Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M409620200 on September 9, 2004

J. Biol. Chem., Vol. 279, Issue 47, 48950-48958, November 19, 2004
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
279/47/48950    most recent
M409620200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fritz, D. T.
Right arrow Articles by Rogers, M. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fritz, D. T.
Right arrow Articles by Rogers, M. B.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Conservation of Bmp2 Post-transcriptional Regulatory Mechanisms*{boxs}

David T. Fritz, Donglin Liu, Junwang Xu, Shan Jiang, and Melissa B. Rogers{ddagger}

From the Department of Biochemistry and Molecular Biology, University of Medicine and Dentistry of New Jersey (UMDNJ)-NJ Medical School, Newark, New Jersey 07101

Received for publication, August 20, 2004 , and in revised form, September 9, 2004.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Bone morphogenetic protein (BMP) orthologs from diverse species like flies and humans are functionally interchangeable and play key roles in fundamental processes such as dorso-ventral axis formation in metazoans. Because both transcriptional and post-transcriptional mechanisms play central roles in modulating developmental protein levels, we have analyzed the 3'-untranslated region (3'UTR) of the Bmp 2 gene. This 3'UTR is unusually long and is alternatively polyadenylated. Mouse, human, and dog mRNAs are 83–87% identical within this region. A 265-nucleotide sequence, conserved between mammals, birds, frogs, and fish, is present in Bmp2 but not Bmp4. The ability of AmphiBMP2/4, a chordate ortholog to Bmp2 and Bmp4, to align with this sequence suggests that its function may have been lost in Bmp4. Activation of reporter genes by the conserved region acts by a post-transcriptional mechanism. Mouse, human, chick, and zebrafish Bmp2 synthetic RNAs decay rapidly in extracts from cells not expressing Bmp2. In contrast, these RNAs are relatively stable in extracts from Bmp2-expressing cells. Thus, Bmp2 RNA half-lives in vitro correlate with natural Bmp2 mRNA levels. The fact that non-murine RNAs interact appropriately with the mouse decay machinery suggests that the function of these cis-regulatory regions has been conserved for 450 million years since the fish and tetrapod lineages diverged. Overall, our results suggest that the Bmp2 3'UTR contains essential regulatory elements that act post-transcriptionally.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Bone morphogenetic proteins (BMPs)1 were first identified by their osteogenic properties. These developmentally critical proteins are expressed widely in vertebrate embryonic structures (1–4). BMP2 and BMP4 signaling mediates key events such as epithelio-mesenchymal interactions (5), apoptosis (6–9), and dorso-ventral axis specification (10). Mice having null mutations in Bmp2 or Bmp4 (11, 12), BMP receptor genes (13–16), or the BMP signal transducing SMADs (17–21) die during early embryogenesis. The phenotypes of these mutants prove that BMP signaling is required for vital developmental processes.

The evolutionary conservation of the BMP2 and BMP4 proteins is remarkable. Except for nematode BMPs, the amino acid sequences of invertebrate BMPs are 70–87% identical to human BMP2 (22). The Drosophila protein Decapentaplegic (DPP), which is 71% identical to human BMP2, is functionally interchangeable with mammalian BMPs in a mammalian bone induction assay (23). Conversely, the closely related mammalian BMP4 rescues the axis defects of Drosophila lacking DPP function (24). Indeed, the entire BMP signaling pathways are conserved. For example, BMPs and their antagonists appear to play analogous, although inverted, roles in dorso-ventral axis formation in vertebrates and invertebrates (25).

Although the BMP2 and BMP4 amino acid sequences are 91% identical and the proteins function similarly in most assays, the embryonic lethal phenotypes of null mutations proved that both genes are indispensable. The inability of BMP2 and BMP4 to compensate for each other is probably because of their distinct patterns of expression. Elucidating Bmp2 gene regulatory mechanisms is thus fundamental to understanding this crucial gene.

Both Bmp2 in mouse and dpp in Drosophila are expressed in highly tissue- and stage-specific patterns. Multiple promoters and alternative splicing produce a variety of dpp transcripts in Drosophila (26). Like Bmp2, the dpp mRNA has an unusually long 3'-untranslated region (3'UTR) with highly conserved regions (27, 28). Our work, and that of others, suggests that mammalian Bmp2 regulation may be similarly complex (29–35).

The vitamin A-derivative retinoic acid (RA) strongly induces the Bmp2 gene in F9 embryonal carcinoma cells stimulated to differentiate with RA (36). F9 cells lacking retinoic acid receptor-{gamma} fail to express Bmp2 in response to RA (37). RA also induces the Bmp2 gene in the developing chick limb (38) and in medulloblastoma cells (39). Many Bmp2-expressing tissues (e.g. heart and cardiovasculature, limbs, central nervous system, craniofacial structures, and vertebrae) develop abnormally in vitamin A-deficient embryos or after exposure to high levels of vitamin A or other retinoids (4, 40).

Bmp2 is expressed at three distinct levels in F9 cells. Undetectable in undifferentiated stem cells, the Bmp2 transcript is detected readily in RA-treated cells. The combination of elevated cyclic AMP levels and RA induces the Bmp2 transcript 5–6-fold more than RA alone. Cyclic AMP elevation alone induces neither differentiation nor Bmp2 expression (36, 41). The highly reproducible, differential expression of Bmp2 in F9 cells is an excellent tool for elucidating the molecular determinants controlling RA-induced Bmp2 expression.

By using the F9 cell model system, we previously demonstrated that promoter function is conserved between primates and mouse (29). We now report that sequences within the Bmp2 3'UTR mediate post-transcriptional functions that have been evolutionarily conserved between mammals, birds, and fish.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
DNA Isolation
All plasmids were purified using Qiagen® plasmid purification kits. Dr. Peter Medveczky provided genomic DNA from chicken (Gallus gallus). Dr. Richard Pollenz provided genomic DNA from Madin-Darby canine kidney cells (dog, Canis familiaris) and CHL/IU cells (Chinese hamster, Cricetulus griseus). Dr. Jeffrey Yoder provided DNA from zebrafish (Danio rerio). Anita Antes provided genomic DNA from A549 lung cells (Homo sapiens).

RNA Isolation
RNA was isolated from cell lines by using standard methods (42).

Species-specific RNase Protection Assay (RPA) Probes
Unless otherwise indicated, nucleotide positions have been provided with respect to the murine distal Bmp2 promoter that is 2,201 nt upstream of the initiator codon (ATG). All restriction and modifying enzymes were from New England Biolabs.

Human—To generate an antisense probe spanning the 389 nt upstream to 146 nt downstream of the stop codon, EST clone accession number AI569017 [GenBank] was linearized with MscI and transcribed with T3 RNA polymerase.

For the probe spanning the downstream poly(A) sites (nt 597–1,226 downstream of the Bmp2 stop codon, accession number NT_011387 [GenBank] ), a 630-bp DNA fragment was generated from genomic DNA by PCR and inserted into the EcoRI and HindIII sites of the pBluescript II KS vector (Stratagene). The sequences of the primers are as follows: HindIII-Forward, 5'CAGGAAGCTTGCAGAGTGATTGTCC3'; EcoRI-Reverse, 5'GCGAATTCAAGGTCATCATTGTAAGCG3'. This plasmid (pBShB2-3'UTR-pA2-3) was linearized with XhoI and transcribed with T7 RNA polymerase to generate antisense RNA probes.

Mouse—For the mouse-specific probe spanning the stop codon and the first putative polyadenylation site, a SacI (blunted with T4 DNA polymerase) and PstI fragment was subcloned into the EcoRV and PstI site of pBluescript II KS to generate pBSB2-3'UTR-SacPst (nt 9,397–10,204). After mutating the vector AccI site, the AccI/PstI fragment spanning nt 9938–10,204 was removed; the remaining plasmid was blunted with T4 DNA polymerase and religated to generate pBSB2-3'UTR-SacI-AccI (nt 9,397–9,938). This plasmid was linearized with HindIII and transcribed with T7 RNA polymerase to generate antisense probe or with XbaI and T3 RNA polymerase to generate sense probe.

For the probe spanning the downstream poly(A) sites (nt 10,202–10,781 relative to the distal promoter), a PstI/EcoRI fragment was excised from pPGLB2-3'UTR and inserted into the PstI and EcoRI sites of the pBluescript II KS vector. This plasmid (pBSB2-3'UTR-PA1-2) was linearized with XbaI and transcribed with T3 RNA polymerase to generate antisense probe and HindIII and T7 RNA polymerase to generate sense probe.

RPAs—Strand-specific, [{alpha}-32P]UTP-labeled riboprobes were synthesized by using standard methods (42). RPAs were performed as in Ref. 43 with some modifications. Briefly, radiolabeled RNA probe, total HeLa or F9 cell RNA, and yeast tRNA were co-precipitated with ethanol, denatured at 80 °C for 10 min, and hybridized overnight at 45 °C. After 20 min of RNase A/T1 digestion at 30 °C, reactions were inactivated with SDS and proteinase K, followed by phenol/chloroform extraction. Subsequently, RNAs were ethanol-precipitated, dissolved in 15 µl of gel loading buffer, and electrophoresed on denaturing 5% polyacrylamide gels (8 M urea; 37.5:1, acrylamide:bisacrylamide). Protected RNAs were visualized by using autoradiography and quantified using an Amersham Biosciences PhosphorImager and ImageQuant software.

Genomic PCR Cloning
Genomic clones were obtained by PCR using a forward primer to a region just upstream of the stop codon that is identical or nearly identical in all vertebrates (5'CAGGACATGGTGGTGGAGGG3') and species-specific reverse primers. The mammalian and chick products used a primer identical to the chick sequence (5'GCACTTTGCCATAGTAACCTTCC3'). The zebrafish primer was 5'GCCTTCAGCATGTTATATCATGAC3'). PCRs contained 1 unit of Taq recombinant DNA polymerase (Roche Applied Science), 100 ng of genomic DNA, 50 pmol of each primer, 0.25 mM dNTPs, 1.5 mM MgCl2, and buffer conditions as recommended by the manufacturer (Roche Applied Science). 100-µl reactions were incubated as follows in a Mastercycler gradient PCR machine (Eppendorf): denature 97 °C/5 min, anneal 47 °C/30 s (53 °C zebrafish), extend 72 °C/3 min followed by 35 cycles using a 94 °C denaturation. The PCR products were separated by PAGE (37.5:1 acrylamide:bisacrylamide), visualized by ethidium bromide staining, and confirmed by Southern blotting (42) using the murine highly conserved noncoding sequence (HCNS, Fig. 1A) as probe. PCR fragments (~500 bp) were purified by gel electrophoresis, passively eluted from a gel slice, and cloned into the pCRII TA cloning vector (Invitrogen) according to the manufacturer's instructions. Clones from all species were subcloned into the EcoRI site pGEM-4 (Promega) for in vitro transcript synthesis. The University of Medicine and Dentistry of New Jersey Medical School Molecular Resource Facility (Newark, NJ) sequenced each plasmid by using T7 and Sp6 primers. The accession numbers and region cloned were human AL035668 [GenBank] , 131,066–131,576; mouse AL831753 [GenBank] , 133,140–133,650, chicken accession numbers BU423990 [GenBank] , 63–540; and zebrafish accession numbers AL929237 [GenBank] , 88,314–88,749. Newly cloned hamster (AY722409 [GenBank] ), dog (AY722408 [GenBank] ), and cow (AY714781 [GenBank] ) sequences have been submitted to GenBankTM. Our cloned dog sequence matches the recently completed canine genomic sequence AAEX01031455.



View larger version (66K):
[in this window]
[in a new window]
  		FIG. 1.
Bmp2 3'UTRs are well conserved. Numbers are relative to the mouse distal promoter. Identical nucleotides are indicated by "."; gaps by "-." Sequences are genomic except chick in A, amphioxus in B, and cow in C. A, the HCNS from species representing four mammalian orders (Rodentia, Primates, Carnivora, and Artiodactyla), birds, frogs, and fish. AREs (AUUUA) are shaded and in boldface type. Chimpanzee, rat, rabbit, hamster, deer, and Xenopus tropicalis sequences are similar. B, part of the amphioxus AmphiBMP2/4 3'UTR aligns with part of the HCNS fromvertebrates (ClustalW (1.81) multiple sequence alignment, 0 gap open penalty for multiple alignment). The sequence shown falls in the 441-nt invariant region of the B. belcheri and B. floridae genes (supplemental Fig. 1). C, the two poly(A) signals from rodents, primates, dog, and cow are conserved. Putative CPSF-binding sites (AAUAAA) and CstF-binding sites (U or G/U rich sequences) are underlined and in boldface. The transcript ends supported by ESTs and RPA results (Fig. 2) are indicated by "V"(C, marked above the sequence). Chimpanzee and rat sequences are similar. Species and sequence accession numbers are as follows: mouse, Mus musculus strain C57Bl/6, NW_000178; rat, Rattus norvegicus, AABR02024700; hamster, C. griseus, AY722409 [GenBank] ; rabbit, Oryctolagus cuniculus, AF041421 [GenBank] ; human, H. sapiens, NT_011387 [GenBank] ; chimpanzee, Pan troglodytes, AADA01029118; dog, C. familiaris, AY722408 [GenBank] , AAEX01031455; cow, Bos taurus, AY714781 [GenBank] , CK940647 [GenBank] ; deer, Dama dama, AF041421 [GenBank] ; chick, G. gallus, X75914, BU423990 [GenBank] ; X. laevis, Xenopus laevis, AJ315159 [GenBank] ; X. tropicalis, AJ315160 [GenBank] ; zebrafish Bmp2b gene, D. rerio, AL928549 [GenBank] ; pufferfish, Fugu rubripes, CAAB01002368, and amphioxus (Amph), B. belcheri AF206325 [GenBank] .

 
Luciferase Reporter Constructs
Construct A (nt –1,237 to 471, pGL1.7XX)—See Ref. 29 for construct A.

pBSB2-3'UTR (nt 9,392–11,604)—A 6-kb BamHI/NotI fragment was subcloned from phage B2 (31) creating mB2-BamI (nt 5,102–11,604). pBSB2-3'UTR was created by excising a SacI fragment containing nt 5,102–9,392 and religating.

pGL2Basic{Delta}Bam+Sac—QuikChangeTM site-directed mutagenesis (Stratagene) was used to add a SacI/SstI site at nt 2100 of plasmid pGL2Basic{Delta}Bam (29). The sequences of the mutating oligomers used are as follows: Sac-Forward, 5'-GAGGAAAACCTGTTGAGCTCAGAAGAAATGCCATCTAGTG-3'; Sac-Reverse, 5'-CACTAGATGGCATTTCTTCTGAGCTCAACAGGTTTTCCTC-3'.

Construct B (nt –1,237 to 471 and nt 9,392–11,604, pGLB2–5'3')— Plasmid pBSB2-3'UTR (nt 9,392–11,604) was digested with SmaI and SacI. A 2,212-bp fragment containing the Bmp2 stop codon, 3'UTR, and downstream sequence was cloned into pGL2Basic{Delta}Bam+Sac digested with StyI (blunted with Klenow in the presence of dNTPs) and SacI to create pGLB2–3'UTR. A DraIII and XbaI fragment containing the 1,702-bp Bmp2 promoter was excised from construct A (29) and was inserted in place of the 2,381-nt DraIII and XbaI fragment in pGLB2–3'UTR.

Construct C (nt –1,237 to 471 and nt 9,574–10,204, pGLB2–5'3'CNS)—Plasmid pGLB2–3'UTR was digested by PstI and BamHI, blunted with T4 DNA polymerase in the presence of dNTPs, and religated to remove the fragment between nt 10,204 and 11,444 creating pGLB2–3'UTR{Delta}PstBam. Plasmid pGLB2–3'UTR{Delta}PstBam was cut with PvuII and SacI, blunted by T4 DNA polymerase in the presence of dNTPs, and the ends religated to create pGLB2–3'UTRCNS. This deletion leaves all of the highly conserved sequences. The Bmp2 promoter fragment from construct A was inserted upstream of luciferase as described for construct B.

Construct D (nt –1,237 to 471 and nt 9,392–11,604, pGLB2–5'SVpA-3'UTR)—The 2,212-bp Bmp2 fragment from pBSB2-3'UTR was excised with SacI (blunted with T4 DNA polymerase in the presence of dNTPs) and SalI and then cloned into pGL2Basic cut with BamHI (filled in with T4 DNA polymerase) and SalI to create pGLB2-SVpA-3'UTR. The Bmp2 promoter fragment from construct A was inserted upstream of luciferase as described for construct B.

Construct E (nt –1,237 to 471 and nt 10,202–11,604, pGLB2–5'3'{Delta}SacPst)—To remove the 810-bp fragment between nt 9,392 and 10,202, pGLB2–3'UTR was cut with SacI and PstI, blunted with T4 DNA polymerase in the presence of dNTPs, and religated to create pGLB2–3'UTR{Delta}SacPst. The Bmp2 promoter fragment from construct A was inserted upstream of luciferase as described for construct B.

In Vitro Transcription Plasmids
pGemB2-KA (nt 9,455–9,938) and plasmids containing the homologous region from human, chick, and zebrafish were synthesized by PCR as described above and linearized with BamHI. SacI/PstI (nt 9,397–10,202) or PvuII/PstI (9,574–10,202) fragments obtained from pBS-3'UTR were cloned into SacI/PstI or SmaI/PstI-digested pGem4 to make pGBmp2-SacPst and pGBmp2-PvuIIPst, respectively. These plasmids were linearized with AccI to make sense probes spanning nt 9,397–9,938 or 9,574–9,938, respectively. pGBmp2-SacPst was digested with PvuII and RsaI to make pGBmp2-PvuIIRsa (nt 9,574–9,735) or RsaI and AccI (blunted with T4 DNA polymerase) to make pGBmp2-RsaAcc (nt 9,735–9,938). These plasmids and wild type and mutated TNF{alpha} plasmids (44) were linearized with HindIII. All linearized plasmid templates were transcribed with SP6 RNA polymerase

F9 Cell Culture and Differentiation
F9 embryonal carcinoma cells were plated on dishes pre-coated with 1% gelatin and incubated at 37 °C with 10% CO2. The culture media consisted of Dulbecco's modified Eagle's medium supplemented with 10% heat-inactivated calf serum and 2 mM glutamine. The cells were induced to differentiate into parietal endoderm by adding 1 µM all-trans-retinoic acid, 250 µM Bt2cAMP, and 500 µM theophylline (RACT). Undifferentiated control cells were treated with 250 µM Bt2cAMP and 500 µM theophylline (CT).

F9 Cell Transfection by Calcium Phosphate Precipitation
Transfections were performed essentially as described by Vasios et al. (45). Briefly, for 96-h drug treatments, F9 cells were plated at 1 x 106 or 0.3 x 106 (CT only) cells per 100-cm dish (Nunc) for 12 h, drugged for 48 h with CT or RACT, transfected by overnight calcium phosphate precipitation, and then cultured for an additional 24–48 h with drugs. Each 100-cm dish was co-transfected with 10 µg of reporter plasmid and 3 µg of p{beta}AclacZ (45) containing the {beta}-galactosidase coding region driven by the constitutive {beta}-actin promoter.

Luciferase Assays
Cells were extracted, and luciferase activity was determined by using the Promega Luciferase Assay System and a Monolight 2010 luminometer (Analytic Luminescence Laboratory). Luciferase activity was normalized for transfection efficiency by dividing the raw luciferase value by the units of {beta}-galactosidase activity (1 unit = A1 420·µl–1·h–).

In Vitro Stability Measurements
Sequences were subcloned into the pGEM4 (Promega) polylinker downstream of the SP6 promoter and upstream of the HindIII site. After HindIII digestion, plasmids were transcribed with SP6 RNA polymerase with 7MeGpppG and [{alpha}-32P]UTP. The design of these transcripts mimics that of transcripts used extensively for this purpose (44, 46, 47). The capped and labeled transcripts were incubated in S18 cytoplasmic extracts as described previously (44, 46, 48, 49). Transcripts and degradation products were visualized and quantified as above.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
The Bmp2 3'UTR Is Unusually Conserved—Surveys of conserved regions in 3'UTRs defined "highly conserved" as sequences of >100 nt with 70% identity conserved for 300 million years of evolution (50–52). Because 265 nt of the Bmp2 3'UTR is 73% conserved between mammals and fish (450 million years of separation), this region fits within this class (Fig. 1) (29). For brevity, we have termed the Bmp2 highly conserved noncoding sequence the "HCNS." A more comprehensive analysis of Bmp2 3'UTRs from more evolutionarily separated mammals indicates that the entire 3'UTR including the polyadenylation (poly(A)) signals is unusually conserved. To analyze the rest of the 3'UTR, we aligned Bmp2 sequences from our PCR-generated clones and newly deposited GenBankTM sequences from additional mammals using the MultiPipMaker global sequence alignment program (see site bio.cse.psu.edu/pipmaker/) (Fig. 1). The 3'UTRs of the human and dog Bmp2 transcripts are 86% identical over 1,217 nt and 83% identical over 1,088 nt, respectively, to the mouse transcript. Between Bmp2 genes from four mammalian orders (Rodentia, Primates, Carnivores, and Artiodactyls), the highly conserved block is 95% identical over 370 nt. Furthermore, the striking conservation of the entire 3'UTR between several rodents, humans, and chimpanzees and dog, deer, and cow implies vital post-transcriptional regulatory functions for the whole 3'UTR.

The Bmp2 and Bmp4 3'UTRs Differ—The BMP2 and BMP4 proteins are 91% identical and have similar biological activities but are expressed in different patterns (4, 53–55). Our analyses of ESTs and mRNA sequences indicate that human and mouse Bmp4 mRNAs end at a single poly(A) signal resulting in 293 or 336 nt 3'UTRs, respectively. We attempted to align Bmp2 and Bmp4 3'UTR sequences from many species; however, the Bmp2 HCNS is clearly absent in all Bmp4 genes (see Ref. 29 and data not shown). We also attempted to align vertebrate Bmp4 3'UTRs to themselves, but Bmp4 3'UTRs are poorly conserved relative to the coding region.

BMP2 and BMP4 form a subgroup with the invertebrate DPP protein. Protostomes and other deuterostomes such as cephalochordates, hemichordates, urochordates, and echinoderms appear to have only one Bmp2/4/dpp-like gene (22, 56). Dpp 3'UTRs from four Drosophila species that diverged 40–80 million years ago are perfectly conserved for 110 nt (27, 28, 57). This suggests that insect 3'UTRs play a necessary regulatory function. Cis-regulatory elements retained for 450 million years in vertebrate Bmp2 3'UTRs may reflect functions that evolved in earlier metazoans. This can be tested by tracing the evolution of Bmp2 3'UTRs.

Amphioxus, a cephalochordate that separated from the vertebrate ancestor ~650 million years ago (58), is the closest living link between invertebrates and vertebrates (59). The expression of the single AmphiBMP2/4 gene is both Bmp2- and Bmp4-like (56). AmphiBMP2/4 genes have been sequenced from Pacific and Atlantic species that diverged 112 million years ago (60). Amphioxus genes are typically highly polymorphic between individuals within a species (61) and between species (60). The 97.6% identity between the 687- and 699-nt AmphiBMP2/4 3'UTRs of these two species and the presence of a 441-nt invariant region suggests the 3'UTR contains important features (GenBankTM accession numbers AF068750 [GenBank] , Branchiostoma floridae, and AF206325 [GenBank] , Branchiostoma belcheri; see supplemental Fig. 1). No part of the AmphiBMP2/4 3'UTR aligns with the Bmp4 3'UTR. In contrast, adjacent sequences within the AmphiBMP2/4 3'UTR invariant region align with two adjacent Bmp2 HCNS sequences (Fig. 1B). Gene duplication often releases one gene from the cellular constraints on evolution of the ancestral gene. Thus, the amphioxus sequence that aligns with the Bmp2 HCNS may reflect sequences present in the ancestral Bmp2/4 gene. After gene duplication, these sequences may have been lost in Bmp4 after it was freed to evolve a new set of cis-regulatory elements.

Alternative Polyadenylation Produces Tissue-specific Bmp2 mRNAs—Alternative mRNA termination and polyadenylation can produce mRNAs with different 3' ends. Because sequences in the 3'UTR can contain important post-transcriptional regulatory elements, alternative polyadenylation may strongly affect mRNA function and half-life. We have analyzed the 3' ends of human Bmp2 ESTs found in GenBankTM (Fig. 2A). ESTs ending at three different positions contain apparent poly(A) tails.



View larger version (30K):
[in this window]
[in a new window]
  		FIG. 2.
Bmp2 transcript ends. A, human BMP2 locus view downloaded from www.ncbinlm.nih.gov/mapview/maps. Black bars indicate coding sequence. Gray bars represent ESTs. The two pA sites are marked above a histogram of UniGene transcripts. B, species-specific RPA probes spanning pA sites 1 and 2 protect two RNA ends in HeLa cells or F9 cells treated with RACT to induce differentiation. No protection was observed in undifferentiated F9 cells (day 0), in tRNA, or with sense strand probes (not shown). C, the signals in B were normalized to the U composition of the protected regions and to actin RNA levels and were plotted against the days F9 cells were RA-treated.

 
According to the UniGene tabular summary of Bmp2 transcript ends, 15 ESTs appear to end 21 nt downstream of the stop codon. These mRNAs would lack the HCNS. Some ESTs ending at this position were cloned from HeLa cells; however, by using RPA, we cannot detect mRNAs ending here in HeLa or F9 cells. Manual comparison of the 15 EST sequences to the genomic sequence revealed a primate-specific, 20-nt dinucleotide repeat. Masking of this repeat led to an error in the UniGene transcript end assignment. In fact, all 15 clones end 48 nt after the stop codon. An adjacent stretch of 13 As broken by a G in the human genomic sequence may provide an internal oligo(dT) priming site during cDNA synthesis. The location of this A stretch and our inability to detect these short RNAs using RPAs suggests that the shortest transcripts do not occur in vivo. Thus, whereas UniGene alignments can provide some information regarding transcript ends, gene features such as repeats and internal priming sites may confound purely in silico analyses.

Twelve ESTs end at the second site indicated by the UniGene alignments and four end at the third site (Fig. 2A). These ESTs contain the HCNS. In contrast to the first putative site, RPAs strongly support the use of the second and third sites in HeLa and F9 cells (Fig. 2B). Thus the human and mouse mRNAs would have 3'UTRs of ~880 and 1188 nt or 870 and 1185 nt, respectively. Most interestingly, the relative abundance of these protected RNAs is reversed in HeLa and F9 cells (Fig. 2, B and C). HeLa cell mRNAs end at position 1 more than 3 times as often as at position 2. In contrast, transcripts ending at position 2 are more abundant in differentiated F9 cells. Thus, Bmp2 mRNA cleavage site choice is species- or cell type-specific.

Mammalian poly(A) signals contain a cleavage and polyadenylation factor specificity factor (CPSF) binding site (usually AAUAAA) 10–35 nt upstream of the cleavage and poly(A) site (62). U- or G/U-rich sequences 14–70 nt downstream of the cleavage site bind the cleavage stimulation factor (CstF) (63–67). Together, the CPSF and CstF sites define the position of cleavage. Bmp2 genes from four orders of mammals have one or more consensus CPSF-binding sites and CstF sites (Fig. 1C). The facts that two or more poly(A) signals can double transgene expression (68–70), that the two mouse signals and the sequence between are 78–83% identical to the human, dog, and cow Bmp2 signals, and that Bmp2 cleavage and polyadenylation is tissue-specific suggest that these poly(A) signals are important cis-elements controlling Bmp2 expression.

The HCNS Activates a Reporter Gene in Differentiated F9 Cells—We showed previously that a 2.2-kb sequence containing the entire 3'UTR and flanking sequences strongly stimulated a reporter construct containing the mouse promoter (29) (Fig. 3, compare constructs A and B). The inserted fragment included the Bmp2 stop codon, the HCNS (Fig. 1A), both poly(A) signals (Figs. 1C and 2), and 934 nt of nontranscribed downstream sequence. These results indicated that key regulatory elements occurred within the region but did not prove that the HCNS was involved. To test the hypothesis that the HCNS directly controls Bmp2 expression, we made subclones with only the HCNS (Fig. 3, construct C). The activity of this construct did not differ significantly from the full-length construct. Thus, the region conserved between mammals, birds, amphibians, and fish is sufficient to activate a heterologous reporter gene.



View larger version (22K):
[in this window]
[in a new window]
  		FIG. 3.
The HCNS acts post-transcriptionally. Reporter constructs with the Bmp2 distal promoter (nt –1237 to 471) upstream of the luciferase (LUC) gene alone (construct A) or with nt 9392–11604 (construct B) or nt 9574–10204 (construct C) of Bmp2 sequence between the SV40 intron and the SV40 pA signal of pGL2-Basic. In construct D, the 3'UTR and downstream sequence was inserted after the SV40 pA signal. In construct E, nt 9392–10204 was deleted. F9 cells were treated with RACT and co-transfected with a plasmid constitutively expressing {beta}-galactosidase to normalize transfection efficiency. Average reporter activity is shown ± S.E. The number of experimental determinations = 3–14 transfections. Constructs B and C did not differ significantly.

 
The HCNS Acts Post-transcriptionally—Construct B contains three potential poly(A) signals: two Bmp2 signals followed by an SV40 poly(A) signal from the pGL2-Basic plasmid. Consequently, reporter mRNAs may end at three positions yielding transcripts containing the HCNS. Regulatory elements within this reporter construct may act as cis-regulatory elements within the mRNA or transcriptional enhancers in the plasmid DNA. To distinguish between these mechanisms, we placed the 2.2-kb fragment downstream of the SV40 poly(A) signal. Because the SV40 poly(A) signal is a strong viral signal, most mRNAs should end prior to the Bmp2 sequence. The activity of this construct (Fig. 3, construct D) was slightly greater than the reporter construct containing only the Bmp2 promoter (Fig. 3, construct A). This may be due to a weak enhancer or to mRNAs ending beyond the SV40 poly(A) signal. More importantly, the activity of construct D was significantly less than that of construct B with the Bmp2 3'UTR inserted upstream of the SV40 poly(A) signal. These data support the hypothesis that the conserved sequence stimulates Bmp2 expression by a post-transcriptional mechanism.

Other 3'UTR Sequences Stimulate Reporter Gene Expression—The entire 3'UTR and the sequence immediately downstream of the poly(A) signal is well conserved between mammals. This suggests that other 3'UTR regions besides the HCNS play key functions. To test this, we deleted the HCNS from construct B (Fig. 3). The activity of construct E lacking the HCNS was greater than the promoter-only construct A but was less than the construct B containing the promoter, 3'UTR, and downstream sequences. This suggests that the remaining sequence contains activating elements. Construct E was also more active than construct D with the Bmp2 sequence downstream of the strong SV40 poly(A) signal. This finding is consistent with an RNA-mediated, post-transcriptional activating function. Indeed, construct E contains three poly(A) signals, two from Bmp2 and one from SV40. Expression studies have shown that more than one poly(A) signal increases gene expression levels (68–70).

RNAs Containing Subclones of the Highly Conserved Bmp2 3'UTR Are Unstable in Vitro—Reporter genes containing either the entire Bmp2 3'UTR or only the HCNS were expressed highly in differentiated F9 cells but not in stem cells (Fig. 3) (29). The murine HCNS contains eight AREs (AUUUA) that are well known cis-regulatory elements controlling RNA stability. The eight AREs are restricted entirely to the HCNS and do not occur elsewhere within the UTR. Of these, seven are conserved among all mammals and four are conserved in zebrafish and pufferfish. Factors induced during differentiation may stabilize the Bmp2 mRNA by interacting with these AREs. Experiments using S18 cytoplasmic extracts (48, 49) from undifferentiated F9 stem cells (Fig. 4, A and B) support this hypothesis. We compared the in vitro stability of capped synthetic RNAs containing the conserved Bmp2 3'UTR region relative to RNAs containing the wild type or mutated ARE from the TNF{alpha} 3'UTR (46). Bmp2-containing RNAs containing the entire HCNS were the least stable, with half-lives of ~10 min. As expected, RNAs containing the wild type TNF{alpha} ARE were less stable than those with the mutated TNF{alpha} ARE. This indicates that factors in F9 stem cell S18 extracts can recognize an ARE and can stimulate unusually rapid decay of the Bmp2 mRNA.



View larger version (40K):
[in this window]
[in a new window]
  		FIG. 4.
Bmp2 transcripts are less stable than TNF{alpha} transcripts and decay rate correlates with endogenous mRNA level. A PhosphorImager view (A) and a graph (B) show the decay of labeled RNAs containing Bmp2 sequences indicated relative to the Bmp2 promoter, or the wild type ({blacktriangleup} WT, AAUUAUUUAUUAUUUAUUUAUUAUUUAUUUAUUUAA) or mutated (x, MT, AAUGAUGUACUACUUGUUCAUGAUGUUCUUCUUGAA) (44) ARE from the TNF{alpha} 3'UTR incubated in F9 stem cell S18 extracts for up to 30 min and plotted as a percentage of the transcript in unincubated extracts (time 0). C, mouse Bmp2 RNA (nt. 9,574–9,735) decays at the same rate in S18 or S100 HeLa extracts. D, Bmp2 RNA containing the entire HCNS from mouse (nt 9,455–9,965) or the homologous human (E) or zebrafish (F) RNA decays faster in S18 extracts from undifferentiated F9 stem cells than in extracts from F9 cells induced to differentiate with RACT. Average results are plotted ± S.E. or range. D and E, n = 4; F, n = 2–3.

 
The fact that the Bmp2 RNAs were less stable than the wild type TNF{alpha} RNA is intriguing. The Bmp2 RNAs were 467 and 297 nt longer than the 96-nt RNA containing the 34-nt TNF{alpha} ARE (Fig. 4). In Bmp2, only two of the eight AUUUA sequences overlap. The others are distributed over about 330 nt (Fig. 1). Factors binding multiple, separated AREs within the Bmp2 sequence may stimulate more rapid decay, relative to the five closely spaced AREs found in TNF{alpha}. The data shown in Fig. 5 support this hypothesis. Specifically, the two RNAs containing the entire HCNS with eight AREs (nt 9,455 or 9,574–9,938) were less stable than RNAs containing half of the HCNS with four AREs each. Overall, the data suggest that multiple AREs may independently recruit decay factors to RNA.



View larger version (14K):
[in this window]
[in a new window]
  		FIG. 5.
Multiple regions influence rapid decay in F9 cell extracts. Bars show the relative lengths and positions of the Bmp2 sequence in the RNAs. Nucleotide positions are relative to the distal mouse start site. Asterisks indicate the approximate positions of AUUUA motifs within the HCNS and the TNF{alpha} RNAs. Percentage of the remaining RNA after 30 min of incubation is shown at right. Values are ± S.E. or range. n = 3–5, except for the RNA containing nt 9,574–9,938, where n = 2. 30-min values for the wild type and mutated TNF{alpha} RNAs described in Fig. 4 are positive and negative controls for ARE-regulated decay, respectively.

 
Bmp2 RNAs Are Unstable in Extracts from Cells Not Expressing Endogenous Bmp2 mRNA—If the HCNS alters the relative stability of the Bmp2 mRNA in cells expressing different Bmp2 levels, then decay extracts from these cells should reproduce this regulated stability. Because the originally developed S100-based RNA turnover assay is too laborious for screening many cell types, we used S18 extracts. Like others, we showed that both S18 and S100 extracts from various cells mediate similar rates of in vitro decay (Fig. 4C) (44, 46, 48, 49).2

Bmp2 mRNA is undetectable in undifferentiated F9 stem cells. In contrast, the endogenous Bmp2 RNA is abundant in RACT-treated cells (Fig. 2B) (36, 41). Similarly, RACT stimulates the expression of Bmp2 reporter genes (Fig. 3) (29, 31). The half-life of a synthetic mouse Bmp2 RNA in extracts from undifferentiated F9 stem cells is less than 10 min but is greater than 20 min in extracts from RACT-treated cells (Fig. 4D). Thus, the in vitro half-lives of Bmp2 RNAs correlate with their relative abundance in cells. This suggests that differentiation induces factors that stabilize Bmp2 RNAs.

Human, Chick, and Zebrafish HCNS-containing RNAs Also Decay Rapidly in Vitro—We tested the hypothesis that 3'UTR function has been conserved over 310 and 450 million years, since mammals separated from birds and fish (71), using chick and zebrafish sequences equivalent to the mouse HCNS (Fig. 1). Mouse, human, chick, and fish RNAs were similarly unstable in F9 stem cell extracts (Table I). This suggests that the HCNS regulates Bmp2 mRNA stability in birds and fish, as well as mammals. Most importantly, human and zebrafish RNA were more stable in extracts from differentiated F9 cells (Fig. 4, E and F, and Table I). Thus, the human and fish sequences recapitulate the regulated decay pattern of the mouse Bmp2 mRNA during RACT-induced differentiation.


View this table:
[in this window]
[in a new window]
  		TABLE I
RNAs containing the Bmp2 HCNS from other species are rapidly degraded in F9 stem cell extracts relative to extracts from F9 cells induced to differentiate with RACT

The percentage of the RNA remaining after 30 min of incubation ± S.E. or range is shown. The number of experimental determinations is given in parentheses. ND, not done.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
Protein coding genes are regulated at many levels, including transcription initiation and elongation, RNA processing, stability, and translation. The complex patterns of embryonic Bmp2 expression make it unlikely that all Bmp2 regulation occurs at the promoter (4, 53, 54). Indeed, the Drosophila Bmp homolog, dpp, has regulatory elements located throughout the 25 kbp downstream of the stop codon, and the transcript is alternately spliced (26). Sequence identity between the Bmp2 3'UTRs from widely separated vertebrate lineages (Fig. 1) (29) suggests that the 3'UTR interacts with conserved cellular complexes controlling post-transcriptional RNA function. Both alternative Bmp2 transcripts have 3'UTRs that are more than twice as long as the average 3'UTR of 300–500 nt ((72–74).3 Unlike many mRNAs, the Bmp2 3'UTR is more conserved than the coding region (Fig. 1) (29). An unusual length, alternative polyadenylation, and extreme conservation appear to be unique features of the Bmp2 3'UTR. Specifically, Bmp4, a sister gene that encodes a protein that is 91% identical to BMP2, has a 3'UTR that is short, is not alternatively polyadenylated, is significantly less conserved, and lacks any similarity to the Bmp2 HCNS.

We demonstrated that, like the mouse HCNS, RNAs containing the human or zebrafish HCNS are stabilized in extracts from Bmp2-expressing F9 cells. Thus, the 260 nt that are identical between fish and mammals is sufficient to mediate the change in RNA stability associated with induced Bmp2 expression in F9 cells. Most interestingly, the dpp and AmphiBMP2/4 3'UTRs from several fly and amphioxus species are also as conserved as the coding regions of these genes (supplemental Fig. 1) (27, 28, 56, 57). The 3'UTRs of other insect dpps, e.g. the red flour beetle (T. castaneum) (75), also contain AREs and are relatively long. The part of the amphioxus 3'UTR that aligns with the Bmp2 HCNS, but not Bmp4, contains AREs. The fact that Bmp2 genes in vertebrates and dpp genes in invertebrates have highly conserved, long, and AU-rich 3'UTRs is consistent with involvement in an evolutionarily ancient post-transcriptional mechanism. Indeed, because RNA processing proteins are conserved between yeast, insects, and mammals (76, 77), it is logical that the RNA targets of the decay apparatus would be similarly conserved.

Initially, the 3'UTR regulates mRNA processing during synthesis (78). Cis-acting elements in the RNA mediate binding of polyadenylation factors that stimulate cleavage at a specific position (for review see Refs. 62 and 79–81). Subsequently, poly(A) polymerase synthesizes a poly(A) tail. Alternative polyadenylation occurs in up to half of human mRNAs.3 These mRNAs contain variations in the cis-acting elements controlling cleavage site choice (47, 65, 82). Because elements controlling post-transcriptional regulation may be in one 3'UTR, but not another, alternative polyadenylation is an important regulatory event. In addition, the number of poly(A) signals can strongly modulate RNA abundance (68–70).

Bmp2 mRNAs exhibit tissue-specific cleavage and polyadenylation (Fig. 2). These alternative transcripts contain or lack a sequence that is 78–83% identical between the mouse sequence and the human, dog, and cow sequences shown in Fig. 1C. Indeed, the poly(A) signals are the second most conserved region of the 3'UTR. A reporter construct lacking the HCNS, but containing the tandem Bmp2 poly(A) signals (Fig. 3, construct E), was expressed more than constructs with only the promoter (Fig. 3, construct A) or with the entire 3'UTR downstream of a strong viral poly(A) signal (Fig. 3, construct D). The sequence conservation at the transcript ends, the increased activity of reporter genes with both signals, and the tissue-specific alternative polyadenylation suggests that the two poly(A) signals are a major influence on Bmp2 mRNA levels.

Differential control of RNA degradation via the 3'UTR is an essential regulatory mechanism controlling gene expression in eukaryotes (44, 76, 77, 83). Regulated degradation of mRNAs, such as those encoding cytokines and other signaling molecules, involves AREs located in the 3'UTR (44, 77, 84–86). Important signals including steroid hormones regulate the stability of specific mRNAs (87). Similarly, RA may alter Bmp2 stability.

We have shown that the Bmp2 HCNS modulates mRNA stability in vitro (Fig. 4 and Table I). More importantly, the relative half-lives of Bmp2 transcripts in extracts from undifferentiated and F9 cells stimulated to differentiate with RA correlate with abundance of the endogenous transcript (Figs. 2 and 4 and Table I). The 628-nt fragment containing the mouse HCNS can activate reporter gene activity in differentiated F9 cells to the same extent as 2.2 kb of 3'UTR and flanking region. The Bmp2 HCNS contains widely separated ARE motifs (Fig. 1) (29, 77). Relative to the closely spaced AREs found in the extensively analyzed TNF{alpha} mRNA, these class IID and IIE AREs are less well studied. The fact that the eight AUUUA motifs account for only 39 nt of the 265 nt conserved between mammals and fish indicates that other sequences play an essential part in transcript function.

Both transcriptional and post-transcriptional mechanisms play important roles in modulating developmental protein levels. Theoretical and empirical considerations show that small changes in RNA half-life mediated by 3'UTRs cause large changes in the net yield of RNA (87–91). Smithies and coworkers (68) recently used this fact to modulate transgene expression by over 100-fold. Such cis-regulatory elements controlling mRNA decay may be essential in the case of a potent growth and differentiation factor like Bmp2.

The 3'UTR also may contain elements that regulate nuclear export, mRNA localization, and translation (77, 83, 92). These sequence motifs can interact with many different proteins leading to a unique cell-specific assemblage (93–95). Along with the combinatorial mechanisms regulating transcription, these RNA cis-regulatory elements and the factors that bind them provide the exquisite level of control required to regulate developmental control genes like Bmp2.


   FOOTNOTES
 
* This work was supported in part by the Molecular Resource Facility at the University of Medicine and Dentistry of New Jersey Medical School, by NICHD Grant HD31117 from the National Institutes of Health, and by a grant from the Foundation of University of Medicine and Dentistry of New Jersey. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

{boxs} The on-line version of this article (available at http://www.jbc.org) contains Fig. S1.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EBI Data Bank with accession number(s) AY714781 [GenBank] , AY722408 [GenBank] , and AY722409 [GenBank] . Back

{ddagger} To whom correspondence should be addressed: Dept. of Biochemistry and Molecular Biology (MSB E627), University of Medicine and Dentistry of New Jersey Medical School, 185 South Orange Ave., P. O. Box 1709, Newark, NJ 07101-1709. Tel.: 973-972-2984; Fax: 973-972-5594; E-mail: rogersmb{at}umdnj.edu.

1 The abbreviations used are: BMP, bone morphogenetic protein; ARE, AU-rich element; DPP, decapentaplegic; Bt2cAMP, dibutyryl cyclic AMP; CT, Bt2cAMP and theophylline; HCNS, highly conserved noncoding sequence; nt, nucleotide; RA, retinoic acid; RACT, retinoic acid, Bt2cAMP, and theophylline; UTR, untranslated region; TNF{alpha}, tumor necrosis factor-{alpha}; RPA, RNase protection assays; CPSF, cleavage and polyadenylation factor specificity factor. Back

2 J. Wilusz, personal communication. Back

3 Tian, B., Hu, J., Zhang, H., and Lutz, C. S. (2004) Nucleic Acids Res., in press. Back


   ACKNOWLEDGMENTS
 
We thank Drs. Carol Lutz and Bin Tian from University of Medicine and Dentistry of New Jersey Medical School (Newark, NJ) and Jeff Wilusz from Colorado State University (Fort Collins, CO) for critical discussions and advice. We appreciate the dedicated technical assistance of Dr. Minzhen He. We also thank Drs. Jeff Yoder, Richard Pollenz, and Peter Medveczky (University of South Florida, Tampa, FL) for DNA and plasmids.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Reddi, A. H. (2001) J. Bone Jt. Surg. Am. 83, S1–S6[Free Full Text]
  2. Urist, M. (1965) Science 150, 893–899[Abstract/Free Full Text]
  3. Wozney, J. M., Rosen, V., Celeste, A. J., Mitsock, L. M., Whitters, M. J., Kriz, R. W., Hewick, R. M., and Wang, E. A. (1988) Science 242, 1528–1534[Abstract/Free Full Text]
  4. Hogan, B. (1996) Genes Dev. 10, 1580–1594[Free Full Text]
  5. Vainio, S., Karavanova, I., Jowett, A., and Thesleff, I. (1993) Cell 75, 45–58[CrossRef][Medline] [Order article via Infotrieve]
  6. Glozak, M. A., and Rogers, M. B. (1996) Dev. Biol. 179, 458–470[CrossRef][Medline] [Order article via Infotrieve]
  7. Graham, A., Francis-West, P., Brickell, P., and Lumsden, A. (1994) Nature 372, 684–686[CrossRef][Medline] [Order article via Infotrieve]
  8. Vaahtokari, A., Aberg, T., and Thesleff, I. (1996) Development (Camb.) 122, 121–129[Abstract]
  9. Zou, H., and Niswander, L. (1996) Science 272, 738–741[Abstract]
  10. Graff, J. (1997) Cell 89, 171–174[CrossRef][Medline] [Order article via Infotrieve]
  11. Winnier, G., Blessing, M., Labosky, P. A., and Hogan, B. L. (1995) Genes Dev. 9, 2105–2116[Abstract/Free Full Text]
  12. Zhang, H., and Bradley, A. (1996) Development (Camb.) 122, 2977–2986[Abstract]
  13. Yi, S. E., Daluiski, A., Pederson, R., Rosen, V., and Lyons, K. M. (2000) Development (Camb.) 127, 621–630[Abstract]
  14. Mishina, Y., Suzuki, A., Ueno, N., and Behringer, R. R. (1995) Genes Dev. 9, 3027–3037[Abstract/Free Full Text]
  15. Beppu, H., Kawabata, M., Hamamoto, T., Chytil, A., Minowa, O., Noda, T., and Miyazono, K. (2000) Dev. Biol. 221, 249–258[CrossRef][Medline] [Order article via Infotrieve]
  16. Baur, S. T., Mai, J. J., and Dymecki, S. M. (2000) Development (Camb.) 127, 605–619[Abstract]
  17. Chang, H., Huylebroeck, D., Verschueren, K., Guo, Q., Matzuk, M. M., and Zwijsen, A. (1999) Development (Camb.) 126, 1631–1642[Abstract]
  18. Sirard, C., de la Pompa, J. L., Elia, A., Itie, A., Mirtsos, C., Cheung, A., Hahn, S., Wakeham, A., Schwartz, L., Kern, S. E., Rossant, J., and Mak, T. W. (1998) Genes Dev. 12, 107–119[Abstract/Free Full Text]
  19. Tremblay, K. D., Dunn, N. R., and Robertson, E. J. (2001) Development (Camb.) 128, 3609–3621[Medline] [Order article via Infotrieve]
  20. Yang, X., Li, C., Xu, X., and Deng, C. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 3667–3672[Abstract/Free Full Text]
  21. Yang, X., Castilla, L. H., Xu, X., Li, C., Gotay, J., Weinstein, M., Liu, P. P., and Deng, C. X. (1999) Development (Camb.) 126, 1571–1580[Abstract]
  22. Lelong, C., Mathieu, M., and Favrel, P. (2001) Biochimie (Paris) 83, 423–426, and references therein
  23. Sampath, T. K., Rashka, K. E., Doctor, J. S., Tucker, R. F., and Hoffmann, F. M. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 6004–6008[Abstract/Free Full Text]
  24. Padgett, R. W., Wozney, J. M., and Gelbart, W. M. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 2905–2909[Abstract/Free Full Text]
  25. Hogan, B. (1995) Nature 376, 210–211[CrossRef][Medline] [Order article via Infotrieve]
  26. St. Johnston, R. D., Hoffmann, F. M., Blackman, R. K., Segal, D., Grimaila, R., Padgett, R. W., Irick, H. A., and Gelbart, W. M. (1990) Genes Dev. 4, 1114–1127[Abstract/Free Full Text]
  27. Newfeld, S. J., Padgett, R. W., Findley, S. D., Richter, B. G., Sanicola, M., de Cuevas, M., and Gelbart, W. M. (1997) Genetics 145, 297–309[Abstract]
  28. Richter, B., Long, M., Lewontin, R. C., and Nitasaka, E. (1997) Genetics 145, 311–323[Abstract]
  29. Abrams, K. L., Xu, J., Nativelle-Serpentini, C., Dabirshahsahebi, S., and Rogers, M. B. (2004) J. Biol. Chem. 279, 15916–15928[Abstract/Free Full Text]
  30. Ghosh-Choudhury, N., Choudhury, G. G., Harris, M. A., Wozney, J., Mundy, G. R., Abboud, S. L., and Harris, S. E. (2001) Biochem. Biophys. Res. Commun. 286, 101–108[CrossRef][Medline] [Order article via Infotrieve]
  31. Heller, L. C., Li, Y., Abrams, K. A., and Rogers, M. B. (1999) J. Biol. Chem. 274, 1394–1400[Abstract/Free Full Text]
  32. Helvering, L. M., Sharp, R. L., Ou, X., and Geiser, A. G. (2000) Gene (Amst.) 256, 123–138[CrossRef][Medline] [Order article via Infotrieve]
  33. Sugiura, T. (1999) Biochem. J. 338, 433–440[Medline] [Order article via Infotrieve]
  34. Zhou, S., Turgeman, G., Harris, S. E., Leitman, D. C., Komm, B. S., Bodine, P. V., and Gazit, D. (2003) Mol. Endocrinol. 17, 56–66[Abstract/Free Full Text]
  35. Feng, J. Q., Xing, L., Zhang, J. H., Zhao, M., Horn, D., Chan, J., Boyce, B. F., Harris, S. E., Mundy, G. R., and Chen, D. (2003) J. Biol. Chem. 278, 29130–29135[Abstract/Free Full Text]
  36. Rogers, M. B., Rosen, V., Wozney, J. M., and Gudas, L. J. (1992) Mol. Biol. Cell 3, 189–196[Abstract]
  37. Boylan, J., Lufkin, T., Achkar, C., Taneja, R., Chambon, P., and Gudas, L. (1995) Mol. Cell. Biol. 15, 843–851[Abstract]
  38. Francis, P. H., Richardson, M. K., Brickell, P. M., and Tickle, C. (1994) Development (Camb.) 120, 209–218[Abstract]
  39. Hallahan, A. R., Pritchard, J. I., Chandraratna, R. A., Ellenbogen, R. G., Geyer, J. R., Overland, R. P., Strand, A. D., Tapscott, S. J., and Olson, J. M. (2003) Nat. Med. 9, 1033–1038[CrossRef][Medline] [Order article via Infotrieve]
  40. Zile, M. (1998) J. Nutr. 128, S455–S458[Medline] [Order article via Infotrieve]
  41. Rogers, M. (1996) Cell Growth & Differ. 7, 115–122[Abstract]
  42. Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., and Struhl, K. (eds) (1997) Current Protocols in Molecular Biology, pp. 4.2.3–4.2.5, 4.7.1–4.7.2, 2.9.1–2.9.5, 2.10.2–2.10.3, John Wiley & Sons, Inc., New York
  43. Strijker, R., Fritz, D. T., and Levinson, A. D. (1989) EMBO J. 8, 2669–2675[Medline] [Order article via Infotrieve]
  44. Mukherjee, D., Gao, M., O'Connor, J. P., Raijmakers, R., Pruijn, G., Lutz, C. S., and Wilusz, J. (2002) EMBO J. 21, 165–174[CrossRef][Medline] [Order article via Infotrieve]
  45. Vasios, G. W., Gold, J. D., Petkovich, M., Chambon, P., and Gudas, L. J. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 9099–9103[Abstract/Free Full Text]
  46. Ford, L. P., and Wilusz, J. (1999) Methods 17, 21–27[CrossRef][Medline] [Order article via Infotrieve]
  47. Natalizio, B. J., Muniz, L. C., Arhin, G. K., Wilusz, J., and Lutz, C. S. (2002) J. Biol. Chem. 277, 42733–42740[Abstract/Free Full Text]
  48. Fritz, D. T., Ford, L. P., and Wilusz, J. (2000) Science's STKE http:/www.stke.org/cgi/content/full/OC_sigtrans;2000/PL1
  49. Mukherjee, D., Fritz, D. T., Kilpatrick, W. J., Gao, M., and Wilusz, J. (2004) Methods Mol. Biol. 257, 193–212[Medline] [Order article via Infotrieve]
  50. Duret, L., Dorkeld, F., and Gautier, C. (1993) Nucleic Acids Res. 21, 2315–2322[Abstract/Free Full Text]
  51. Shabalina, S. A., Ogurtsov, A. Y., Lipman, D. J., and Kondrashov, A. S. (2003) Nucleic Acids Res. 31, 5433–5439[Abstract/Free Full Text]
  52. Spicher, A., Guicherit, O. M., Duret, L., Aslanian, A., Sanjines, E. M., Denko, N. C., Giaccia, A. J., and Blau, H. M. (1998) Mol. Cell. Biol. 18, 7371–7382[Abstract/Free Full Text]
  53. Lyons, K. M., Pelton, R. W., and Hogan, B. L. M. (1990) Devlelopment (Camb.) 109, 833–844
  54. Lyons, K., Pelton, R., and Hogan, B. (1989) Genes Dev. 3, 1657–1668[Abstract/Free Full Text]
  55. Jones, C. M., Lyons, K. M., and Hogan, B. L. M. (1991) Development (Camb.) 111, 531–542[Abstract]
  56. Panopoulou, G. D., Clark, M. D., Holland, L. Z., Lehrach, H., and Holland, N. D. (1998) Dev. Dyn. 213, 130–139[CrossRef][Medline] [Order article via Infotrieve]
  57. Frazer, K. A., Elnitski, L., Church, D. M., Dubchak, I., and Hardison, R. C. (2003) Genome Res. 13, 1–12[Abstract/Free Full Text]
  58. Panopoulou, G., Hennig, S., Groth, D., Krause, A., Poustka, A. J., Herwig, R., Vingron, M., and Lehrach, H. (2003) Genome Res. 13, 1056–1066[Abstract/Free Full Text]
  59. Wada, H., and Satoh, N. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 1801–1804[Abstract/Free Full Text]
  60. Nohara, M., Nishida, M., Manthacitra, V., and Nishikawa, T. (2004) Zool. Sci. (Tokyo) 21, 203–210
  61. Canestro, C., Godoy, L., Gonzalez-Duarte, R., and Albalat, R. (2003) Evol. Dev. 5, 157–162, and references therein[Medline] [Order article via Infotrieve]
  62. MacDonald, C. C., and Redondo, J. L. (2002) Mol. Cell. Endocrinol. 190, 1–8, and references therein[CrossRef][Medline] [Order article via Infotrieve]
  63. Gil, A., and Proudfoot, N. J. (1984) Nature 312, 473–474[CrossRef][Medline] [Order article via Infotrieve]
  64. Gil, A., and Proudfoot, N. J. (1987) Cell 49, 399–406[CrossRef][Medline] [Order article via Infotrieve]
  65. Chen, F., MacDonald, C. C., and Wilusz, J. (1995) Nucleic Acids Res. 23, 2614–2620[Abstract/Free Full Text]
  66. Chen, F., and Wilusz, J. (1998) Nucleic Acids Res. 26, 2891–2898[Abstract/Free Full Text]
  67. Bagga, P. S., Ford, L. P., Chen, F., and Wilusz, J. (1995) Nucleic Acids Res. 23, 1625–1631[Abstract/Free Full Text]
  68. Kakoki, M., Tsai, Y. S., Kim, H. S., Hatada, S., Ciavatta, D. J., Takahashi, N., Arnold, L. W., Maeda, N., and Smithies, O. (2004) Dev. Cell 6, 597–606[CrossRef][Medline] [Order article via Infotrieve]
  69. Edwalds-Gilbert, G., Prescott, J., and Falck-Pedersen, E. (1993) Mol. Cell. Biol. 13, 3472–3480[Abstract/Free Full Text]
  70. Denome, R. M., and Cole, C. N. (1988) Mol. Cell. Biol. 8, 4829–4839[Abstract/Free Full Text]
  71. Ureta-Vidal, A., Ettwiller, L., and Birney, E. (2003) Nat. Rev. Genet. 4, 251–262[Medline] [Order article via Infotrieve]
  72. Hawkins, J. D. (1988) Nucleic Acids Res. 16, 9893–9908[Abstract/Free Full Text]
  73. Deutsch, M., and Long, M. (1999) Nucleic Acids Res. 27, 3219–3228[Abstract/Free Full Text]
  74. Shabalina, S. A., Ogurtsov, A. Y., Rogozin, I. B., Koonin, E. V., and Lipman, D. J. (2004) Nucleic Acids Res. 32, 1774–1782[Abstract/Free Full Text]
  75. Sanchez-Salazar, J., Pletcher, M., Bennett, R., Brown, S., Dandamudi, T., Denell, R., and Doctor, J. (1996) Dev. Genes Evol. 206, 237–346[CrossRef]
  76. Fritz, D., Bergman, N., Kilpatrick, W., Wilusz, C., and Wilusz, J. (2004) Cell Biochem. Biophys. 41, 265–278[CrossRef][Medline] [Order article via Infotrieve]
  77. Wilusz, C. J., Wormington, M., and Peltz, S. W. (2001) Nat. Rev. Mol. Cell. Biol. 2, 237–246[CrossRef][Medline] [Order article via Infotrieve]
  78. Proudfoot, N. J., Furger, A., and Dye, M. J. (2002) Cell 108, 501–512[CrossRef][Medline] [Order article via Infotrieve]
  79. Manley, J. L. (1995) Curr. Opin. Genet. Dev. 5, 222–228[CrossRef][Medline] [Order article via Infotrieve]
  80. Proudfoot, N. (2000) Trends Biochem. Sci. 25, 290–293[CrossRef][Medline] [Order article via Infotrieve]
  81. Colgan, D. F., and Manley, J. L. (1997) Genes Dev. 11, 2755–2766[Free Full Text]
  82. Edwalds-Gilbert, G., Veraldi, K. L., and Milcarek, C. (1997) Nucleic Acids Res. 25, 2547–2561[Abstract/Free Full Text]
  83. Conne, B., Stutz, A., and Vassalli, J. D. (2000) Nat. Med. 6, 637–641[CrossRef][Medline] [Order article via Infotrieve]
  84. Bakheet, T., Frevel, M., Williams, B. R., Greer, W., and Khabar, K. S. (2001) Nucleic Acids Res. 29, 246–254[Abstract/Free Full Text]
  85. Bakheet, T., Williams, B. R., and Khabar, K. S. (2003) Nucleic Acids Res. 31, 421–423[Abstract/Free Full Text]
  86. Shaw, G., and Kamen, R. (1986) Cell 46, 659–667[CrossRef][Medline] [Order article via Infotrieve]
  87. Ross, J. (1995) Microbiol. Rev. 59, 423–450[Abstract/Free Full Text]
  88. Hargrove, J. L., and Schmidt, F. H. (1989) FASEB J. 3, 2360–2370[Abstract]
  89. Rajagopalan, L. E., and Malter, J. S. (1997) Prog. Nucleic Acids Res. Mol. Biol. 56, 257–286[Medline] [Order article via Infotrieve]
  90. Jacobson, A., and Peltz, S. W. (1996) Annu. Rev. Biochem. 65, 693–739[CrossRef][Medline] [Order article via Infotrieve]
  91. Davidson, E. (1986) Gene Activity in Early Development, 3rd Ed., Academic Press, Orlando
  92. Kuersten, S., and Goodwin, E. B. (2003) Nat. Rev. Genet. 4, 626–637[CrossRef][Medline] [Order article via Infotrieve]
  93. Dreyfuss, G., Kim, V. N., and Kataoka, N. (2002) Nat. Rev. Mol. Cell Biol. 3, 195–205[CrossRef][Medline] [Order article via Infotrieve]
  94. Keene, J. D. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 7018–7024[Abstract/Free Full Text]
  95. Keene, J. D. (2003) Mol. Cell 12, 1347–1349[CrossRef][Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 DevelopmentHome page
M. Dixon Fox and A. E. E. Bruce
Short- and long-range functions of Goosecoid in zebrafish axis formation are independent of Chordin, Noggin 1 and Follistatin-like 1b
Development, May 15, 2009; 136(10): 1675 - 1685.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
D. Liu, D. T. Fritz, M. B. Rogers, and A. J. Shatkin
Species-specific cis-Regulatory Elements in the 3'-Untranslated Region Direct Alternative Polyadenylation of Bone Morphogenetic Protein 2 mRNA
J. Biol. Chem., October 17, 2008; 283(42): 28010 - 28019.
[Abstract] [Full Text] [PDF]

Home page
 Nucleic Acids ResHome page
V. Moucadel, F. Lopez, T. Ara, P. Benech, and D. Gautheret
Beyond the 3' end: experimental validation of extended transcript isoforms
Nucleic Acids Res., March 19, 2007; 35(6): 1947 - 1957.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
N. Fukui, Y. Ikeda, T. Ohnuki, A. Hikita, S. Tanaka, S. Yamane, R. Suzuki, L. J. Sandell, and T. Ochi
Pro-inflammatory Cytokine Tumor Necrosis Factor-{alpha} Induces Bone Morphogenetic Protein-2 in Chondrocytes via mRNA Stabilization and Transcriptional Up-regulation
J. Biol. Chem., September 15, 2006; 281(37): 27229 - 27241.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Endocrinol.Home page
D. T. Fritz, S. Jiang, J. Xu, and M. B. Rogers
A Polymorphism in a Conserved Posttranscriptional Regulatory Motif Alters Bone Morphogenetic Protein 2 (BMP2) RNA:Protein Interactions
Mol. Endocrinol., July 1, 2006; 20(7): 1574 - 1586.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
279/47/48950    most recent
M409620200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fritz, D. T.
Right arrow Articles by Rogers, M. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fritz, D. T.
Right arrow Articles by Rogers, M. B.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2004 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement