, F. F., Harrison, W. R., Francomano, C. A., Prange, C. K., Lennon, G. G., and Deere, M. (1995) Nat. Genet. 10, 325-329[CrossRef][Medline] [Order article via Infotrieve]
  26. Cohn, D. H., Briggs, M. D., King, L. M., Rimoin, D. L., Wilcox, W. R., Lachman, R. S., and Knowlton, R. G. (1996) Ann. N. Y. Acad. Sci. 785, 188-194[Medline] [Order article via Infotrieve]
  27. Susic, S., McGrory, J., Ahier, J., and Cole, W. G. (1997) Clin. Genet. 51, 219-224[Medline] [Order article via Infotrieve]
  28. Mundlos, S., and Olsen, B. R. (1997) FASEB J. 11, 227-233[Abstract]
  29. Horton, W. A. (1996) Endocrinol. Metab. Clin. N. Am. 25, 683-697[CrossRef][Medline] [Order article via Infotrieve]
  30. Francomano, C. A., McIntosh, I., and Wilkin, D. J. (1996) Curr. Opin. Genet. Dev. 6, 301-308[CrossRef][Medline] [Order article via Infotrieve]
  31. Di Cesare, P. E., Chen, F. S., Moergelin, M., Carlson, C. S., Leslie, M. P., Perris, R., and Fang, C. (2002) Matrix Biol. 21, 461-470[CrossRef][Medline] [Order article via Infotrieve]
  32. Rosenberg, K., Olsson, H., Morgelin, M., and Heinegard, D. (1998) J. Biol. Chem. 273, 20397-20403[Abstract/Free Full Text]
  33. Zaucke, F., Dinser, R., Maurer, P., and Paulsson, M. (2001) Biochem. J. 358, 17-24[CrossRef][Medline] [Order article via Infotrieve]
  34. Recklies, A. D., Baillargeon, L., and White, C. (1998) Arthritis Rheum. 41, 997-1006[CrossRef][Medline] [Order article via Infotrieve]
  35. Issack, P. S., Fang, C. H., Leslie, M. P., and Di Cesare, P. E. (2000) J. Orthop. Res. 18, 345-350[Medline] [Order article via Infotrieve]
  36. Ekman, S., Reinholt, F. P., Hultenby, K., and Heinegard, D. (1997) Calcif. Tissue Int. 60, 547-553[CrossRef][Medline] [Order article via Infotrieve]
  37. Franzen, A., Heinegard, D., and Solursh, M. (1987) Differentiation 36, 199-210[CrossRef][Medline] [Order article via Infotrieve]
  38. Barry, F., Boynton, R. E., Liu, B., and Murphy, J. M. (2001) Exp. Cell Res. 268, 189-200[CrossRef][Medline] [Order article via Infotrieve]
  39. Issack, P. S., Liu, C.-j., Prazak, L., and Di Cesare, P. E. (2004) J. Orthop. Res. 22, 751-758[Medline] [Order article via Infotrieve]
  40. Sieweke, M. H., Tekotte, H., Frampton, J., and Graf, T. (1996) Cell 85, 49-60[CrossRef][Medline] [Order article via Infotrieve]
  41. Sieweke, M. (2000) Methods Mol. Biol. 130, 59-77[Medline] [Order article via Infotrieve]
  42. Oda, E., Shirasuna, K., Suzuki, M., Nakano, K., Nakajima, T., and Oda, K. (1998) Mol. Cell. Biol. 18, 4772-4782[Abstract/Free Full Text]
  43. Murakami, A., Ishida, S., Thurlow, J., Revest, J. M., and Dickson, C. (2001) Nucleic Acids Res. 29, 3347-3355[Abstract/Free Full Text]
  44. Davies, J. M., Hawe, N., Kabarowski, J., Huang, Q. H., Zhu, J., Brand, N. J., Leprince, D., Dhordain, P., Cook, M., Morriss-Kay, G., and Zelent, A. (1999) Oncogene 18, 365-375[CrossRef][Medline] [Order article via Infotrieve]
  45. Pessler, F., Pendergrast, P. S., and Hernandez, N. (1997) Mol. Cell. Biol. 17, 3786-3798[Abstract]
  46. Pendergrast, P. S., Wang, C., Hernandez, N., and Huang, S. (2002) Mol. Biol. Cell 13, 915-929[Abstract/Free Full Text]
  47. Morrison, D. J., Pendergrast, P. S., Stavropoulos, P., Colmenares, S. U., Kobayashi, R., and Hernandez, N. (1999) Nucleic Acids Res. 27, 1251-1262[Abstract/Free Full Text]
  48. Kukita, A., Kukita, T., Ouchida, M., Maeda, H., Yatsuki, H., and Kohashi, O. (1999) Blood 94, 1987-1997[Abstract/Free Full Text]
  49. Gao, L., Cueto, M. A., Asselbergs, F., and Atadja, P. (2002) J. Biol. Chem. 277, 25748-25755[Abstract/Free Full Text]
  50. Liu, C.-j., Wang, H., and Lengyel, P. (1999) EMBO J. 18, 2845-2854[CrossRef][Medline] [Order article via Infotrieve]
  51. Liu, C.-j., Ding, B., Wang, H., and Lengyel, P. (2002) Mol. Cell. Biol. 22, 2893-2905[Abstract/Free Full Text]
  52. Liu, C.-j., Dib-Hajj, S. D., Renganathan, M., Cummins, T. R., and Waxman, S. G. (2003) J. Biol. Chem. 278, 1029-1036[Abstract/Free Full Text]
  53. Liu, C.-j., Dib-Hajj, S. D., and Waxman, S. G. (2001) J. Biol. Chem. 276, 18925-18933[Abstract/Free Full Text]
  54. Liu, C.-j., Dib-Hajj, S. D., Black, J. A., Greenwood, J., Lian, Z., and Waxman, S. G. (2001) J. Biol. Chem. 276, 46553-46561[Abstract/Free Full Text]
  55. Liu, C.-j., Wang, H., Zhao, Z., Yu, S., Lu, Y. B., Meyer, J., Chatterjee, G., Deschamps, S., Roe, B. A., and Lengyel, P. (2000) Mol. Cell. Biol. 20, 7024-7036[Abstract/Free Full Text]
  56. Fischer, L., Boland, G., and Tuan, R. S. (2002) J. Biol. Chem. 277, 30870-30878[Abstract/Free Full Text]
  57. Kozak, M. (1987) Nucleic Acids Res. 15, 8125-8148[Abstract/Free Full Text]
  58. Lee, D. K., Suh, D., Edenberg, H. J., and Hur, M. W. (2002) J. Biol. Chem. 277, 26761-26768[Abstract/Free Full Text]
  59. Pessler, F., and Hernandez, N. (2003) J. Biol. Chem. 278, 29327-29335[Abstract/Free Full Text]
  60. Lee, H. S., Huang, G. T., Chiang, H., Chiou, L. L., Chen, M. H., Hsieh, C. H., and Jiang, C. C. (2003) Stem Cells 21, 190-199[Abstract/Free Full Text]
  61. Bianco, P., Cancedda, F. D., Riminucci, M., and Cancedda, R. (1998) Matrix Biol. 17, 185-192[CrossRef][Medline] [Order article via Infotrieve]
  62. Zhang, P., Liegeois, N. J., Wong, C., Finegold, M., Hou, H., Thompson, J. C., Silverman, A., Harper, J. W., DePinho, R. A., and Elledge, S. J. (1997) Nature 387, 151-158[CrossRef][Medline] [Order article via Infotrieve]
  63. Yan, Y., Frisen, J., Lee, M. H., Massague, J., and Barbacid, M. (1997) Genes Dev. 11, 973-983[Abstract/Free Full Text]
  64. Dong, S., Zhu, J., Reid, A., Strutt, P., Guidez, F., Zhong, H. J., Wang, Z. Y., Licht, J., Waxman, S., Chomienne, C., Chen, Z., Zelent, A., and Chen, S.-J. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 3624-3629[Abstract/Free Full Text]
  65. Lin, R. J., Nagy, L., Inoue, S., Shao, W., Miller, W. H., Jr., and Evans, R. M. (1998) Nature 391, 811-814[CrossRef][Medline] [Order article via Infotrieve]
  66. Widom, R. L., Lee, J. Y., Joseph, C., Gordon-Froome, I., and Korn, J. H. (2001) Matrix Biol. 20, 451-462[CrossRef][Medline] [Order article via Infotrieve]
  67. Widom, R. L., Culic, I., Lee, J. Y., and Korn, J. H. (1997) Gene (Amst.) 198, 407-420[CrossRef][Medline] [Order article via Infotrieve]
  68. Bardwell, V. J., and Treisman, R. (1994) Genes Dev. 8, 1664-1677[Abstract/Free Full Text]
  69. Albagli, O., Dhordain, P., Deweindt, C., Lecocq, G., and Leprince, D. (1995) Cell Growth & Differ. 6, 1193-1198[Abstract]
  70. Deltour, S., Guerardel, C., and Leprince, D. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 14831-14836[Abstract/Free Full Text]
  71. Huynh, K. D., Fischle, W., Verdin, E., and Bardwell, V. J. (2000) Genes Dev. 14, 1810-1823[Abstract/Free Full Text]
  72. Heinzel, T., Lavinsky, R. M., Mullen, T. M., Soderstrom, M., Laherty, C. D., Torchia, J., Yang, W. M., Brard, G., Ngo, S. D., Davie, J. R., Seto, E., Eisenman, R. N., Rose, D. W., Glass, C. K., and Rosenfeld, M. G. (1997) Nature 387, 43-48[CrossRef][Medline] [Order article via Infotrieve]
  73. Nagy, L., Kao, H. Y., Chakravarti, D., Lin, R. J., Hassig, C. A., Ayer, D. E., Schreiber, S. L., and Evans, R. M. (1997) Cell 89, 373-380[CrossRef][Medline] [Order article via Infotrieve]
  74. Brehm, A., Miska, E. A., McCance, D. J., Reid, J. L., Bannister, A. J., and Kouzarides, T. (1998) Nature 391, 597-601[CrossRef][Medline] [Order article via Infotrieve]
  75. Ferreira, R., Magnaghi-Jaulin, L., Robin, P., Harel-Bellan, A., and Trouche, D. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 10493-10498[Abstract/Free Full Text]
  76. Magnaghi-Jaulin, L., Groisman, R., Naguibneva, I., Robin, P., Lorain, S., Le Villain, J. P., Troalen, F., Trouche, D., and Harel-Bellan, A. (1998) Nature 391, 601-605[CrossRef][Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
W.-I. Choi, B.-N. Jeon, C.-O. Yun, P.-H. Kim, S.-E. Kim, K.-Y. Choi, S. H. Kim, and M.-W. Hur
Proto-oncogene FBI-1 Represses Transcription of p21CIP1 by Inhibition of Transcription Activation by p53 and Sp1
J. Biol. Chem., May 8, 2009; 284(19): 12633 - 12644.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. A. Lin, L. Kong, X.-H. Bai, Y. Luan, and C.-j. Liu
miR-199a*, a Bone Morphogenic Protein 2-responsive MicroRNA, Regulates Chondrogenesis via Direct Targeting to Smad1
J. Biol. Chem., April 24, 2009; 284(17): 11326 - 11335.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B.-N. Jeon, J.-Y. Yoo, W.-I. Choi, C.-E. Lee, H.-G. Yoon, and M.-W. Hur
Proto-oncogene FBI-1 (Pokemon/ZBTB7A) Represses Transcription of the Tumor Suppressor Rb Gene via Binding Competition with Sp1 and Recruitment of Co-repressors
J. Biol. Chem., November 28, 2008; 283(48): 33199 - 33210.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. H. Huh, J.-H. Ryu, and J.-S. Chun
Regulation of Type II Collagen Expression by Histone Deacetylase in Articular Chondrocytes
J. Biol. Chem., June 8, 2007; 282(23): 17123 - 17131.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Luan, X.-P. Yu, K. Xu, B. Ding, J. Yu, Y. Huang, N. Yang, P. Lengyel, P. E. Di Cesare, and C.-j. Liu
The Retinoblastoma Protein Is an Essential Mediator of Osteogenesis That Links the p204 Protein to the Cbfa1 Transcription Factor Thereby Increasing Its Activity
J. Biol. Chem., June 8, 2007; 282(23): 16860 - 16870.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
R. Sakimura, K. Tanaka, S. Yamamoto, T. Matsunobu, X. Li, M. Hanada, T. Okada, T. Nakamura, Y. Li, and Y. Iwamoto
The Effects of Histone Deacetylase Inhibitors on the Induction of Differentiation in Chondrosarcoma Cells
Clin. Cancer Res., January 1, 2007; 13(1): 275 - 282.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Furumatsu, M. Tsuda, K. Yoshida, N. Taniguchi, T. Ito, M. Hashimoto, T. Ito, and H. Asahara
Sox9 and p300 Cooperatively Regulate Chromatin-mediated Transcription
J. Biol. Chem., October 21, 2005; 280(42): 35203 - 35208.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
279/45/47081    most recent
M405288200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Liu, C.-j.
Right arrow Articles by Di Cesare, P. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liu, C.-j.
Right arrow Articles by Di Cesare, P. E.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2004 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement