Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M408926200 on August 25, 2004

J. Biol. Chem., Vol. 279, Issue 47, 48550-48561, November 19, 2004
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
279/47/48550    most recent
M408926200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pawliczak, R.
Right arrow Articles by Shelhamer, J. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pawliczak, R.
Right arrow Articles by Shelhamer, J. H.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Cytosolic Phospholipase A2 Group IV{alpha} but Not Secreted Phospholipase A2 Group IIA, V, or X Induces Interleukin-8 and Cyclooxygenase-2 Gene and Protein Expression through Peroxisome Proliferator-activated Receptors {gamma} 1 and 2 in Human Lung Cells*

Rafal Pawliczak{ddagger}§, Carolea Logun{ddagger}, Patricia Madara{ddagger}, Marion Lawrence{ddagger}, Grzegorz Woszczek{ddagger}, Anetta Ptasinska{ddagger}, Marek L. Kowalski§, Tong Wu¶, and James H. Shelhamer{ddagger}||

From the {ddagger}Critical Care Medicine Department, National Institutes of Health, Bethesda, Maryland 20892, the §Department of Allergy and Clinical Immunology, Medical University of Lodz, Lodz 92213, Poland, and the Department of Pathology, University of Pittsburgh School of Medicine, Pittsburgh, Pennsylvania 15213

Received for publication, August 4, 2004


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
It has been reported that interleukin-8 (IL-8) and cyclooxygenase-2 (COX-2) expression is regulated by peroxisome proliferator-activated receptor (PPAR)-{gamma} synthetic ligands. We have shown previously that cytosolic phospholipase A2 (cPLA2) is able to activate gene expression through PPAR-{gamma} response elements (Pawliczak, R., Han, C., Huang, X. L., Demetris, A. J., Shelhamer, J. H., and Wu, T. (2002) J. Biol. Chem. 277, 33153–33163). In this study we investigated the influence of cPLA2 and secreted phospholipase A2 (sPLA2) Group IIA, Group V, and Group X on IL-8 and COX-2 expression in human lung epithelial cells (A549 cells). We also studied the results of cPLA2 activation by epidermal growth factor (EGF) and calcium ionophore (A23187 [GenBank] ) on IL-8 and COX-2 reporter gene activity, mRNA level, and protein synthesis. cPLA2 overexpression and activation increased both IL-8 and COX-2 reporter gene activity. Overexpression and activation of Group IIA, Group V, or Group X sPLA2s did not increase IL-8 and COX-2 reporter gene activity. Methyl arachidonyl fluorophosphate, a cPLA2 inhibitor, inhibited the effect of A23187 [GenBank] and of EGF on both IL-8 and COX-2 reporter gene activity, steady state levels of IL-8 and COX-2 mRNA, and IL-8 and COX-2 protein expression. Small inhibitory RNAs directed against PPAR-{gamma}1 and -{gamma}2 blunted the effect of A23187 [GenBank] and of EGF on IL-8 and COX-2 protein expression. Moreover small inhibitory RNAs directed against cPLA2 decreased the effect of A23187 [GenBank] and EGF on IL-8 and COX-2 protein expression. These results demonstrate that cPLA2 has an influence on IL-8 and COX 2 gene and protein expression at least in part through PPAR-{gamma}.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
85-kDa cytosolic phospholipase A2 (cPLA2)1 is a cytoplasmic enzyme that metabolizes phospholipids to release arachidonic acid. Upon activation by various stimuli (including but not limited to calcium ionophore (A23187 [GenBank] ), IL-1{beta}, tumor necrosis factor-{alpha}, and interferon-{gamma}) cPLA2 is translocated to the cellular membranes, releasing arachidonic acid from membrane phospholipids (1–4). Stimuli such as epidermal growth factor (EGF), oxidative stress, or IL-1{beta} may also cause cPLA2 activation through its phosphorylation (5, 6). Previously we have reported that cPLA2 is able to alter gene expression through PPAR-{gamma} activation and binding to peroxisome proliferator response elements (4). The calcium ionophore A23187 [GenBank] activates cPLA2 by increasing intracellular calcium levels, causing cPLA2 translocation to the nuclear envelope (4, 6, 7). EGF is also thought to increase cytosolic phospholipase A2 activity through activation of the mitogen-activated protein kinase pathway and phosphorylation of cPLA2 at serine 505 (and possibly other serine residues) (5). Both stimuli are known to increase cPLA2 enzymatic activity and arachidonate release.

PLA2 enzymes catalyze the hydrolysis of membrane glycerophospholipids to liberate arachidonic acid and lysophospholipids. So far, more than 20 enzymes that possess PLA2 activity have been identified and cloned in mammals (for reviews, see Refs. 8–15). PLA2s have been classified according to their molecular weight, homology, and calcium influence on enzyme activity. cPLA2 appears to play a role in intracellular arachidonate release, whereas low molecular weight PLA2s (such as Groups IA, IB, IIA, IIC, and V) may be involved in extracellular arachidonic acid release due to the fact that they are secreted into extracellular milieu upon cell stimulation. Thus, there may be distinct roles or cross-talk between PLA2s in cell signaling (16, 17). On the other hand a group of calcium-independent phospholipases A2 seems to have a broader substrate specificity. Several lines of evidence (for a review, see Ref. 18) suggest that the Group VI iPLA2 may be responsible for phospholipid fatty acid remodeling in resting cells. The role of iPLA2 in intracellular cell signaling remains to be clarified.

IL-8 is a chemokine that is produced and secreted by human lung cells (19, 20). It has strong chemotactic properties for neutrophils and eosinophils. Moreover IL-8 is an important proinflammatory cytokine that plays a role in allergic inflammation.

The IL-8 promoter contains a PPAR-{gamma} response element localized to –1060 relative to the transcription start site, suggesting that PPAR-{gamma} may play a role in regulation of IL-8 transcription. It has been reported that several PPAR-{gamma} agonists such as troglitazone, rosiglitazone, and others activate IL-8 transcription and enhanced IL-8 secretion in many cell systems including but not limited to lung cells (21–25).

Cyclooxygenase is a key enzyme in prostaglandin synthesis. Cyclooxygenase exists in two isoforms (26). COX-1 is a housekeeping gene constitutively expressed in most human cells. COX-2 is a highly inducible cyclooxygenase isoform. Various proinflammatory stimuli such as IL-1{beta}, tumor necrosis factor-{alpha}, and interferon-{gamma} have been reported to increase COX-2 expression in many biological systems including bronchial cells (27–29). The COX-2 promoter contains a PPRE, thus PPAR-{gamma} agonists including anti-inflammatory drugs may influence COX-2 transcription and expression. 15-{Delta}12,14-Prostaglandin J2, thiazolidinediones, and non-steroidal anti-inflammatory drugs have been reported to alter COX-2 expression (22, 24, 30, 31). As mentioned cPLA2 activation might increase expression of genes containing PPRE in promoter regions. This hypothesis has been proved using an artificial reporter gene as described elsewhere (4). The purpose of this study was to investigate whether Group IVA cPLA2 and other phospholipases (such as secreted phospholipase A2 Group IIA, V, or X) might influence IL-8 and COX-2 gene and protein expression in human lung cells.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Materials—A549 cells, a human adenocarcinoma cell line, were obtained from ATTC (American Type Culture Collection, Manassas, VA) and were grown in Ham's F-12K medium (BIOSOURCE) with 10% fetal bovine serum (BIOSOURCE) and 2 mM of L-Glutamine (BIOSOURCE). All experiments were performed when cells were 80–90% confluent. Methyl arachidonyl fluorophosphate (MAFP) was obtained from Calbiochem. Bromoenol lactone (BEL), an iPLA2 inhibitor, and thioetheramide-PC, an sPLA2 inhibitor, were purchased from Cayman Chemicals (Ann Arbor, MI).

Transient Transfection Assay—The cPLA2 overexpression plasmid was obtained from Drs. J. D. Clark and J. L. Knopf at the Genetics Institute, Boston, MA (22). The sPLA2 Group IIA expression vector in pcDNA3.1 (Invitrogen) was obtained as described previously (4). The sPLA2 Group V and Group X vectors were obtained from Drs. D. A. Bass and Michael Seeds (23). The IL-8 luciferase reporter gene was obtained from Dr. Robert L. Danner. The COX-2 reporter gene was a kind gift from Dr. Stephen Prescott (24). A plasmid with {beta}-galactosidase gene driven by a CMV promoter was obtained from Clontech. A549 cells were transfected with 1.5 µg of reporter gene (IL-8 or COX-2) and 1.5 µg of expression vector. 0.2 µgof {beta}-galactosidase/CMV plasmid was added as a control for transfection efficiency. Cells were transfected in 6-well dishes (PGS Scientific, Bethesda, MD) using LipofectAMINE Plus reagent (Invitrogen) for 4 h in serum-free Ham's F-12K medium (containing 2 mM L-glutamine). After transfection, medium was replaced with standard Ham's F-12K medium containing 10% fetal bovine serum and cells were maintained for 16 h. After exposure to cPLA2 or sPLA2 activators as described below, cells were washed three times in ice-cold phosphate-buffered saline and lysed using Passive Lysis Buffer (Promega, Madison, WI). Cell lysate was frozen at –80 °C. Luciferase activity was measured using a luciferase assay system (Promega) with a Turner TD20 luminometer (Promega). {beta}-Galactosidase was measured using a Beta-Gal enzyme-linked immunosorbent assay kit (Roche Applied Science).

Immunoblotting—A549 cells were grown on 6-well dishes and treated with 1 µM calcium ionophore A23187 [GenBank] (Calbiochem) for 8 h. In experiments involving cPLA2 or sPLA2 inhibitors, the inhibitors were added to medium (at the specified concentration) for 2 h before the experiments and maintained throughout the time of exposure to calcium ionophore or EGF. The vehicle, Me2SO or methyl acetate, was added to control cultures. Cells were harvested with trypsin (E-PET, Biofluids, Rockville, MD), scraped, collected, and washed three times with cold 1x phosphate-buffered saline. Cells were transferred to 0.5 ml of homogenization buffer containing 50 mM Hepes (pH 8.0), 1 mM EDTA, 1 mM EGTA, 100 µM leupeptin, 1 mM dithiothreitol, 10 mM phenylmethylsulfonyl fluoride, 0.5 mM soybean trypsin inhibitor, 15 mM aprotinin, and 0.25% Triton X-100. Cells were sonicated three times for 15 s and centrifuged at 1,000 x g for 5 min. Total protein of the cell lysate was assayed by BCA reagent (Pierce). Samples containing 20 µg of crude cell lysate protein were separated on 8 or 11% Tris-glycine gels (Invitrogen) using 1x Tris-glycine SDS running buffer. The separated proteins were electrophoretically transferred onto nitrocellulose membranes (Invitrogen). The membranes were then blocked using 5% nonfat dry milk with 0.1% Tween 20 for 2 h at room temperature. Protein expression was detected by using a 1:1000 dilution of rabbit anti-human PPAR-{gamma}1 or -{gamma}2 antibody or a 1:200 dilution of rabbit anti-human COX-2 antibody (Cayman Chemical) and a 1:1000 dilution of horseradish peroxidase-conjugated mouse anti-rabbit IgG as the second antibody (Jackson ImmunoResearch Laboratory, Inc., West Grove, PA). The blot was developed using the ECL Western blotting detection system (Amersham Biosciences) and exposed to Eastman Kodak MR radiographic film for 1 min.

Arachidonic Acid Release from A549 Cells—Whole cell arachidonic acid release was performed as described previously (4). Briefly cells grown in 6-well dishes were transfected with expression vector or empty vector as described above. After 4 h, medium was changed, and cells were labeled for 16 h with 1 µCi/ml [5,6,8,9,11,12,14,15-3H]arachidonic acid ([3H]arachidonic acid) (214 Ci/mmol) (Amersham Biosciences) in Ham's F-12K medium with 10% fetal bovine serum. Subsequently cells were washed and treated with or without IL-1{beta}. At the end of the 4-h treatment period, medium was harvested and centrifuged at 1000 x g for 5 min. An aliquot of medium was transferred to scintillation vials containing 10 ml of Bio-Safe II scintillation fluid (Research International Products Inc., Mount Prospect, IL) and counted in an LS 6500 scintillation counter (Beckman).

Gene Expression Measurements Using a Real Time Polymerase Chain Reaction—Cells were grown as described above and exposed to EGF, A23187 [GenBank] , or MAFP. Total RNA was isolated using an RNeasy kit (Qiagen, Valencia, CA). IL-8 and COX-2 expression was measured using a real time PCR mRNA quantification using a TaqMan system (Applied Biosystems, Foster City, CA). COX-2 probe and primer sets were obtained from Synthegen (Houston, TX). To measure COX-2 mRNA expression, the following primer sequences were used based on mRNA sequence (GenBankTM accession number U04636 [GenBank] ): forward primer, 5'-GCTCAAACATGATGTTTGCATTC-3'; reverse primer, 5'-GCTGGCCCTCGCTTATGA-3'; probe sequence, 5'-TGCCCAGCACTTCACGCATCAGTT-3'. Commercially available probe and primer sets from Applied Biosystems were used to measure IL-8 and RNase P1 expression. 1 µg of total RNA was reverse transcribed using a reverse transcription kit from Applied Biosystems. Real time polymerase chain reaction was conducted using an Applied Biosystems kit and run on a 7900HT instrument (Applied Biosystems) according to the manufacturer's manual using RNase P1 gene as a standard. Relative gene expression is presented as a -fold induction as compared with control ± S.E.

Transfection of A549 Cells with Small Inhibitory RNA (siRNA) Directed against PPAR-{gamma}—siRNAs targeting bases 4–23 of the PPAR-{gamma}1 and 4–24 of the PPAR-{gamma}2 coding sequences were obtained from Integrated DNA Technologies (Coralville, IA). Untemplated TTs were added to the 3'-end of each strand. The siRNA sequences were 5'-GUUGACACAGGAUGCCAUUTT-3' (PPAR-{gamma}1) and 5'-GGUGAAACUCUGGGAGAUUCTT-3' (PPAR-{gamma}2). The single-stranded siRNAs were annealed by incubating a 100 mM concentration of each single strand in annealing buffer (100 mM potassium acetate, 30 mM Hepes, pH 7.4, 2 mM magnesium acetate) for 2 min at 90 °C and slowly cooled down to room temperature. Cells grown in 6-well plates were transfected with 100 nM siRNA duplexes using LipofectAMINE reagent (Invitrogen) (5 ml in 1 ml of culture medium) for 5 h. After transfection, medium was changed, and cells were maintained in medium with fetal bovine serum for 16 h. The effect of siRNA on PPAR-{gamma}1 and -{gamma}2 protein expression was assessed by immunoblotting as described above. Cells were then treated with or without A23187 [GenBank] or EGF as specified below. The effect of treatment of cells with siRNA duplexes on IL-8 protein levels was determined by enzyme-linked immunosorbent assay of cellular supernatants and for COX-2 protein expression by immunoblotting of cell lysates.

Transfection of A549 Cells with siRNA Directed against cPLA2— RNA-DNA chimeras were synthesized by Integrated DNA Technologies. The sequence used to generate 100 nmol of siRNA duplex was: 5'-AAC UCU AGG GAC AGC AAC AUU TT; the complementary sequence was 5'-AAU GUU GCU GUC CCU AGA GUU TT, which corresponds to bases 299–319 of the cPLA2 coding sequence (GenBankTM accession number M68874 [GenBank] ). The annealing procedure was performed as described above. Medium (Ham's F-12 with glutamine) was incubated with LipofectAMINE (5 µl/ml) (Invitrogen) with or without siRNA duplex (final concentration, 20 nM) for 20 min at room temperature. Cells were treated for 5 h at 37 °C. Medium was then changed to Ham's F-12 with glutamine and fetal bovine serum, and the cells were incubated an additional 72 h. Cell lysate was collected for cPLA2 Western blots. The remaining cells were incubated for 8 h with medium alone, A23187 [GenBank] (10–6 M), or EGF (20 ng/ml). Medium was collected for IL-8 assay by enzyme-linked immunosorbent assay, and cell lysate was collected for COX-2 and cPLA2 Western blots.

Electrophoretic Mobility Shift Assay—PPRE probes were synthesized by Keystone Laboratories (Camarillo, CA) corresponding to PPRE sequences (underlined) present in the COX-2 (5'-GAGGCGACAGGTCATAACCCTACT-3') and IL-8 promoters (5'-GGGTCCTCAGAGGTCAGACTTGGTGT-3'). The inverted PPRE sequence in the COX-2 promoter is at –3599 to –3573 relative to the transcription start site and is present as bases of –3542 to –3565 in GenBankTM accession number AF044206 [GenBank] . The IL-8 PPRE sequence represents bases –1070 to –1045 relative to the transcription start site and is present as bases 412–437 of GenBankTM accession number M28130 [GenBank] . Single-stranded nucleotides were reannealed by heating to 95 °C for 5 min and cooled down slowly to room temperature. A549 cells were incubated with and without A23187 [GenBank] (10–6 M) or EGF (10 ng/ml) for 30 min, 1 h, and 2 h prior to harvest at the 2-h time point. Nuclear extracts were prepared using a nuclear extraction kit according to the manufacturer's directions (Sigma). DNA binding was performed by incubating 3 µg of nuclear protein in a total volume of 10 µl of binding buffer (50 mM NaCl, 10 mM Tris-HCl, pH 7.5, 0.5 mM dithiothreitol, 0.5 mM EDTA, 1 mM MgCl2, 0.05 µg/µl poly(dI-dC)·poly(dI-dC), 15% glycerol) and 10,000 cpm 32P-labeled double-stranded PPRE probes for 20 min at room temperature. The specificity of protein binding to labeled probe was assessed by competition with unlabeled probe or with PPRE consensus sequence. For the competition experiments, a 100x excess of unlabeled probe or PPRE consensus sequence (CAAAACTAGGTCAAAGGTCA) (Santa Cruz Biotechnology, Santa Cruz, CA) was added to the electrophoretic mobility shift assay mixture. Nuclear protein derived from cells exposed to A23187 [GenBank] (1 µM) for 60 min was utilized for these experiments. Protein-DNA complexes were resolved on a 6% DNA retardation gel (Invitrogen) in 0.5x Tris-borate-EDTA buffer at 200 V for 30 min. The dried gel was exposed to x-ray film (Kodak) with an intensifying screen at –70 °C overnight or until adequate signal was developed. An Amersham Biosciences 301 computing densitometer was used to digitize images.

Statistical Analysis—Statistical analysis was performed using Microsoft Excel 2000 (Redmond, WA) software run on an iMAC computer (Apple, Cupertino, CA). Comparisons were performed using two-tailed unpaired Student's t tests. Values of p < 0.05 were considered statistically significant.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
The Influence of cPLA2 Activation on IL-8 and COX-2 mRNA Levels—Real time polymerase chain reaction was used to study change in steady state levels of IL-8 and COX-2 mRNA after treatment. Calcium ionophore A23187 [GenBank] and EGF increased both IL-8 and COX-2 mRNA levels as shown in Fig. 1, A and B. Treatment with the calcium ionophore A23187 [GenBank] resulted in an increase in IL-8 and COX-2 mRNA levels. The increase in the IL-8 transcript was present even after 24 h. By this time, the COX-2 mRNA levels had returned to control levels (Fig. 1A). EGF treatment of A549 cells also resulted in an increase in steady state mRNA levels for both IL-8 and COX-2. This effect was transient for COX-2 and disappeared after 2 h. IL-8 mRNA levels were still increased at the 24-h time point (Fig. 1B). These effects were in part decreased by MAFP as shown in Fig. 1, C and D.



View larger version (25K):
[in this window]
[in a new window]
  		FIG. 1.
Effect of the calcium ionophore A23187 [GenBank] or EGF treatment of A549 cells on steady state levels of IL-8 and COX-2 mRNA. These effects were at least in part inhibited by MAFP. Subconfluent A549 cell were exposed to A23187 [GenBank] (10–6 M) (A), EGF (20 ng/ml) (B), Me2SO, or medium for specified times. RNA was isolated, and IL-8 and COX-2 mRNA levels were assayed by real time PCR as described under "Experimental Procedures." Data are expressed as a -fold increase from control ± S.E. (n = 3–4). *, p < 0.05 as compared with control. In C and D cells were pretreated with MAFP (10 mM) for 2 h and coincubated with A23187 [GenBank] (10–6 M)(C) or EGF (20 ng/ml) (D) for 4 h. RNA was isolated, and IL-8 (closed bars) and COX-2 (open bars) mRNA levels were assayed by real time PCR as described under "Experimental Procedures." Data are expressed as a -fold increase from control ± S.E. (n = 3–4). *, p < 0.05 as compared with control. **, p < 0.05 as compared with cells exposed to A23187 [GenBank] or EGF and methyl acetate (a MAFP vehicle) only.

 
The Influence of cPLA2 Activation on IL-8 Reporter Gene Activity: the Effect of MAFP, a cPLA2 Inhibitor—To test whether cPLA2 overexpression might induce IL-8 transcription, a reporter gene assay was used. Cells were transfected with an IL-8 reporter gene and cotransfected with a cPLA2 expression vector or empty vector. Twenty-four hours after transfection, cells were exposed for 4 h to culture medium with Me2SO, A23187 [GenBank] (10–6 M), or EGF (20 ng/ml) to activate cPLA2. cPLA2 overexpression induced an increase in IL-8 reporter gene activity as shown on Fig. 2A. When transfected cells were stimulated by A23187 [GenBank] (10–6 M) for 4 h, IL-8 reporter gene activity was increased as compared with cells treated with Me2SO (A23187 [GenBank] vehicle). These results suggest that both cPLA2 activation and cPLA2 overexpression and activation induce IL-8 reporter gene activity. Further cPLA2 activation induced by EGF caused a similar effect on IL-8 reporter gene activity (Fig. 2B). The effect of cPLA2 activation (either by A23187 [GenBank] or EGF) was in part inhibited by preincubation with a specific cPLA2 inhibitor, MAFP (10 µM), as shown in Fig. 2, A and B.



View larger version (29K):
[in this window]
[in a new window]
  		FIG. 2.
The influence of cPLA2 activation on IL-8 (A and B) and COX-2 (C and D) reporter gene activity. Subconfluent A549 cells were transfected with 1.5 µg of IL-8 or COX-2 reporter gene and 1.5 µg of cPLA2 overexpression vector or empty vector, respectively. Cells were cotransfected with 0.2 µg of {beta}-galactosidase/CMV vector to normalize for transfection efficiency. Some cultures were preincubated (for 2 h) and coincubated with 10 µM MAFP or vehicle (methyl acetate). After preincubation, cells were treated with or without A23187 [GenBank] (10–6 M) (A and C) or EGF (20 ng/ml) (B and D) for 4 h. Cell lysates were prepared and assayed for luciferase and {beta}-galactosidase activity as described under "Experimental Procedures." Data shown are mean ± S.E. (n = 4–6). *, p < 0.05 as compared with cells transfected with empty vector (VC) and treated with A23187 [GenBank] or EGF, respectively. **, p < 0.05 as compared with cells transfected with cPLA2 expression vector and exposed to A23187 [GenBank] or EGF, respectively.

 
The Influence of cPLA2 Activation on COX-2 Reporter Gene Activity: the Effect of MAFP, a cPLA2 Inhibitor—Similar experiments were performed to test the hypothesis that cPLA2 overexpression might induce COX-2 transcription. cPLA2 overexpression induced an increase of COX-2 reporter gene activity as shown on Fig. 2C. When transfected cells were stimulated with A23187 [GenBank] (10–6 M) for 4 h, COX-2 reporter gene activity was increased compared with cells treated with Me2SO (A23187 [GenBank] vehicle). These data suggest that both cPLA2 activation and cPLA2 overexpression and activation induce COX-2 reporter gene activity. Furthermore treatment of cells with EGF produced a similar effect on COX-2 reporter gene activity. The effect of EGF was also in part inhibited by preincubation with a specific cPLA2 inhibitor, MAFP (10 µM), as shown on Fig. 2D.

The Influence of sPLA2 Group IIA, sPLA2 Group V, and sPLA2 Group X Activation on IL-8 and COX-2 Reporter Gene Activity—cPLA2 is not the only phospholipase A2 expressed in human lung cells. Therefore, we used vectors overexpressing sPLA2 Group IIA, Group V, and Group X proteins and tested whether overexpression of these enzymes might influence IL-8 and COX-2 reporter gene activity. IL-1{beta} is known to induce the release of sPLA2 from the cells to the medium. This process is associated with an increase in sPLA2 enzyme activity in the extracellular space, activated by the calcium levels present in the medium. Previously we have shown that transfection of cells with an sPLA2 Group IIA expression vector induces an increase in arachidonic acid release (4). In Fig. 3, A and B, we present evidence that transfection of cells with sPLA2 Group V or Group X vectors, respectively, results in increased arachidonate release compared with cells transfected with empty vectors. These data suggest that these vectors produce functionally active proteins enhancing arachidonate release. Fig. 4, A, B, and C, demonstrate the lack of activation of IL-8 reporter gene in cells transfected with expression vectors encoding sPLA2 Group IIA, V, or X. In all three cases, an increase in sPLA2 activity is associated with a decrease in IL-8 reporter gene activity suggesting the possibility of an inhibitory effect of secreted phospholipase products on IL-8 transcription. Fig. 5, A, B, and C, demonstrate the influence of sPLA2 activation on COX-2 reporter gene activity. Transfection of cells with expression vectors encoding for Group IIA, V, or X isoforms of secreted phospholipases A2 did not activate COX-2 reporter gene expression. Activation of sPLA2 activity seems to be associated with a decrease in COX-2 reporter gene activity suggesting the possibility of an inhibitory effect of secreted phospholipase products on transcription of this gene.



View larger version (15K):
[in this window]
[in a new window]
  		FIG. 3.
Arachidonic acid release from A549 cells transfected with sPLA2 Group V (A) or sPLA2 Group X (B) expression vectors. Subconfluent A549 cells were transfected with 1 µg of each of the aforementioned expression vectors or with empty vector (VC). After 4 h medium was changed, and cells were labeled with 1 µCi of [3H]arachidonic acid. Sixteen hours later medium was changed, cells were exposed to IL-1{beta} (1 ng/ml) for 4 h, and arachidonic acid (AA) release was assayed as described under "Experimental Procedures." Data are expressed as mean ± S.E. (n = 3–6). *, p < 0.05 as compared with cells transfected with empty vector.

 



View larger version (13K):
[in this window]
[in a new window]
  		FIG. 4.
The influence of sPLA2 Group IIA (A), sPLA2 Group V (B), and sPLA2 Group X (C) activation on IL-8 reporter gene activity. The influence of the aforementioned sPLA2s upon activation with IL-1{beta} was studied on IL-8 reporter gene activity. Subconfluent A549 cells were transfected with 1 µg of IL-8 reporter gene and 1 µg of the respective PLA2 expression vector or an empty vector (VC), respectively. All cells were also cotransfected with 0.2 µg of {beta}-galactosidase/CMV vector to normalize for transfection efficiency. Some cultures were incubated with IL-1{beta} (10 ng/ml) for 4 h. Cells incubated with medium for 4 h were used as a control. Cell lysates were prepared and assayed for luciferase and {beta}-galactosidase activity as described under "Experimental Procedures." Data shown are mean ± S.E. (n = 4–6). *, p < 0.05 as compared with cells transfected with an empty vector.

 



View larger version (12K):
[in this window]
[in a new window]
  		FIG. 5.
The influence of sPLA2 Group IIA (A), sPLA2 Group V (B), and sPLA2 Group X (C) activation on COX-2 reporter gene activity. The influence of the aforementioned sPLA2s upon activation with IL-1{beta} was studied on COX-2 reporter gene activity. Subconfluent A549 cells were transfected with 1 µg of COX-2 reporter gene and 1 µg of the respective PLA2 expression vector or an empty vector (VC), respectively. All cells were also cotransfected with 0.2 µg of {beta}-galactosidase/CMV vector to normalize for transfection efficiency. Some cultures were incubated with IL-1{beta} (10 ng/ml) for 4 h. Cells incubated with medium for 4 h were used as a control. Cell lysates were prepared and assayed for luciferase and {beta}-galactosidase activity as described under "Experimental Procedures." Data shown are mean ± S.E. (n = 4–6). *, p < 0.05 as compared with cells transfected with an empty vector.

 
Effect of Inhibitors of sPLA2, iPLA2, or cPLA2 on Spontaneous IL-8 and COX-2 Reporter Gene Activity in A549 Cells—To confirm the role of cPLA2 in the regulation of IL-8 and COX-2 expression, cells transfected with IL-8 or COX-2 reporter genes were exposed for 12 h to sPLA2, iPLA2, or cPLA2 inhibitors. Neither the sPLA2 inhibitor thioetheramide-PC nor the iPLA2 inhibitor BEL influenced IL-8 or COX-2 reporter gene activity suggesting no role for these enzymes in the regulation of IL-8 and COX-2 transcription de novo. MAFP, a cPLA2 inhibitor, decreased both IL-8 and COX-2 reporter gene activity suggesting that cPLA2 might regulate even basal IL-8 and COX-2 transcriptional activity (Fig. 6, A and B).



View larger version (35K):
[in this window]
[in a new window]
  		FIG. 6.
The influence of various PLA2 inhibitors on IL-8 (A, C, and E) and COX-2 (B, D, and F) reporter gene activity in quiescent cells (A and B) or after stimulation with A23187 [GenBank] (C and D) or with EGF (E and F). Subconfluent A549 cells were transfected with 1 µg of IL-8 or COX-2 reporter gene, respectively. Cells were cotransfected with 0.2 µg of {beta}-galactosidase/CMV vector to normalize for transfection efficiency. After 4 h the medium was changed, and cells were exposed to BEL (1 µM), an iPLA inhibitor, MAFP (10 µM), a cPLA inhibitor, or thioetheramide-PC (10 µM), an sPLA2 inhibitor, for 12 h or medium with vehicle, which served as 2 2a control (A and B). Data are shown as mean ± S.E. (n = 4–6). *, p < 0.05 as compared with control (cells exposed to Me2SO/MeAc, vehicles for PLA2 inhibitors). Some cells were preincubated with BEL (1 µM), an iPLA2 inhibitor, MAFP (10 µM), a cPLA2 inhibitor, thioetheramide-PC (10 µM), a sPLA inhibitor, or vehicle for 2 h and then treated with A23187 [GenBank] (1 µM) or Me2SO (an A23187 [GenBank] vehicle) for 4 h (C and D). Similarly, instead of A23187 [GenBank] , EGF 2was utilized as an alternative cPLA2 activator in E and F; cells exposed to medium alone were treated as a control. Cell lysate was prepared and assayed for luciferase and {beta}-galactosidase activity as described under "Experimental Procedures." Data are shown as mean ± S.E. (n = 3–4). *, p < 0.05 as compared with control (cells exposed to Me2SO or medium, vehicles for A23187 [GenBank] or EGF, respectively).

 
Effect of Inhibitors of sPLA2, iPLA2, or cPLA2 on Calcium Ionophore and EGF-stimulated IL-8 and COX-2 Reporter Gene Activity in A549 Cells—To establish the role of cPLA2 activation by A23187 [GenBank] and EGF in the regulation of IL-8 and COX-2 de novo transcription, cells transfected with IL-8 or COX-2 reporter genes were preincubated for 2 h with sPLA2, iPLA2, or cPLA2 inhibitors. Afterward some cultures were exposed to A23187 [GenBank] (1 µM) or EGF (20 ng/ml) for 4 h (with inhibitors present in the medium) or exposed to Me2SO, an A23187 [GenBank] vehicle, or medium, respectively. Neither the sPLA2 inhibitor thioetheramide-PC nor the iPLA2 inhibitor BEL abolished the A23187 [GenBank] or EGF effect on IL-8 or COX-2 reporter gene activity suggesting no role for these enzymes in regulation of IL-8 and COX-2 transcription de novo upon calcium-dependent or EGF cell activation. MAFP, a cPLA2 inhibitor, decreased calcium ionophore-stimulated IL-8 and COX-2 reporter gene activity suggesting that cPLA2 might regulate IL-8 and COX-2 transcriptional activity (Fig. 6, C and D, respectively). Similarly MAFP decreased EGF-stimulated IL-8 and COX-2 reporter gene activity again suggesting that cPLA2 might regulate IL-8 and COX-2 transcriptional activity (Fig. 6, E and F).

The Influence of cPLA2 Activation on IL-8 Protein Expression in A549 Cells—The observation that cPLA2 activation increases IL-8 reporter gene activity and IL-8 mRNA levels was supported by the measurements of IL-8 protein secreted by A549 cells. Exposure of A549 cells to A23187 [GenBank] resulted in a time-dependent increase in secretion of IL-8 as shown in Fig. 7A. A significant increase in IL-8 in the medium was present at 4 h and beyond. This effect was in part inhibited by MAFP suggesting that this effect might be cPLA2-dependent as shown in Fig. 7B. A similar effect was obtained when A549 cells were exposed to EGF (20 ng/ml) as shown in Fig. 7C. The EGF effect was present at the 2-h time point. The effect of EGF was in part inhibited by MAFP as shown in Fig. 7D.



View larger version (22K):
[in this window]
[in a new window]
  		FIG. 7.
The effect of cPLA2 activation on IL-8 protein production by A549 cells. A, subconfluent A549 cells were treated with A23187 [GenBank] (10–6 M) or Me2SO (vehicle) for the specified times. B, A549 cells were preincubated with MAFP (10 µM) for 2 h and incubated with A23187 [GenBank] (10–6 M) for 8 h. C, subconfluent A549 cells were treated with EGF (20 ng/ml) for the specified times. D, A549 cells were preincubated with MAFP (10 µM) for 2 h and incubated with EGF (20 ng/ml) for 8 h. Culture supernatants were collected, and IL-8 concentrations were measured by an immunoassay as described under "Experimental Procedures." Data are expressed as mean ± S.E. (n = 3–6). *, p < 0.05 as compared with control. **, p < 0.05 as compared with cells exposed to A23187 [GenBank] or EGF, respectively.

 
The Influence of cPLA2 Activation on COX-2 Protein Expression in A549 Cells—The observation that cPLA2 activation increases COX-2 reporter gene activity and COX-2 mRNA levels was supported by the assessment of COX-2 protein levels in A549 cells by performing immunoblotting. Treatment of A549 cells with A23187 [GenBank] resulted in a time-dependent increase in cellular COX-2 protein levels as shown in Fig. 8A, left panel. This effect was in part inhibited by MAFP suggesting that this effect might be cPLA2-dependent as shown in Fig. 8A, right panel. When A549 cells were treated with EGF, increases in cellular levels of COX-2 protein were also noted (Fig. 8B, left panel). This increase in COX-2 protein levels in response to EGF treatment was, in part, inhibited by pretreatment of the cells with MAFP (Fig. 8B, right panel).



View larger version (32K):
[in this window]
[in a new window]
  		FIG. 8.
The effect of cPLA2 activation on COX-2 protein production by A549 cells. Subconfluent A549 cells were treated with A23187 [GenBank] for the specified times (10–6 M) (A) or with EGF (20 ng/ml) (B). Some cultures were preincubated and coincubated with MAFP (right panels). Cell lysates were prepared as described under "Experimental Procedures." 20 µg of cellular lysate was subjected to immunoblotting. Each immunoblot shown is representative of three separate experiments, each with similar results.

 
The Effect of cPLA2 Activation on IL-8 and COX-2 Protein Expression Is Decreased by siRNAs for PPAR-{gamma}1 and PPAR-{gamma}2—To confirm that the effect of cPLA2 activation on IL-8 and COX-2 expression is indeed via PPRE activation, we used cells transiently transfected with siRNAs for both PPAR-{gamma} genes. Fig. 9A presents immunoblots for PPAR-{gamma} revealing expression of both isoforms in control cells and a decrease in PPAR-{gamma}1 and PPAR-{gamma}2 expression in cells transiently transfected with siRNAs. These results suggest that the use of siRNA might be a useful tool in limiting PPAR-{gamma}1 and PPAR-{gamma}2 expression. These cells were used to study the influence of cPLA2 activation on IL-8 and COX-2 protein expression after stimulation with A23187 [GenBank] or EGF. As shown in Fig. 9, B and C, transfection of A549 cells with siRNAs directed against PPAR-{gamma}1 and PPAR-{gamma}2 resulted in a diminished response to A23187 [GenBank] or to EGF in IL-8 and COX-2 protein expression suggesting that this effect is at least in part mediated through PPAR-{gamma}1, PPAR-{gamma}2, or both.



View larger version (19K):
[in this window]
[in a new window]
  		FIG. 9.
The effect of cPLA2 activation on IL-8 and COX-2 expression is mediated through PPAR-{gamma}. Subconfluent A549 cells were transfected with siRNA against PPAR-{gamma}1 and -{gamma}2 as described under "Experimental Procedures." After 24 h cells were collected, and 10 µg of cell lysate was immunoblotted as described under "Experimental Procedures." A represents an immunoblot developed with anti-PPAR-{gamma} antibody, which recognizes PPAR-{gamma}1 and PPAR-{gamma}2 protein. The immunoblot shown is representative of three with similar results. After 24 h some cultures were exposed to A23187 [GenBank] (10–6 M), EGF (20 ng/ml), or medium for 8 h. Supernatants were collected and assayed for IL-8. Cells were lysed and processed as described under "Experimental Procedures," and 20 µg of cell lysate was subjected to immunoblotting. B, IL-8 protein levels in cellular supernatants measured by an immunoassay. Data are expressed as mean ± S.E. (n = 3–6). *, p < 0.05 as compared with control cells (cells treated with LipofectAMINE only). C, COX-2 protein production measured by immunoblotting. Cells were lysed and processed as described under "Experimental Procedures." 20 µg of cellular lysate was subjected to immunoblotting. Blots shown are representative of three with similar results. Ctrl, control.

 
The Effect of Calcium Ionophore and EGF on IL-8 and COX-2 Protein Expression Is Decreased by siRNAs for cPLA2—To reconfirm that cPLA2 activation may influence IL-8 and COX-2 expression we utilized cells transiently transfected with siR-NAs for the cPLA2 gene. Figs. 10A and 11A present immunoblots for cPLA2 revealing its expression in control cells and a decrease in cPLA2 expression in cells transiently transfected with siRNAs. These results suggest that the use of siRNA might be a useful tool in limiting cPLA2 expression. These cells were used to study the influence of A32187 [GenBank] or EGF on IL-8 and COX-2 protein expression. As shown in Figs. 10B and 11B, transfection of A549 cells with siRNAs directed against cPLA2 resulted in a diminished response to A23187 [GenBank] or to EGF in COX-2 and IL-8 protein expression suggesting that this effect is at least in part mediated through cPLA2.



View larger version (40K):
[in this window]
[in a new window]
  		FIG. 10.
The effect of A23187 [GenBank] and EGF on COX-2 expression is mediated through cPLA2. Subconfluent A549 cells were transfected with siRNA against cPLA2 as described under "Experimental Procedures." After 72 h cells were collected, and 10 µg of cell lysate was immunoblotted as described under "Experimental Procedures." A represents an immunoblot developed with anti-cPLA2 antibody. The immunoblot shown is representative of three with similar results. After 24 h some cultures were exposed to A23187 [GenBank] (10–6 M), EGF (20 ng/ml), or medium for 8 h. Cells were lysed and processed as described under "Experimental Procedures," and 20 µg of cell lysate was subjected to immunoblotting. B shows COX-2 protein production measured by immunoblotting. Cells were lysed and processed as described under "Experimental Procedures." Blots shown are representative of three with similar results.

 



View larger version (25K):
[in this window]
[in a new window]
  		FIG. 11.
The effect of A23187 [GenBank] and EGF on IL-8 expression is mediated through cPLA2. Subconfluent A549 cells were transfected with siRNA against cPLA2 as described under "Experimental Procedures." After 72 h cells were collected, and 10 µg of cell lysate was immunoblotted as described under "Experimental Procedures." A represents an immunoblot developed with anti-cPLA2 antibody. The immunoblot shown is representative of four with similar results. After 72 h some cultures were exposed to A23187 [GenBank] (10–6 M), EGF (20 ng/ml), or medium for 8 h. Medium was collected, and IL-8 concentrations were measured by enzyme-linked immunosorbent assay. Cells were lysed, and total cellular protein was measured as described under "Experimental Procedures." B, data expressed as mean ± S.E. in picograms of IL-8 standarized for 1 µg of cellular protein. *, p < 0.05 as compared with control cells.

 
cPLA2 Activation Results in an Increase in PPAR Binding to PPRE Sequences Derived from IL-8 and COX-2 Promoters—To confirm that as a result of cPLA2 activation arachidonate or its metabolites might bind to PPAR and activate PPAR response elements, an electrophoretic mobility shift assay was performed. Probes representing PPAR response elements derived from the IL-8 or COX-2 promoters were used. Nuclear proteins were derived from cells treated with A23187 [GenBank] or EGF. Exposure of A549 cells to EGF increased nuclear protein binding to the probe derived from the IL-8 promoter with a maximum effect at 60 min (Fig. 12A, upper panel). Similarly nuclear protein isolated from cells exposed to A23187 [GenBank] exhibited an increased binding to the probe. Maximum binding was also obtained when cells were exposed to A23187 [GenBank] for 60 min (Fig. 12A, lower panel). Exposure of A549 cells to EGF increased nuclear protein binding to the probe derived from the COX-2 promoter with maximum effect at 60 min (Fig. 12B, upper panel). Similarly nuclear protein isolated from cells exposed to A23187 [GenBank] exhibited an increased binding to the probe. Maximum binding was obtained when cells were exposed to A23187 [GenBank] for 60 min (Fig. 12B, lower panel). These data suggest that activation of transcription of IL-8 and COX-2 may be related to an increased binding of activated PPARs to PPREs in the promoter of these genes. To confirm the specificity of the binding to the PPRE in the IL-8 and COX-2 promoters, an inhibition experiment was performed showing that a 100x excess of unlabeled probe or unlabeled PPRE consensus oligonucleotide significantly decreased the binding (Fig. 12, C and D). Both unlabeled oligonucleotide and PPRE consensus oligonucleotide markedly decreased labeled probe binding suggesting that these effects may be specific.



View larger version (70K):
[in this window]
[in a new window]
  		FIG. 12.
Cytosolic phospholipase A2 activation increases nuclear protein binding to PPRE sequences derived from the IL-8 promoter (A) and from the COX-2 promoter (B). Subconfluent A549 cells were exposed to EGF (20 ng/ml, upper panels) or A23187 [GenBank] (1 µM, lower panels) for the specified time intervals. To confirm specificity of the binding to PPRE sequences derived from the IL-8 promoter (C) and from the COX-2 promoter (D) a 100x excess of the cold probe or PPRE consensus oligonucleotide, respectively, was added to the electrophoretic mobility shift assay mixture utilizing nuclear protein derived from cells exposed to A23187 [GenBank] (1 µM). Nuclear proteins were isolated as described under "Experimental Procedures." Electrophoretic mobility gel shift assay was performed. After drying, the gel was exposed to Kodak MR film for 16 h or until adequate signal appeared. The autoradiograph shown is representative of three different experiments, each with similar results. The arrows indicate DNA-nuclear protein complexes.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
PPAR-{gamma} is one of the low affinity dietary lipid receptors reviewed by Rosen and Spiegelman (32). It is widely expressed in various tissues including liver and lung cells and cell lines (4, 26, 27, 33–36). After binding a ligand (e.g. thiazolidinediones, arachidonate, 15-hydroxyeicosatetraenoic acid, or others), it forms a heterodimer with cis-retinoic acid retinoid X receptor, binds to a PPAR response element, and activates transcription of selected genes. It has been well documented that PPAR-{gamma} is able to activate genes such as glucose transporter 4, COX-2, IL-8, and others (22, 37, 38). COX-2 is one of two main isoforms of cyclooxygenase, an enzyme in the arachidonate metabolism cascade that leads to prostaglandin synthesis. Expression of COX-2 is increased by bacterial endotoxin, IL-1{beta}, tumor necrosis factor-{alpha}, or interferon-{gamma}. This is in contrast to COX-1, which is a housekeeping gene. The COX-2 transcription start site has been identified, and its promoter has been cloned. The promoter contains at least one PPAR response element, which is located at –3599 relative to the transcription start site. COX-2 reporter gene activity and protein expression is stimulated by PPAR-{gamma} agonists such as 15-{Delta}12,14-prostaglandin J2, arachidonate, and thiazolidinedione (37, 39, 40). It also might be controlled by some non-steroidal anti-inflammatory drugs (37).

Here we report for the first time that cPLA2 activation induces COX-2 and IL-8 expression. Five lines of evidence support this conclusion. First, treatment of A549 cells with activators of cPLA2, A23187 [GenBank] or EGF, increased activity of both COX-2 and IL-8 reporter genes. Furthermore overexpression of cPLA2 and activation of cPLA2 increased transcriptional activity of both COX-2 and IL-8 reporter genes. These effects were inhibited by coincubation with a cPLA2 inhibitor, MAFP. Second, in cells transfected with the IL-8 reporter gene or the COX-2 reporter gene, coincubation the cPLA2 inhibitor MAFP inhibited reporter gene expression. This effect was not noted with coincubation with the iPLA2 inhibitor bromoenol lactone or with the sPLA2 inhibitor thioetheramide-PC. Third, treatment of cells with A23187 [GenBank] or with EGF increased steady state levels of IL-8 mRNA and COX-2 mRNA. These effects were inhibited by coincubation with MAFP. Fourth, incubation of A549 cells with A23187 [GenBank] or with EGF increased release of IL-8 protein and increased cellular COX-2 protein levels. These effects were in part inhibited by treatment with MAFP. Finally the linkage of cPLA2 activation and IL-8 or COX-2 expression to PPAR{gamma} activation was studied in three ways. First, electrophoretic mobility shift assays using PPRE sequence from the IL-8 and the COX-2 promoters demonstrated increased shift in both sequences in response to treatment of cells with A23187 [GenBank] or EGF suggesting that these sequences do bind PPARs after stimulation. Second, A549 cells were treated with siRNAs directed at PPAR-{gamma}1 and -{gamma}2. This treatment reduced the protein levels of PPAR-{gamma}1 and -{gamma}2. This treatment also reduced production of IL-8 protein and COX-2 protein in response to A23187 [GenBank] or to EGF compared with cells treated with transfecting reagent alone. Third, we used cells with diminished cPLA2 expression (using siRNA) to confirm that the effect of A23187 [GenBank] and EGF on IL-8 and COX-2 protein expression is at least in part mediated through cPLA2 activation. This again suggests that cytosolic phospholipase A2 might play a role in regulation of IL-8 and COX-2 expression.

Interestingly there are no data available so far suggesting a role of other phospholipases A2 such as Groups IIA, V, and X or iPLA2 in this process. Previously we have shown that sPLA2 Group IIA does not appear to be involved in activation gene transcription driven through PPARs (4). In this report we suggest that sPLA2 types IIA, V, and X are not involved in activation of COX-2 and IL-8 transcription in response to A23187 [GenBank] or EGF. Two lines of evidence support this hypothesis. First, cotransfection of IL-8 or COX-2 reporter gene together with sPLA2 Group IIA, V, or X did not increase reporter gene activity even after stimulation with IL-1{beta}. Second, only MAFP, a cPLA2 inhibitor, decreased reporter gene activity when transfected cells were exposed to various PLA2 inhibitors in both quiescent and A23187 [GenBank] - or EGF-stimulated cells. All of these data taken together suggest that IL-8 and COX-2 transcription is not influenced by sPLA2 Group IIA, V, or X activation. One of the functional differences between cPLA2 and sPLA2 is that upon activation cPLA2 is translocated from the cytoplasm to various cell membranes (including the nuclear envelope but excluding the outer cell membrane), whereas sPLA2 is actively secreted into intercellular space where it is activated. These data taken together with our previous observations might suggest that the translocation allows cPLA2 to deliver arachidonate and its metabolites to the nucleus and therefore to regulate gene expression.

Studies involving cPLA2 {alpha} null mice have provided convincing evidence of the role of cPLA2 in the inflammatory process in several diseases including but not limited to airway inflammation, arthritis, and acute lung injury (41–43). So far, its role in these events was presumed to be related to prostaglandin and leukotriene synthesis. In this report, we suggest that the role of cPLA2 in inflammation also might be related to a direct effect of its products on gene expression at least in part through PPAR-{gamma}1 and -{gamma}2 pathways.

Both stimuli (EGF and A23187 [GenBank] ) may alter gene expression through other pathways. EGF acting through the EGF receptor is able to activate the mitogen-activated protein kinase cascade leading to transcription factor phosphorylation. Similarly A23187 [GenBank] increases intracellular calcium levels, which may activate various pathways including protein kinase A. These pathways might contribute to regulation of IL-8 and COX-2 expression in a cPLA2-independent way (33–35, 44–48). Utilization of cells with decreased cPLA2 expression provided the evidence that cPLA2 or downstream products of this pathway might play a role in EGF- and calcium-dependent regulation of IL-8 and COX-2 expression in human lung cells.

Recently the role of sPLA2 Group IIA in regulating sPLA2 expression has been linked to cPLA2 activation by secreted sPLA2 in rat mesangial cells. This autocrine loop might utilize PPAR-{alpha} (36). As we have previously shown A549 cells do not express PPAR-{alpha} (4). This may explain why sPLA2 overexpression did not increase IL-8 or cyclooxygenase-2 expression in A549 cells. Further studies investigating the role of enzymes such as COX-1, COX-2, 12-lipooxygenase, and 15-lipooxygenase and other lipid products of cPLA2 activation are needed to clarify the role of cPLA2 in the regulation of gene expression.


   FOOTNOTES
 
* This work was supported in part by Grant 3P04A02124 from the State Committee for Scientific Research, Poland (to R. P.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

|| To whom correspondence should be addressed: Critical Care Medicine Dept., National Institutes of Health, Warren Grant Magnuson Clinical Center, Bldg. 10, Rm. 7D43, 9000 Rockville Pike, Bethesda, MD 20892. E-mail: jshelhamer{at}nih.gov.

1 The abbreviations used are: cPLA2, cytosolic PLA2; CAT, chloramphenicol acetyltransferase; PLA2, phospholipase A2; iPLA2, intracellular calcium-independent PLA2; sPLA2, secretory PLA2; PPAR, peroxisome proliferator-activated receptor; PPRE, peroxisome proliferator response element; MAFP, methyl arachidonyl fluorophosphate; IL, interleukin; EGF, epidermal growth factor; COX, cyclooxygenase; siRNA, small inhibitory RNA; thioetheramide-PC, 1-palmitylthio-2-palmitoylamido-1,2-dideoxy-sn-glycero-3-phosphorylcholine; BEL, bromoenol lactone; CMV, cytomegalovirus. Back


   ACKNOWLEDGMENTS
 
We thank Drs. J. D. Clark and J. L. Knopf at the Genetics Institute, Boston, MA, for providing the cPLA2 expression plasmid, Dr. Michael Seeds for the sPLA2 Group V and Group X expression plasmids, Dr. Steven Prescott for the COX-2 reporter gene, and Dr. Robert Danner from the National Institutes of Health for the IL-8 reporter gene.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Wu, T., Levine, S. J., Lawrence, M. G., Logun, C., Angus, C. W., and Shelhamer, J. H. (1994) J. Clin. Investig. 93, 571–577[Medline] [Order article via Infotrieve]
  2. Wu, T., Ikezono, T., Angus, C. W., and Shelhamer, J. H. (1996) Biochim. Biophys. Acta 1310, 175–184[Medline] [Order article via Infotrieve]
  3. Wu, T., Levine, S. J., Cowan, M., Logun, C., Angus, C. W., and Shelhamer, J. H. (1997) Am. J. Physiol. 273, L331–L338[Medline] [Order article via Infotrieve]
  4. Pawliczak, R., Han, C., Huang, X. L., Demetris, A. J., Shelhamer, J. H., and Wu, T. (2002) J. Biol. Chem. 277, 33153–33163[Abstract/Free Full Text]
  5. Pawliczak, R., Huang, X. L., Nanavaty, U. B., Lawrence, M., Madara, P., and Shelhamer, J. H. (2002) Am. J. Respir. Cell Mol. Biol. 27, 722–731[Abstract/Free Full Text]
  6. Dolan-O'Keefe, M., Chow, V., Monnier, J., Visner, G. A., and Nick, H. S. (2000) Am. J. Physiol. 278, L649–L657
  7. Evans, J. H., Fergus, D. J., and Leslie, C. C. (2003) Adv. Enzyme Regul. 43, 229–244[CrossRef][Medline] [Order article via Infotrieve]
  8. Kudo, I., and Murakami, M. (2002) Prostaglandins Other Lipid Mediat. 68–69, 3–58
  9. Leslie, C. C. (1997) J. Biol. Chem. 272, 16709–16712[Free Full Text]
  10. Dennis, E. A. (1997) Trends Biochem. Sci. 22, 1–2[CrossRef][Medline] [Order article via Infotrieve]
  11. Balsinde, J., Balboa, M. A., Insel, P. A., and Dennis, E. A. (1999) Annu. Rev. Pharmacol. Toxicol. 39, 175–189[CrossRef][Medline] [Order article via Infotrieve]
  12. Dennis, E. A. (2000) Am. J. Respir. Crit. Care Med. 161, S32–S35[Free Full Text]
  13. Balsinde, J., Balboa, M. A., and Dennis, E. A. (2000) Ann. N. Y. Acad. Sci. 905, 11–15[Medline] [Order article via Infotrieve]
  14. Winstead, M. V., Balsinde, J., and Dennis, E. A. (2000) Biochim. Biophys. Acta 1488, 28–39[Medline] [Order article via Infotrieve]
  15. Balsinde, J., Winstead, M. V., and Dennis, E. A. (2002) FEBS Lett. 531, 2–6[CrossRef][Medline] [Order article via Infotrieve]
  16. Balsinde, J., and Dennis, E. A. (1996) J. Biol. Chem. 271, 6758–6765[Abstract/Free Full Text]
  17. Balboa, M. A., Perez, R., and Balsinde, J. (2003) J. Immunol. 171, 989–994[Abstract/Free Full Text]
  18. Balsinde, J., and Dennis, E. A. (1997) J. Biol. Chem. 272, 16069–16072[Free Full Text]
  19. Benfield, T. L., van Steenwijk, R., Nielsen, T. L., Dichter, J. R., Lipschik, G. Y., Jensen, B. N., Junge, J., Shelhamer, J. H., and Lundgren, J. D. (1995) Respir. Med. 89, 285–290[CrossRef][Medline] [Order article via Infotrieve]
  20. Aoki, Y., Qiu, D., Zhao, G. H., and Kao, P. N. (1998) Am. J. Physiol. 274, L1030–L1039[Medline] [Order article via Infotrieve]
  21. Zhang, X., Wang, J. M., Gong, W. H., Mukaida, N., and Young, H. A. (2001) J. Immunol. 166, 7104–7111[Abstract/Free Full Text]
  22. Jozkowicz, A., Dulak, J., Prager, M., Nanobashvili, J., Nigisch, A., Winter, B., Weigel, G., and Huk, I. (2001) Prostaglandins Other Lipid Mediat. 66, 165–177[CrossRef][Medline] [Order article via Infotrieve]
  23. Subbanagounder, G., Wong, J. W., Lee, H., Faull, K. F., Miller, E., Witztum, J. L., and Berliner, J. A. (2002) J. Biol. Chem. 277, 7271–7281[Abstract/Free Full Text]
  24. Harris, S. G., Smith, R. S., and Phipps, R. P. (2002) J. Immunol. 168, 1372–1379[Abstract/Free Full Text]
  25. Fu, Y., Luo, N., and Lopes-Virella, M. F. (2002) Atherosclerosis 160, 11–20[CrossRef][Medline] [Order article via Infotrieve]
  26. Hla, T., and Neilson, K. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 7384–7388[Abstract/Free Full Text]
  27. Bradbury, D. A., Newton, R., Zhu, Y. M., Stocks, J., Corbett, L., Holland, E. D., Pang, L. H., and Knox, A. J. (2002) Am. J. Physiol. 283, L717–L725
  28. Fong, C. Y., Pang, L., Holland, E., and Knox, A. J. (2000) Am. J. Physiol. 279, L201–L207
  29. Pang, L., and Knox, A. J. (1997) Br. J. Pharmacol. 121, 579–587[Medline] [Order article via Infotrieve]
  30. Ikawa, H., Kameda, H., Kamitani, H., Baek, S. J., Nixon, J. B., Hsi, L. C., and Eling, T. E. (2001) Exp. Cell Res. 267, 73–80[CrossRef][Medline] [Order article via Infotrieve]
  31. Pang, L., Nie, M., Corbett, L., and Knox, A. J. (2003) J. Immunol. 170, 1043–1051[Abstract/Free Full Text]
  32. Rosen, E. D., and Spiegelman, B. M. (2001) J. Biol. Chem. 276, 37731–37734[Free Full Text]
  33. Huh, Y. H., Kim, S. H., Kim, S. J., and Chun, J. S. (2003) J. Biol. Chem. 278, 9691–9697[Abstract/Free Full Text]
  34. Jaspers, I., Chen, L. C., and Flescher, E. (1998) J. Cell. Physiol. 177, 313–323[CrossRef][Medline] [Order article via Infotrieve]
  35. Wadhwa, S., Choudhary, S., Voznesensky, M., Epstein, M., Raisz, L., and Pilbeam, C. (2002) Biochem. Biophys. Res. Commun. 297, 46–51[CrossRef][Medline] [Order article via Infotrieve]
  36. Beck, S., Lambeau, G., Scholz-Pedretti, K., Gelb, M. H., Janssen, M. J., Edwards, S. H., Wilton, D. C., Pfeilschifter, J., and Kaszkin, M. (2003) J. Biol. Chem. 278, 29799–29812[Abstract/Free Full Text]
  37. Meade, E. A., McIntyre, T. M., Zimmerman, G. A., and Prescott, S. M. (1999) J. Biol. Chem. 274, 8328–8334[Abstract/Free Full Text]
  38. Armoni, M., Kritz, N., Harel, C., Bar-Yoseph, F., Chen, H., Quon, M. J., and Karnieli, E. (2003) J. Biol. Chem. 278, 30614–30623[Abstract/Free Full Text]
  39. Chandrasekharan, N. V., Dai, H., Roos, K. L., Evanson, N. K., Tomsik, J., Elton, T. S., and Simmons, D. L. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, 13926–13931[Abstract/Free Full Text]
  40. Hinz, B., Brune, K., and Pahl, A. (2003) Biochem. Biophys. Res. Commun. 302, 415–420[CrossRef][Medline] [Order article via Infotrieve]
  41. Hegen, M., Sun, L., Uozumi, N., Kume, K., Goad, M. E., Nickerson-Nutter, C. L., Shimizu, T., and Clark, J. D. (2003) J. Exp. Med. 197, 1297–1302[Abstract/Free Full Text]
  42. Uozumi, N., and Shimizu, T. (2002) Prostaglandins Other Lipid Mediat. 68–69, 59–69
  43. Ghosh, M., Stewart, A., Tucker, D. E., Bonventre, J. V., Murphy, R. C., and Leslie, C. C. (2004) Am. J. Respir. Cell Mol. Biol. 30, 91–100[Abstract/Free Full Text]
  44. Richter, A., O'Donnell, R. A., Powell, R. M., Sanders, M. W., Holgate, S. T., Djukanovic, R., and Davies, D. E. (2002) Am. J. Respir. Cell Mol. Biol. 27, 85–90[Abstract/Free Full Text]
  45. Subauste, M. C., and Proud, D. (2001) Int. Immunopharmacol. 1, 1229–1234[CrossRef][Medline] [Order article via Infotrieve]
  46. Zhao, H., Tian, W., Tai, C., and Cohen, D. M. (2003) Am. J. Physiol. 285, F281–F288
  47. Rebsamen, M. C., Capoccia, R., Vallotton, M. B., and Lang, U. (2003) J. Mol. Cell. Cardiol. 35, 81–89[CrossRef][Medline] [Order article via Infotrieve]
  48. Rodrigues, S., Van Aken, E., Van Bocxlaer, S., Attoub, S., Nguyen, Q. D., Bruyneel, E., Westley, B. R., May, F. E., Thim, L., Mareel, M., Gespach, C., and Emami, S. (2003) FASEB J. 17, 7–16[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
S. Paruchuri, Y. Jiang, C. Feng, S. A. Francis, J. Plutzky, and J. A. Boyce
Leukotriene E4 Activates Peroxisome Proliferator-activated Receptor {gamma} and Induces Prostaglandin D2 Generation by Human Mast Cells
J. Biol. Chem., June 13, 2008; 283(24): 16477 - 16487.
[Abstract] [Full Text] [PDF]

Home page
 Infect. Immun.Home page
B. P. Hurley and B. A. McCormick
Multiple Roles of Phospholipase A2 during Lung Infection and Inflammation
Infect. Immun., June 1, 2008; 76(6): 2259 - 2272.
[Full Text] [PDF]

Home page
 Mol. Endocrinol.Home page
Z. Naor, H. N. Jabbour, M. Naidich, A. J. Pawson, K. Morgan, S. Battersby, M. R. Millar, P. Brown, and R. P. Millar
Reciprocal Cross Talk between Gonadotropin-Releasing Hormone (GnRH) and Prostaglandin Receptors Regulates GnRH Receptor Expression and Differential Gonadotropin Secretion
Mol. Endocrinol., February 1, 2007; 21(2): 524 - 537.
[Abstract] [Full Text] [PDF]

Home page
 J. Appl. Physiol.Home page
M. J. Cowan, T. Coll, and J. H. Shelhamer
Polyamine-mediated reduction in human airway epithelial migration in response to wounding is PGE2 dependent through decreases in COX-2 and cPLA2 protein levels
J Appl Physiol, October 1, 2006; 101(4): 1127 - 1135.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
B. P. Hurley, N. L. Williams, and B. A. McCormick
Involvement of phospholipase A2 in Pseudomonas aeruginosa-mediated PMN transepithelial migration
Am J Physiol Lung Cell Mol Physiol, April 1, 2006; 290(4): L703 - L709.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
T. Ozbay, A. Rowan, A. Leon, P. Patel, and M. B. Sewer
Cyclic Adenosine 5'-Monophosphate-Dependent Sphingosine-1-Phosphate Biosynthesis Induces Human CYP17 Gene Transcription by Activating Cleavage of Sterol Regulatory Element Binding Protein 1
Endocrinology, March 1, 2006; 147(3): 1427 - 1437.
[Abstract] [Full Text] [PDF]

Home page
 J. Pharmacol. Exp. Ther.Home page
N. Kawao, M. Nagataki, K. Nagasawa, S. Kubo, K. Cushing, T. Wada, F. Sekiguchi, S. Ichida, M. D. Hollenberg, W. K. MacNaughton, et al.
Signal Transduction for Proteinase-Activated Receptor-2-Triggered Prostaglandin E2 Formation in Human Lung Epithelial Cells
J. Pharmacol. Exp. Ther., November 1, 2005; 315(2): 576 - 589.
[Abstract] [Full Text] [PDF]

Home page
 CarcinogenesisHome page
L. Parhamifar, B. Jeppsson, and A. Sjolander
Activation of cPLA2 is required for leukotriene D4-induced proliferation in colon cancer cells
Carcinogenesis, November 1, 2005; 26(11): 1988 - 1998.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
W. Yan, C. M. Jenkins, X. Han, D. J. Mancuso, H. F. Sims, K. Yang, and R. W. Gross
The Highly Selective Production of 2-Arachidonoyl Lysophosphatidylcholine Catalyzed by Purified Calcium-independent Phospholipase A2{gamma}: IDENTIFICATION OF A NOVEL ENZYMATIC MEDIATOR FOR THE GENERATION OF A KEY BRANCH POINT INTERMEDIATE IN EICOSANOID SIGNALING
J. Biol. Chem., July 22, 2005; 280(29): 26669 - 26679.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
H. Kuwata, T. Nonaka, M. Murakami, and I. Kudo
Search of Factors That Intermediate Cytokine-induced Group IIA Phospholipase A2 Expression through the Cytosolic Phospholipase A2- and 12/15-Lipoxygenase-dependent Pathway
J. Biol. Chem., July 8, 2005; 280(27): 25830 - 25839.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
279/47/48550    most recent
M408926200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pawliczak, R.
Right arrow Articles by Shelhamer, J. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pawliczak, R.
Right arrow Articles by Shelhamer, J. H.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2004 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement