Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M408915200 on September 9, 2004

J. Biol. Chem., Vol. 279, Issue 48, 49680-49688, November 26, 2004
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
279/48/49680    most recent
M408915200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Thyagarajan, A.
Right arrow Articles by Szaro, B. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Thyagarajan, A.
Right arrow Articles by Szaro, B. G.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Phylogenetically Conserved Binding of Specific K Homology Domain Proteins to the 3'-Untranslated Region of the Vertebrate Middle Neurofilament mRNA*

Amar Thyagarajan and Ben G. Szaro{ddagger}

From the Department of Biological Sciences and the Center for Neuroscience Research, University at Albany, State University of New York, Albany, New York 12222

Received for publication, August 4, 2004


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
As axons mature, neurofilament-M (NF-M) expression rises, contributing to maturation of the axonal cytoskeleton and an expansion in axon caliber. This increase is partly due to a rise in NF-M mRNA stability. Such post-transcriptional regulation is often mediated through the binding of specific proteins to the 3'-untranslated region (3'-UTR) of mRNAs. Vertebrate NF-M 3'-UTRs are remarkably well conserved, prompting us to test whether similar proteins bind the 3'-UTRs of different vertebrate NF-Ms. Identification of such proteins could lead to insights into the regulation of NF-M expression during development and in response to trauma or disease. Ultraviolet cross-linking analysis of proteins isolated from adult frog (Xenopus laevis), mouse, and rat brains revealed three ribonucleoprotein complexes (97, 70, and 47 kDa) that were present in all species and bound specifically to NF-M 3'-UTRs. Affinity purification of NF-M 3'-UTR-binding proteins from rat brain followed by mass spectrometry and immunoprecipitation assays identified heterogeneous nuclear ribonucleoprotein (hnRNP) K and hnRNP E1 as the proteins forming the 70- and 47-kDa complexes, respectively. These RNA-binding proteins of the KH domain family recognize CU-rich motifs identical to ones present in NF-M 3'-UTRs. Ultraviolet cross-linking assays performed on Xenopus embryos at different stages of neural development demonstrated that whereas hnRNP K binding occurred at all stages, hnRNP E binding occurred only at the most mature stages of axon development. Since hnRNP E is known to stabilize mRNAs, these results raise the hypothesis that these proteins may contribute to the increases in cytoplasmic levels of NF-M mRNA that accompany axonal maturation.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Neurofilaments (NFs)1 are the most abundant structural component of vertebrate axons. They are made of neuronal intermediate filament (nIF) proteins, which include peripherin, {alpha}-internexin, and the low, middle, and high molecular mass NF triplet proteins (NF-L, -M, and -H, respectively). In adult neurons, the stoichiometry of these proteins is tightly controlled and if unbalanced can lead to the formation of Lewy bodies and axonal degeneration (1). During development, changes in nIF expression are linked to successive phases of axon development, including neurite initiation in PC12 cells (2), the rapid growth phase of axon elongation (3, 4), and the expansion of axon caliber that follows synaptogenesis and myelination (5–8). Such changes in nIF expression are regulated, at least in part, by post-transcriptional mechanisms, which include changes in mRNA stability (9, 10) as well as in translation and localization (11–13). Aberrant post-transcriptional regulation of nIF expression plays a role in a number of neurodegenerative disorders, including amyotrophic lateral sclerosis (14).

In eukaryotes, the 3'-untranslated region (3'-UTR) of mRNAs harbors many of the cis regulatory elements critical for cytoplasmic post-transcriptional control of gene expression (15–17). Among nIFs, the role of the 3'-UTR in post-transcriptional regulation has been studied best for NF-L. Its 3'-UTR contains a 45-nucleotide-long destabilizing element that overlaps with the 3' end of the coding domain (18, 19) and binds a specific protein, p190RhoGEF (20). RNA electrophoretic mobility shift assays (EMSAs) have also implicated as yet unidentified poly(C)-binding proteins in the formation of ribonucleoprotein (RNP) complexes with the NF-L 3'-UTR (21).

NF-M is also post-transcriptionally regulated (9–11), but much less is known about the specific proteins that bind its 3'-UTR than is known for NF-L. Competitive EMSAs have implicated AU-rich element (ARE) RNA-binding proteins (21), and one such protein, Hel-N1 (also known as HuB), binds non-canonical AREs in the NF-M 3'-UTR. It also enhances NF-M translation when transfected into a human teratocarcinoma cell line (22). The 3'-UTRs of vertebrate NF-Ms, from fish to mammal, contain extensive stretches of exceptionally high conservation (23, 24), suggesting that many more trans factors must bind the 3'-UTR than are implied by the presence of the non-canonical AREs. For example, within the domains conserved among vertebrate NF-M 3'-UTRs lies a pyrimidine-rich sequence matching the consensus sequence for binding of hnRNP K homology (KH) domain RNA-binding proteins.

In this study, we set out to learn more about which proteins bind the NF-M 3'-UTR in the nervous system. Using EMSA and SDS-PAGE of brain proteins cross-linked to the NF-M 3'-UTR RNA by ultraviolet irradiation, we found evidence for at least three RNP complexes that are conserved between frog and rodent. In Xenopus, formation of one of these conserved complexes was developmentally regulated. These conserved complexes included three specific KH domain proteins (hnRNPs K, E1, and E2) that have been demonstrated to play key roles in post-transcriptional gene regulation in a variety of non-neuronal systems. Although these KH domain proteins had been previously observed in neurons (25), their targets in the nervous system were unknown. Our study provides evidence of their binding a specific, developmentally regulated neuronal mRNA, thus offering important clues about their possible functions within the nervous system.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Cloning of Xenopus and Rat NF-M 3'-UTR—The Xenopus NF-M 3'-UTR was extended to its 3' end by 3' rapid amplification of cDNA ends (26) from adult Xenopus laevis brain mRNA using a sense primer (TATGTAATGATGAGGAAGTAT) targeted to the 3'-UTR of the Xenopus NF-M mRNA sequence in GenBankTM (accession number U85969 [GenBank] ). This sequence was located 230 nucleotides upstream from the 3' end of the published sequence between positions 2967 and 2988 (27). The resulting PCR product was cloned into pGEM-T Easy (Promega, Madison, WI), and four of these clones were sequenced.

cDNA from adult Xenopus brain was next used as a template for PCR to obtain three additional cDNA clones that spanned overlapping regions from the full-length Xenopus NF-M 3'-UTR. X1 (684 bp) contained the full-length NF-M 3'-UTR plus the last 100 bp of the coding region (sense primer, GCGCGAATTCAAAGTGGAAGAGCATGAGGAGACTG; antisense primer, GCATGCAAGCTTGATATTTTCAATATAACCTTTTTATTGAG). X2 (557 bp) began at the stop codon at the beginning of the 3'-UTR (sense primer, GCGCGAATTCATAAGAGAAGAGGTACAGCAATTGC) and ended just upstream of the nuclear poly(A) signal (antisense primer, GCATGCAAGCTTGAGCAAGGTTCACTACATAACCCAT). X3 (657 bp) contained the last 100 bp of the coding region and lacked the nuclear poly(A) signal. These PCR products were directionally cloned into pGem-3Z (Promega) after digestion with EcoRI and HindIII to produce compatible ends. An analogous 566-bp cDNA clone (R3) spanning the rat NF-M 3'-UTR (GenBankTM accession number Z12152 [GenBank] ) from the last 100 bp of its coding region (sense primer, GCGCGAGCTCGTTGAAGAGCATGAGGAGACCTTTG) to the nuclear poly(A) signal (antisense primer, ATGCTCTAGACAAGAACTGCTGTGACATTTAACAT) was obtained from rat brain total RNA by reverse transcription followed by the PCR. This PCR product was directionally cloned into pGem-3Z after digestion with SacI and XbaI to produce compatible overhangs.

The sequences of these 3'-UTRs as well as those from human (GenBankTM accession number NM005382), mouse (GenBankTM accession number AK051696 [GenBank] ), and chicken (GenBankTM accession number X05558 [GenBank] ) were aligned using ClustalX (28) using the default parameters. The first nucleotide of the stop codon preceding each 3'-UTR was designated as the first nucleotide in the alignment. The alignment was further refined manually using the BIOEDIT suite (29).

In Vitro Transcription Reactions—Sense RNA probes X2S, X3S, and R3S were synthesized by in vitro transcription from X2, X3, and R3, respectively, using T7 RNA polymerase (New England Biolabs, Beverly, MA). Nonspecific competitor GFP RNA (570 nucleotides) was synthesized from pGreen-Lantern (Invitrogen) using SP6 polymerase (New England Biolabs). To prepare the templates for in vitro transcription, the Xenopus, rat, and GFP plasmids were linearized with HindIII, XbaI, or BamHI, respectively, and then purified by agarose gel electrophoresis. To generate radiolabeled RNA transcripts, 1 µg of each DNA template was added to in vitro transcription reactions (30) containing [{alpha}-32P]UTP (800 Ci/mmol, 10 mCi/ml, PerkinElmer Life Sciences); non-radioactive competitor RNA probes were synthesized with unlabeled UTP. After purification and removal of unincorporated nucleotides (30), the RNA was resuspended in Buffer A (50 mM potassium acetate, 3 mM magnesium acetate, 2 mM dithiothreitol, 20 mM HEPES, pH 7.4, 175 µg/ml phenylmethylsulfonyl fluoride, 10 µg/ml leupeptin, and 10 µg/ml pepstatin A).

Preparation of Cytosolic Extracts—Cytosolic protein extracts were prepared from adult brains of X. laevis, rat (Long Evans, Taconic Farms, Taconic, NY), and mouse (C57B1/6, University at Albany Animal Facility, Albany, NY) and from stage 18, 29/30, and 37/38 (31) X. laevis whole embryos. Tissues were homogenized in 2 volumes of ice-cold Buffer A using a PT3000 Polytron (Kinematica AG, Littau-Luzerne, Switzerland) and then centrifuged at 10,000 x g for 30 min at 4 °C to remove debris. The resulting supernatant was centrifuged again at 100,000 x g for 1 h at 4 °C to isolate the cytosolic phase. This supernatant was then divided into aliquots at a final concentration of 20 µg/µl in Buffer A, 5% glycerol and then at stored –80 °C.

RNA EMSA—RNA EMSA was performed by incubating 60 µg of cytosolic extract with 5 x 105 cpm X2S or X3S radiolabeled RNA probe in a reaction volume of 20 µl for 30 min at 20 °C. This incubation was followed by addition of 100 µg of heparin and further incubation for an additional 5 min at 20 °C (18, 32). For the competition experiments, unlabeled competitor RNA was added in molar excess (15-, 75-, 150-, and 315-fold) to the radioactive RNA probe in each reaction. Reaction mixtures were then electrophoresed overnight at 4 °C on a 5% non-denaturing polyacrylamide gel (acrylamide:bisacrylamide = 40:1). The gel was dried and exposed overnight to a phosphor screen (Amersham Biosciences), and the image was acquired using a STORM 860 PhosphorImager (Amersham Biosciences). A second image was also made using x-ray film (X-Omat AR, Eastman Kodak Co.).

UV Cross-linking (UVCL) Assay—Radiolabeled RNA-protein complexes were formed by mixing cytosolic extracts with 6.25 x 105 cpm RNA as described for the RNA EMSA (18, 32, 33). Competition experiments were also performed as described for the RNA EMSA. The RNA-protein complexes were covalently cross-linked by irradiation with ultraviolet light (254 nm, 1650 mJ of total energy; Stratalinker, Bio-Rad) while the samples were kept cool in an ice slurry. Cross-linked samples were incubated with 10 µg of RNase A for 30 min at 37 °C to remove the unprotected RNA. Samples were then denatured for SDS-PAGE by boiling for 5 min in 60 µl of SDS sample buffer (2.5% SDS, 5% {beta}-mercaptoethanol in upper gel buffer (34)). 20 µl of this solution was then electrophoretically separated on an 8% polyacrylamide gel (34), which was fixed and stained with Coomassie Blue, dried, and exposed to a phosphor screen for 48 h or to x-ray film. Apparent molecular weights of the cross-linked complexes were calculated based on their migration relative to low range molecular weight standards (Bio-Rad).

Affinity Purification and Identification of RNA-binding Proteins— Proteins that bind the NF-M 3'-UTR were affinity-purified by binding to in vitro transcribed X3S RNA affixed to magnetic streptavidin beads (New England Biolabs). To prepare the affinity matrix, 360 µg (~1.6 nmol) of in vitro transcribed X3S RNA (made with AmpliScribe T7, Epicenter Technologies, Madison, WI) was suspended in 200 µl of Incubation Buffer C (IBC: 10 mM Tris-HCl, pH 7.2, 1 mM EDTA, 50 mM NaCl, 0.02% Ficoll, 0.02% polyvinyl pyrrolidone) containing 8 nmol of a 3'-biotinylated oligo (5'-TCATGCTCTTCCACTTTGAATTCGCCCATA-3'-biotin) that was complementary to the 5' end of the X3S probe. The RNA and oligo were then hybridized together by incubating them at 65 °C for 5 min in a water bath that was slowly cooled to room temperature over a 2-h period. The RNA/biotinylated oligo hybrid was then bound to 400 µl of magnetic streptavidin beads (New England Biolabs) that had been prewashed with IBC. The binding reaction was performed by incubating these beads together with the RNA/biotinylated oligo hybrid mixture in a final volume of 400 µl for 2–3 h on a Nutator at room temperature. Prepared beads were stored at 4 °C.

Proteins that bind to the NF-M 3'-UTR were purified from 2 mg of adult rat brain cytosolic extract. To clear the extract of proteins that bind nonspecifically to the beads, it was incubated for 1–2 h at 4 °C on a Nutator with 600 µl of prewashed beads lacking any RNA. The incubated beads were collected afterward and saved for analysis (BO fraction). The precleared extract was next incubated with beads decorated with the RNA/biotinylated oligo (RNA-beads) to collect proteins that bind to the NF-M 3'-UTR. In this reaction, the extract was divided into four parts that were incubated for 2 h at 4°C with separate 100-µl aliquots of the RNA-beads in a volume of 1 ml of IBC. To remove nonspecifically bound proteins, 100 µl of heparin (50 mg/ml) was added, and the beads were washed six times with 200 µl of IBC. To elute the RNA-binding proteins from the beads, the beads were incubated with 200 µl of prewarmed Buffer H (10 mM Tris-HCl, pH 8.4, 1 mM EDTA, 2.5 mM NaCl, 0.02% Ficoll, 0.02% polyvinyl pyrrolidone) at 40 °C, which melted the RNA/oligo hybrid to release RNA-protein complexes. The proteins that bound specifically to the RNA were distinguished from those that bound nonspecifically to the beads by analyzing aliquots from all the wash fractions and the eluates on silver-stained 8% polyacrylamide-SDS gels. To purify the RNA-binding proteins further, the eluates from the RNA beads were pooled, concentrated by precipitation with trichloroacetic acid (35, 36), resuspended in SDS sample buffer, and separated by 8% SDS-PAGE. Proteins were visualized by staining with BioSafe Coomassie Blue (Bio-Rad) following the manufacturer's instructions. The stained gel was sent to the University at Albany proteomics core facility for protein identification by mass spectrometry. Designated bands were excised and subjected to in situ alkylation of cysteines and in-gel tryptic digestion, and the digest solution was injected onto a nanospray LC-Q-TOF 2 tandem mass spectrometer (Waters-Micromass). For protein identification, tandem spectra or MS/MS spectra were searched against the National Center for Biotechnology Information (NCBI) non-redundant data base under the Rodent Taxonomy.

Western Blots—For Western blots, samples were separated by 8% SDS-PAGE and transferred to nitrocellulose membrane (Schleicher and Schuell) at 75 V for 3 h at 10 °C (34, 37). After blocking for 90 min at room temperature (38), the membranes were incubated overnight at 4 °C with one of the following antibodies: a 1:1,000 dilution of three separate rabbit polyclonal antibodies specific for hnRNP E1 (anti-PCBP1), hnRNP E2 (anti-PCBP2), or both (anti-PCBP1 and -2) (39); a 1:500 dilution of rabbit polyclonal anti-hnRNP K (Santa Cruz Biotechnology, Santa Cruz, CA); or blocking solution without primary antibody that served as a control. After washing, blots were incubated for 3 h at room temperature in secondary antibody (alkaline phosphatase-coupled anti-rabbit IgG, 0.4µg/ml, Kirkegaard and Perry, Gaithersburg, MD) and then processed for the detection of alkaline phosphatase activity with 5-bromo-4-chloro-3-indolyl phosphate/nitroblue tetrazolium following conventional procedures (30).

Immunoprecipitation of UV Cross-linked RNP Complexes—Radiolabeled RNP complexes were formed as described for the UVCL assay. After UV irradiation and RNase digestion, the volume of the reaction was increased to 500 µl, and 5 µl of anti-hnRNP K or anti-hnRNP E1 and E2 antibody was added and incubated overnight at 4 °C on a Nutator. The antibody-bound RNP complex was incubated with 50 µlof Protein A-Sepharose beads (Sigma) for 2 h after which the beads were washed with Buffer A. Immunoprecipitated RNP complexes were eluted by boiling the beads in 50 µl of SDS sample buffer and separated on an 8% SDS-polyacrylamide gel. The gel was stained with Coomassie Blue and then dried and exposed to a phosphor screen. The images were captured using a STORM 860 PhosphorImager, and then the same gels were exposed to X-Omat x-ray film for 10 days.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
The 3'-UTRs of NF-M mRNAs Are Highly Conserved and Contain Pyrimidine-rich Sequences That May Function as cis Regulatory Sequences—Because the sequence of the Xenopus NF-M 3'-UTR in GenBankTM (accession numbers U85969 [GenBank] /U85970) was nearly 300 nucleotides shorter than that of other vertebrates and lacked a nuclear termination and poly(A) signal, we suspected that more of the 3'-UTR remained to be found. The 3'-UTR was extended to its full length by 3' rapid amplification of cDNA ends, and four of these clones were sequenced. We concluded that these clones represented the remainder of the 3'-UTR both because they had a canonical nuclear termination and polyadenylation signal 20 nucleotides upstream from the poly(A) tail and because they yielded a 3'-UTR that was comparable in length (593 nucleotides) to that of other vertebrate NF-Ms (mouse, chick, rat, and human). The full-length Xenopus NF-M mRNA 3'-UTR was remarkably similar to that of other vertebrates along its entire length (Fig. 1), exhibiting numerous blocks of nearly complete identity. Overall the Xenopus NF-M 3'-UTR exhibited 47% identity among all five vertebrates compared (highlighted in black) and an additional 21% identity among four of the five species (highlighted in gray).



View larger version (106K):
[in this window]
[in a new window]
  		FIG. 1.
The 3'-UTR of NF-M mRNA is highly conserved. Multiple sequence alignment of the 3'-UTR of NF-M mRNAs from five organisms shows the high degree of sequence conservation among them. The black and the gray shading represents nucleotides conserved among all five and in four of the five species, respectively. Each sequence begins with the stop codon. Black lines represent conserved pyrimidine-rich stretches. The hnRNP E consensus binding sequence is marked by asterisks. The dotted black line represents a sequence motif similar to the 15-lipoxygenase differentiation control element of rabbit 15-lipoxygenase mRNA.

 
This high degree of sequence conservation strongly suggests that the NF-M 3'-UTR plays an important functional role, perhaps providing cis elements involved in the recruitment of regulatory trans factors, such as RNA-binding proteins. Consistent with this idea, we found within the conserved regions several pyrimidine-rich stretches (underlined in Fig. 1) that strongly resembled cis elements that bind poly(C)-sensitive RNA-binding proteins (17, 40–44).

trans Factors in the Adult Xenopus Brain Formed Specific RNP Complexes with the Xenopus NF-M 3'-UTR—The presence of highly conserved domains in the NF-M 3'-UTR suggested that the 3'-UTR is involved in the formation of specific RNP complexes. To test this hypothesis, we performed EMSAs on cytosolic extracts from adult Xenopus brain using two overlapping radiolabeled RNA probes (Fig. 2A). To avoid interference from poly(A)-binding proteins, both probes were terminated just upstream of the AAUAAA polyadenylation signal. The first probe (X2S) spanned the entire remaining 3'-UTR beginning with the stop codon. The second probe (X3S) spanned this same region but also extended further upstream to include the last 100 nucleotides of the coding domain. We made this second probe because a comparable region of the coding domain of NF-L mRNA is essential for the formation of RNP complexes (18–21).



View larger version (47K):
[in this window]
[in a new window]
  		FIG. 2.
Proteins in adult Xenopus brain bind specifically to the NF-M 3'-UTR. The presence of the last 100 nucleotides of the coding region in the RNA probe has no effect on protein binding. A, schematic diagram of the in vitro transcribed NF-M 3'-UTR RNA (1S, top). As indicated, the 2S (middle) and 3S (bottom) RNAs were transcribed from cDNAs derived from the template used to make 1S. B, RNA gel mobility shift assay using 1 x 106 cpm 2S or 3S Xenopus NF-M 3'-UTR RNA probes and 60 µg of adult Xenopus brain protein extract demonstrates identical shift in the mobility of 2S and 3S RNA probes. C, RNA gel shift assay with the 3S RNA probe and adult Xenopus brain protein extract in the absence of competitor RNA (NC) and in the presence of an increasing molar excess of specific competitor RNA (non-radioactive 3S RNA) or nonspecific competitor RNA (GFP RNA) relative to the radioactively labeled probe. The open triangles represent increasing amounts (15-, 75-, 150-, and 315-fold molar excesses) of competitor RNA.

 
The migration of both the X2S and X3S RNA probes shifted when incubated with adult frog brain cytosolic extract, indicating the formation of a RNP complex (Fig. 2B). Because the shifts were indistinguishable between the two probes, we concluded that the last 100 nucleotides of the coding region are unlikely to be involved in complex formation. We further concluded that RNP complex formation was specific because both the intensity and the shift of the band representing the complex were reduced with increasing amounts of specific competitor RNA (i.e. non-radioactive X3S probe; Fig. 2C, lanes 3–6). These properties were much less affected by similarly increasing amounts of nonspecific competitor RNA (i.e. a non-radioactive GFP RNA of similar length as the X3S probe; Fig. 2C, lanes 7–10).

Three Proteins in Adult Xenopus Brain Bound Specifically to the NF-M mRNA 3'-UTR—Next we used UVCL on adult Xenopus brain cytosolic extracts to determine how many proteins are involved in formation of these RNP complexes. With 60 µg of extract, both the X2S and X3S probes yielded the same three complexes, which had apparent molecular masses of 94, 70, and 47 kDa (Fig. 3A). The formation of identical complexes with the two probes further supported our conclusion from the EMSA results that RNP complexes formed independently of the last 100 nucleotides of the NF-M coding domain.



View larger version (65K):
[in this window]
[in a new window]
  		FIG. 3.
Three proteins in adult Xenopus brain bound specifically to the NF-M 3'-UTR. A, UVCL assay of 60 µg of adult Xenopus brain extract with 625,000 cpm in vitro transcribed X2S and X3S RNA probe. Arrowheads point to the three RNA-protein complexes with apparent molecular masses of 94, 70, and 47 kDa. B, UVCL assay of increasing amounts of adult Xenopus brain extract with 625,000 cpm X3S RNA probe. The number above each lane represents the amount of brain protein extract (in µg) added to each reaction. C, UVCL assay of in vitro transcribed X3S RNA probe with 60 µg of adult Xenopus brain extract in the absence of competitor RNA (NC) or in the presence of increasing amounts (open triangles; 15-, 75-, 150-, and 315-fold molar excesses relative to labeled probe) of specific competitor RNA (non-radioactive X3S RNA) and nonspecific competitor RNA (non-radioactive GFP RNA).

 
Because in UVCL assays, the radiolabeled RNA probe must compete with endogenous RNAs still bound to the extracted proteins, the detection of complexes by the exogenously added probe can be influenced by the ratio of probe to extract. We thus performed UVCL over a wide range of protein concentrations (10–350 µg) using a fixed amount of labeled probe. Over this range, we detected the same three RNP complexes (Fig. 3B) with a peak in the intensity of the labeling at 200 µg of total protein.

To test the specificity of formation of each of the three RNP complexes, increasing amounts of specific competitor or nonspecific competitor RNA (15–350-fold molar excess over labeled probe) were added to the UVCL reactions. Increasing the amount of specific competitor RNA (non-radioactive X3S RNA) markedly reduced the signal from the three RNP complexes starting with a 75-fold molar excess (Fig. 3C, lanes 2–5), whereas addition of nonspecific competitor RNA over this range had very little effect (Fig. 3C, lanes 6–9). These results demonstrated that the 94-, 70-, and 47-kDa RNP complexes are formed by specific interactions between RNA-binding proteins in the brain and the Xenopus NF-M mRNA 3'-UTR.

Formation of the 47-kDa RNP Complex Is Developmentally Regulated in Xenopus—The formation of the three RNP complexes were studied in UVCL assays with the X3S probe at four developmental stages in Xenopus (stages 18, 29/30, and 37/38 and adult) that correlate with the changes in NF-M expression that accompany successive phases of axonal development (45). Stage 18 represents an early stage of neurite outgrowth before any NF-M is expressed. Stage 29/30 represents a stage when many axons are actively growing, but relatively few synapses have yet formed, and NF-M expression is low. Stage 37/38 represents a stage when tadpoles can swim. At this stage, although numerous functional synapses have formed, relatively few axons are myelinated, axon caliber remains small, and levels of NF-M expression are moderate. The adult represents the stage when axons are fully myelinated, axonal caliber is expanded, and NF-M expression is at its peak.

Formation of the RNP complexes varied during development. Whereas the 94- and 70-kDa RNP complexes were observed at all stages (Fig. 4), the 47-kDa complex was observed only in the adult (Fig. 4, lane 4). An additional 98-kDa RNP complex (Fig. 4, lanes 1–3, white arrowhead) was observed only in larval and tadpole stages (stages 18–37/38) but was absent in the adult. Thus, formation of the 47-kDa complex appeared to be adult-specific, whereas the 98-kDa complex was specific to the developing animal.



View larger version (72K):
[in this window]
[in a new window]
  		FIG. 4.
NF-M 3'-UTR RNP complexes are developmentally regulated. UVCL assay of labeled X3S RNA probe with protein extracts made from adult Xenopus brain (A) and Xenopus embryos from developmental stages 18, 29/30, and 37/38. The asterisk represents the approximate time when NF-M expression begins. Filled arrowheads point to the three RNA-protein complexes (94, 70, and 47 kDa). Whereas the 47-kDa complex is specific to adult brain extract, the 98-kDa complex (open arrowhead) is specific to embryonic extracts.

 
NF-M mRNA 3'-UTR Forms Similar RNP Complexes in Xenopus, Rat, and Mouse—The high degree of sequence conservation among vertebrate NF-M 3'-UTRs suggests that the proteins that bind to them are likely to be conserved as well. To test this prediction, we performed UVCL assays with the Xenopus X3S and rat R3S probes using cytosolic extracts from adult rat and mouse brains. With these extracts, the Xenopus X3S probe formed 94-, 70-, and 47-kDa RNP complexes (Fig. 5A, lanes 3 and 4) that were indistinguishable in size from those formed using Xenopus extracts (Fig. 5A, lane 1). An additional 56-kDa RNP complex also formed (Fig. 5A, lanes 3 and 4) with rat and mouse extracts that was missing in frog. In reciprocal assays, the rat R3S probe formed the same RNP complexes (Fig. 5A, lanes 2 and 5) as the Xenopus X3S probe did with all the brain extracts.



View larger version (89K):
[in this window]
[in a new window]
  		FIG. 5.
Similar RNP complexes form with NF-M 3'-UTR and proteins from adult Xenopus, rat, and mouse brain extracts. A, the Xenopus NF-M 3'-UTR (X3S RNA probe, lanes marked +) and rat NF-M 3'-UTR (R3S RNA probe, lanes marked +) form 94-, 70-, and 47-kDa (filled arrowheads) complexes in UVCL assays with brain extracts from adult Xenopus (X), rat (R), and mouse (M). An additional 56-kDa (open arrowhead) complex forms in rat and mouse. B, UVCL assay of the X3S RNA probe with adult rat brain extract in the absence of competitor RNA (NC) or in the presence of increasing amounts (open triangles; 15-, 75-, 150-, and 350-fold molar excesses) of specific competitor RNA (non-radioactive X3S RNA) and nonspecific competitor RNA (non-radioactive GFP RNA). The 94-, 70-, and 47-kDa complexes were relatively resistant to nonspecific competitor as compared with specific competitor, indicating specific binding. In contrast, the 56-kDa complex was equally sensitive to specific and nonspecific competitors, indicating binding at much lower affinity.

 
In competition experiments, increasing the specific competitor (Fig. 5B, lanes 2–5) reduced formation of the 94-, 70-, and 47-kDa complexes more readily than did the nonspecific competitor (Fig. 5B, lanes 6–9), whereas it reduced the 56-kDa complex at nearly the same rate (Fig. 5B, white arrowhead). Thus, the 94-, 70-, and 47-kDa RNP complexes appear to form with higher affinity than the 56-kDa complex. These results demonstrated that proteins in rat and mouse brain can form similar RNP complexes with the frog and rat NF-M 3'-UTRs.

KH Domain RNA-binding Proteins Bind the NF-M mRNA 3'-UTR—To identify specific proteins that bind the 3'-UTR of NF-M, we combined mass spectrometry with purification of RNA-binding proteins using an RNA affinity substrate (46, 47). Because the protein data bases for rodent are more complete than for Xenopus, we purified proteins from rat rather than frog. We chose the rat over mouse because the larger brain of the rat would provide more starting material. This approach is justified by the conservation of the frog and rat NF-M 3'-UTR sequences as well as by the similarity of the UVCL results.

As the affinity substrate, we used in vitro transcribed X3S RNA attached to paramagnetic streptavidin beads via an intervening 3'-biotinylated oligo that was complementary to the 5' end of the X3S transcript. This method of attaching the RNA to the beads would permit RNP complexes to be eluted gently by melting the oligo/RNA hybrid at 40 °C with reduced salt. This approach greatly reduced the background contamination from other proteins binding nonspecifically to the beads. The specifically bound proteins (Fig. 6A, lane E) were distinguished from the nonspecific ones by preabsorbing the protein extracts with beads lacking RNA and then comparing on SDS-polyacrylamide gels the eluate from the RNA-beads (Fig. 6A, lane E) with that from beads lacking RNA (Fig. 6A, lane BO). Three bands, with apparent molecular masses of 70, 66 and 43 kDa, were eluted specifically in sufficient quantity for mass spectrometry. A fourth specific band (90 kDa), which was a good candidate for the 94-kDa RNP complex, was visible on silver-stained gels (not shown) but in quantities too small for mass spectrometry.



View larger version (33K):
[in this window]
[in a new window]
  		FIG. 6.
SDS-PAGE of affinity-purified proteins from rat brain for identification by mass spectrometry. A, proteins were purified from 12 mg of adult rat brain extract using X3S RNA as described in the text. BO, eluate from the bead only control, which had no X3S RNA attached to the beads. E, eluate from magnetic streptavidin beads conjugated to X3S RNA. Arrows point to three affinity-purified protein bands (apparent molecular masses of 70, 66, and 43 kDa) that were present in the E fraction but absent in the BO fraction. These were used for protein identification by mass spectrometry. B, eluates E (eluate from magnetic streptavidin beads conjugated to X3S RNA) and BO (eluate from the bead only control) were transferred to nitrocellulose membrane and probed with anti-hnRNPE1 and E2 antibody to demonstrate the presence of both hnRNP E1 and hnRNP E2 in the 43-kDa affinity-purified band.

 
The other three bands yielded peptides (Table I) with MS/MS spectra that led to the unambiguous identification of these proteins as known KH domain RNA-binding proteins. The 70- and 66-kDa bands shared four identical peptides found in hnRNP K, and the 66-kDa band yielded an additional peptide also from hnRNP K. Thus, these proteins most likely represent isoforms of hnRNP K. The 43-kDa band yielded six peptides. Three of these were unique to hnRNP E2 (also known as PCBP2 or {alpha}CP2); two were unique to hnRNP E1 (also known as PCBP1 or {alpha}CP1); and another was common to both.


View this table:
[in this window]
[in a new window]
  		TABLE I
Identification of NF-M 3'-UTR-binding proteins by mass spectrometry

 
Immunoblotting of the affinity-purified proteins (Fig. 6B) probed with the anti-hnRNP E1 and E2 antibody confirmed that the 43-kDa band contained both hnRNP E1 and hnRNP E2. Thus, we concluded that the 43-kDa band is a mixture of these two closely related proteins. Their size made them a good candidate for either the 47- or the 56-kDa UVCL RNP complex or both. A similar immunoblot probed with anti-hnRNP K also confirmed that the 70- and 66-kDa bands were hnRNP K (data not shown). Because of their size, we predicted they would correspond to the 70-kDa UVCL RNP complex. These predictions were confirmed by further Western blot and immunoprecipitation assays.

The 70-, 56-, and 47-kDa RNP Complexes Observed in UVCL Experiments Are Formed by hnRNP K, hnRNP E2, and hnRNP E1, Respectively—To test whether hnRNP K and the hnRNP Es were indeed the proteins involved in the formation of the 70-, 56-, and 47-kDa RNP UVCL complexes, we performed Western blots and immunoprecipitation experiments with UVCL RNP complexes formed between rat brain extracts and the X3S probe. The experiments were done with rat extracts because none of our antibodies cross-reacted with Xenopus (data not shown). Western blots of UVCL reactions between rat brain and the X3S probe were probed with anti-hnRNP E1 and E2 (Fig. 7A, lane 2), anti-hnRNP E1 (Fig. 7A, lane 3), anti-hnRNP E2 (Fig. 7A, lane 4), and anti-hnRNP K (Fig. 7A, lane 5). The immunoblot was then overlaid with x-ray film to reveal the positions of the radiolabeled UVCL bands (e.g. lane 1) relative to those that reacted with each of the antibodies (lanes 2–5). The 70-, 56-, and 47-kDa radiolabeled bands overlaid precisely on those that reacted with the antibodies to hnRNPs K, E2, and E1, respectively. The identities of these RNP complexes were further confirmed by immunoprecipitating the UVCL reactions with the hnRNP K and the hnRNP E1 and E2 antibodies. As expected, the 70-kDa complex was specifically immunoprecipitated by anti-hnRNP K (Fig. 7B, lane 3), and the 56- and 47-kDa complexes were specifically immunoprecipitated by anti-hnRNP E1 and E2 (Fig. 7B, lane 2).



View larger version (80K):
[in this window]
[in a new window]
  		FIG. 7.
The 70-, 56-, and 47-kDa RNP complexes are formed by hnRNP K, hnRNP E2, and hnRNP E1 respectively. A, UV crosslinked RNP complexes (lane 1) were transferred to nitrocellulose membrane and probed with anti-hnRNP E1 and E2 (lane 2), anti-hnRNP E1 (lane 3), anti-hnRNP E2 (lane 4), and anti-hnRNP K (lane 5). The arrowheads on the left side point to the 70-, 56-, and 47-kDa UV cross-linked RNP complexes, and the arrowheads on the right side point to the bands observed on the immunoblots. B, UV cross-linked RNP complexes (lane 1) were immunoprecipitated with anti-hnRNP E1 and E2 (lane 2) or anti-hnRNP K (lane 3) and separated on an 8% SDS-polyacrylamide gel. The arrowheads on the left side point to the 70-, 56-, and 47-kDa UV cross-linked RNP complexes, and the arrowheads on the right side point to the immunoprecipitated UV cross-linked RNP complexes. The control reaction with no antibody is shown in lane 4.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
The 3'-UTRs of vertebrate NF-Ms are strikingly well conserved from fish to mammal (23, 24). Such ancient highly conserved sequences occur within the 3'-UTRs of cytoskeletal mRNAs about 10 times more frequently than they do in those of enzymes, hormones, and hormone receptors (24), suggesting that 3'-UTRs play an especially important role in post-transcriptional regulation of cytoskeletal genes such as NF-M. In this study, we demonstrated that not only are the NF-M 3'-UTR sequences conserved but so are the RNP complexes that they form. Three conserved RNP complexes (94, 70, and 47 kDa) were found in UVCL assays using various reciprocal combinations of rat and frog NF-M 3'-UTRs with brain extracts from different species. In rat, two of these conserved complexes contained the KH domain, poly(C)-sensitive RNA-binding proteins, hnRNP K (70-kDa complex), and hnRNP E1 (47-kDa complex). An additional 56-kDa complex that was present only in rodent proved to be hnRNP E2. Although these proteins are well known outside the nervous system, ours is the first report of their binding a specifically neuronal target RNA. In Xenopus, 47-kDa complex formation was restricted to adult brain, implicating hnRNP E in a novel role of regulating expression of a neuron-specific gene during axonal maturation.

The identification of hnRNPs K and E1/E2 is supported by the presence within the NF-M 3'-UTR of sequences known to bind these proteins. In humans, CCUCC is the consensus binding sequence for hnRNP E (17, 40, 42). In NF-M, this sequence is within a CCCUCCC motif, which also matches the binding site for hnRNP E within RNAs of the androgen receptor (42), renin (43), tyrosine hydroxylase (41, 44, 48), and erythropoietin (44). This motif in NF-M is further nested within a longer motif similar to the 15-lipoxygenase differentiation control element, which is recognized by both hnRNP E and hnRNP K (49, 50). A 15-lipoxygenase differentiation control element sequence also serves as the minimal binding element for binding of hnRNPs E1 and E2 to {alpha}-globin RNA (40). Thus, this region (underlined by a dotted line in Fig. 1) represents the most likely site for the binding of both hnRNP E and hnRNP K. That these sites overlap further suggests these proteins may bind either as a complex or bind differentially to NF-M RNA in different populations of neurons.

Although poly(C)-sensitive RNP complexes form with NF-L and NF-H mRNAs (21), our finding of such complexes with NF-M was at first unexpected because of the two earlier studies that had pointed to ARE proteins as the most likely candidates (21, 22). We, on the other hand, found no hint of ARE proteins in the mass spectrometry analysis of our affinity-purified proteins, even though the masses of the hnRNP Es are comparable to those of HuB and several other ARE proteins. One possibility is that the absence of ARE proteins in our study was due to differences in our NF-M 3'-UTR probes. Both earlier studies used a full-length 3'-UTR, including AU-rich sequences at the poly(A) signal, which Antic et al. (22) found was essential for HuB binding. In making our probe, we deleted the poly(A) signal to avoid detecting and purifying proteins that bind ubiquitously to the poly(A) region of RNAs. By doing so, we may have removed nucleotides essential for the binding of ARE proteins while keeping the poly(C) elements intact. Interestingly many ARE proteins bind to destabilize RNAs (51), whereas binding of hnRNPs K and E tend to stabilize them. Thus, in identifying poly(C)-binding proteins we may have also uncovered the other side of the coin of regulating NF-M mRNA stability.

In the rat, immunoprecipitation and Western blots with well characterized antibodies unambiguously confirmed the mass spectrometry data. Unfortunately, because these antibodies failed to cross-react in Xenopus, similar confirmation was not possible in frog. Nevertheless the reciprocal formation of comigrating complexes in rat and frog argues strongly that the complexes in these two species contain homologous proteins. From cDNA cloning, we know that homologs of both hnRNPs E (52) and K (53) exist in Xenopus, although the precise nature of the expression of their various forms still needs to be characterized more fully. Thus, we feel safe in referring to these proteins in Xenopus as hnRNP K and E homologs.

Both hnRNP K and the hnRNP Es are well known regulators of the stability and translation of cytoplasmic mRNAs in a wide range of non-neuronal cell types (50, 54, 55). The precise role these proteins play in any one instance, however, varies with context, meaning that the same protein can have different effects on several RNAs in the same cell or on the same RNA in response to varying extracellular signals. In one model, hnRNP K acts as a docking platform on the RNA to interact with molecules from various signaling pathways (54). hnRNP K can also interact with hnRNP E. For example, they, together with YB-1, bind the renin mRNA 3'-UTR to regulate its stability (56). Other mRNAs whose stability is regulated by hnRNPs E1 and E2 include those of {alpha}-globin (57, 58), {alpha}1(I) collagen (59, 60), tyrosine hydroxylase (61), and the androgen receptor in testis (42). hnRNP Es can also help regulate mRNA stability through interactions with other proteins binding elsewhere along the mRNA. For example, in the stabilization of {alpha}1(I) collagen mRNA (60), hnRNP E binding the 3'-UTR interacts both with poly(A)-binding protein to prevent loading of the degradosome and with an unidentified factor bound to the 5'-UTR to circularize the mRNA. This latter interaction would both protect the RNA from degradation and increase translation. Alternatively hnRNP K and hnRNP E1 can also silence translation, as in the case of the 15-lipoxygenase mRNA, where they bind a CU-rich differentiation control element within the 3'-UTR (49). Because these same proteins can play multiple roles, how they regulate NF-M expression remains an important unanswered question.

Answering this question will require learning when and where in the nervous system these proteins bind NF-M mRNA endogenously. In rat cortex, both hnRNPs E1 and E2 are expressed in neurons but not in astrocytes (25), demonstrating that the expression of both hnRNP Es, like that of NF-M, is neuronal. Within neurons, however, hnRNPs E1 and E2 likely play separate physiological roles since they respond differentially to extracellular signals. For example, in the cortical response to hypoxia and ischemia, hnRNP E1 expression increases via the activation of p38 mitogen-activated protein kinase, whereas that of hnRNP E2 decreases via activation of protein kinase C. In Drosophila, the hnRNP E homolog mushroom body expressed (mbe) is found preferentially in mushroom body neurons and is one of the first genes expressed during neural differentiation (62). Its overexpression protects transgenic flies from the neurodegenerative effects of expressing human ataxin-1 (63). This connection between hnRNP E and neuronal injury may be relevant for NF-M since its expression also changes dramatically in response to injury both in frog (64) and in mammal (65). In rat, these changes reflect alterations in the stability of NF-M mRNA (10, 66).

The possibility that a hnRNP E might help to stabilize NF-M mRNA is also suggested by our observation that formation of the 47-kDa RNP complex in frog is restricted to mature brain extracts since NF-M mRNA stability increases as neurons mature (9, 10). The inability of exogenous NF-M 3'-UTR to bind hnRNP E in embryos may be due either to the relatively lower levels of hnRNP E expression in young embryos than in older animals (52) or possibly to phosphorylation of hnRNP E, which would inhibit binding (67). The presence in embryos of a 98-kDa complex that is missing in adult suggests that other RNA-binding proteins may be involved in regulating NF-M as well. Characterization of how the endogenous NF-M messenger RNP complexes change and influence NF-M expression will be essential for providing insights into the role of these RNA-binding proteins in neuronal development.

One possibility is that these RNA-binding proteins may provide a means for neurons to coordinate expression among the various nIF subunits in response to extracellular signals. All nIF 3'-UTRs contain pyrimidine-rich sequences, and many of these match the consensus sequence for binding hnRNPs E and K.2 Thus, these proteins might be recruited to other nIF mRNAs as well. Variations among nIF 3'-UTRs outside the similar pyrimidine-rich areas might conceivably alter the partners that these proteins interact with, individualizing the response of each nIF to the same extracellular signals. This could be important for balancing the changes in nIF subunit stoichiometry that occur during axonal outgrowth and in trauma (5, 64, 68, 69), many of which are regulated post-transcriptionally (5, 9, 10, 69, 70). The composition of endogenous messenger RNP complexes changes with the physiological state of many cells (71), and KH domain proteins complexing with nIF mRNAs might represent one such dynamic set of complexes. Two other KH domain proteins, Nova and the fragile X mental retardation protein, participate in mRNA-regulatory networks to coordinate gene expression in the nervous system (72, 73). Our study documents potential interactions between additional members of the KH domain family and a specific neuronal target message that might participate in a regulatory network involved in axonal outgrowth and maturation. Further studies to test this model would provide valuable insights not only into the mechanisms regulating nIF subunit expression in development and disease but also into how these KH domain proteins might integrate multiple signaling pathways to regulate expression of functionally related genes.


   FOOTNOTES
 
* This work was supported by the National Science Foundation. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

{ddagger} To whom correspondence should be addressed: Dept. of Biological Sciences, University at Albany, SUNY, 1400 Washington Ave., Albany, NY 12222. Tel.: 518-442-4364; Fax: 518-442-4767; E-mail: bgs86{at}cnsunix.albany.edu.

1 The abbreviations used are: NF, neurofilament; NF-M, middle molecular mass neurofilament protein; NF-L, low molecular mass neurofilament protein; NF-H, high molecular mass neurofilament protein; nIF, neuronal intermediate filament; UTR, untranslated region; GEF, guanine exchange factor; EMSA, electrophoretic mobility shift assay; RNP, ribonucleoprotein; ARE, AU-rich element; KH, K homology; IBC, Incubation Buffer C; GFP, green fluorescent protein; UVCL, ultraviolet cross-linking; hnRNP, heterogeneous nuclear ribonucleoprotein; MS/MS, tandem mass spectrometry; LC-Q-TOF, liquid chromatographyquadrupole time-of-flight. Back

2 A. Thyagarajan and B. G. Szaro, unpublished data. Back


   ACKNOWLEDGMENTS
 
We thank Dr. Raul Andino (University of California, San Francisco) for antibodies against hnRNP E and Qishan Lin (Center for Functional Genomics, University at Albany) for help with the mass spectrometry. We also thank Drs. Cheryl Frye, Christine Wagner, and Princy Quadros (University at Albany) for help in obtaining tissue from mouse and rat brain and Dr. Christine Gervasi (University at Albany) for help with Xenopus embryos. We thank Dr. Richard Zitomer (University at Albany) for providing access to essential equipment. Drs. Suzannah Tieman, John Schmidt, and Scott Tenenbaum (University at Albany) provided helpful comments on the manuscript.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Julien, J. P. (1999) Curr. Opin. Neurobiol. 9, 554–560[CrossRef][Medline] [Order article via Infotrieve]
  2. Helfand, B. T., Mendez, M. G., Pugh, J., Delsert, C., and Goldman, R. D. (2003) Mol. Biol. Cell 14, 5069–5081[Abstract/Free Full Text]
  3. Walker, K. L., Yoo, H. K., Undamatla, J., and Szaro, B. G. (2001) J. Neurosci. 21, 9655–9666[Abstract/Free Full Text]
  4. Benson, D. L., Mandell, J. W., Shaw, G., and Banker, G. (1996) J. Neurocytol. 25, 181–196[CrossRef][Medline] [Order article via Infotrieve]
  5. Schlaepfer, W. W., and Bruce, J. (1990) J. Neurosci. Res. 25, 39–49[CrossRef][Medline] [Order article via Infotrieve]
  6. Muma, N. A., Slunt, H. H., and Hoffman, P. N. (1991) J. Neurocytol. 20, 844–854[CrossRef][Medline] [Order article via Infotrieve]
  7. Garcia, M. L., Lobsiger, C. S., Shah, S. B., Deerinck, T. J., Crum, J., Young, D., Ward, C. M., Crawford, T. O., Gotow, T., Uchiyama, Y., Ellisman, M. H., Calcutt, N. A., and Cleveland, D. W. (2003) J. Cell Biol. 163, 1011–1020[Abstract/Free Full Text]
  8. Rao, M. V., Campbell, J., Yuan, A., Kumar, A., Gotow, T., Uchiyama, Y., and Nixon, R. A. (2003) J. Cell Biol. 163, 1021–1031[Abstract/Free Full Text]
  9. Moskowitz, P. F., and Oblinger, M. M. (1995) Mol. Brain Res. 30, 211–222[Medline] [Order article via Infotrieve]
  10. Schwartz, M. L., Shneidman, P. S., Bruce, J., and Schlaepfer, W. W. (1994) Mol. Brain Res. 27, 215–220[Medline] [Order article via Infotrieve]
  11. Weiner, O., Zorn, D., Kreig, A., and Bittner, G. D. (1996) Neurosci. Lett. 213, 83–86[CrossRef][Medline] [Order article via Infotrieve]
  12. Sotelo-Silveira, J. R., Calliari, A., Kun, K., Benech, J. C., Sanguinetti, C., Chalar, C., and Sotelo, J. R. (2000) J. Neurosci. Res. 62, 65–74[CrossRef][Medline] [Order article via Infotrieve]
  13. Lee, S. K., and Hollenbeck, P. J. (2003) J. Cell Sci. 116, 4467–4478[Abstract/Free Full Text]
  14. Ge, W. W., Leystra-Lantz, C., Wen, W., and Strong, M. J. (2003) J. Biol. Chem. 278, 26558–26563[Abstract/Free Full Text]
  15. Wickens, M., Anderson, P., and Jackson, R. J. (1997) Curr. Opin. Genet. Dev. 7, 220–232[CrossRef][Medline] [Order article via Infotrieve]
  16. Wickens, M. (1993) Nature 363, 305–306[CrossRef][Medline] [Order article via Infotrieve]
  17. Wang, X., and Liebhaber, S. A. (1996) EMBO J. 15, 5040–5051[Medline] [Order article via Infotrieve]
  18. Canete-Soler, R., Schwartz, M. L., Hua, Y., and Schlaepfer, W. W. (1998) J. Biol. Chem. 273, 12655–12661[Abstract/Free Full Text]
  19. Canete-Soler, R., Schwartz, M. L., Hua, Y., and Schlaepfer, W. W. (1998) J. Biol. Chem. 273, 12650–12654[Abstract/Free Full Text]
  20. Canete-Soler, R., Wu, J., Zhai, J., Shamim, M., and Schlaepfer, W. W. (2001) J. Biol. Chem. 276, 32046–32050[Abstract/Free Full Text]
  21. Canete-Soler, R., and Schlaepfer, W. W. (2000) Brain Res. 867, 265–279[CrossRef][Medline] [Order article via Infotrieve]
  22. Antic, D., Lu, N., and Keene, J. D. (1999) Genes Dev. 13, 449–461[Abstract/Free Full Text]
  23. Roosa, J. R., Gervasi, C., and Szaro, B. G. (2000) Mol. Brain Res. 82, 35–51[Medline] [Order article via Infotrieve]
  24. Duret, L., Dorkeld, F., and Gautier, C. (1993) Nucleic Acids Res. 21, 2315–2322[Abstract/Free Full Text]
  25. Zhu, Y., Sun, Y., Mao, X. O., Jin, K. L., and Greenberg, D. A. (2002) Neuroscience 110, 191–198[CrossRef][Medline] [Order article via Infotrieve]
  26. Frohman, M. A., Dush, M. K., and Martin, G. R. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 8998–9002[Abstract/Free Full Text]
  27. Gervasi, C., and Szaro, B. G. (1997) Mol. Brain Res. 48, 229–242[Medline] [Order article via Infotrieve]
  28. Thompson, J. D., Gibson, T. J., Plewniak, F., Jeanmougin, F., and Higgins, D. G. (1997) Nucleic Acids Res. 24, 4876–4882
  29. Hall, T. A. (1999) Nucleic Acids Symp. Ser. 41, 95–98
  30. Davis, L. G., Kuehl, W. M., and Battey, J. F. (1994) Basic Methods in Molecular Biology, Appleton and Lange, Norwalk, CT
  31. Nieuwkoop, P., and Faber, J. (1956) Normal Table of Xenopus laevis (Daudin) pp. 162–188, North Holland Publishing Co., Amsterdam
  32. Smith, C. W. J. (1998) RNA:Protein Interactions, pp. 109–135, Oxford University Press, Oxford
  33. Hartley, R., Meuth-Metzinger, V., and Osborne, H. B. (2002) BMC Mol. Biol. 3, 8[Medline] [Order article via Infotrieve]
  34. Neville, D. M., Jr. (1971) J. Biol. Chem. 246, 6328–6334[Abstract/Free Full Text]
  35. Sauve, D. M., Ho, D. T., and Roberge, M. (1995) Anal. Biochem. 226, 382–383[CrossRef][Medline] [Order article via Infotrieve]
  36. Brown, R. E., Jarvis, K. L., and Hyland, K. J. (1989) Anal. Biochem. 180, 136–139[CrossRef][Medline] [Order article via Infotrieve]
  37. Towbin, H., Staehelin, T., and Gordon, J. (1979) Proc. Natl. Acad. Sci. U. S. A. 76, 4350–4354[Abstract/Free Full Text]
  38. Zhao, Y., and Szaro, B. G. (1994) J. Comp. Neurol. 343, 158–172[CrossRef][Medline] [Order article via Infotrieve]
  39. Gamarnik, A. V., and Andino, R. (1997) RNA 3, 882–892[Abstract]
  40. Holcik, M., and Liebhaber, S. A. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 2410–2414[Abstract/Free Full Text]
  41. Paulding, W. R., and Czyzyk-Krzeska, M. F. (1999) J. Biol. Chem. 274, 2532–2538[Abstract/Free Full Text]
  42. Yeap, B. B., Voon, D. C., Vivian, J. P., McCulloch, R. K., Thomson, A. M., Giles, K. M., Czyzyk-Krzeska, M. F., Furneaux, H., Wilce, M. C., Wilce, J. A., and Leedman, P. J. (2002) J. Biol. Chem. 277, 27183–27192[Abstract/Free Full Text]
  43. Adams, D. J., Beveridge, D. J., van der Weyden, L., Mangs, H., Leedman, P. J., and Morris, B. J. (2003) J. Biol. Chem. 278, 44894–44903[Abstract/Free Full Text]
  44. Czyzyk-Krzeska, M. F., and Bendixen, A. C. (1999) Blood 93, 2111–2120[Abstract/Free Full Text]
  45. Szaro, B. G., Lee, V. M., and Gainer, H. (1989) Dev. Brain Res. 48, 87–103[CrossRef][Medline] [Order article via Infotrieve]
  46. Ritchie, S. A., Pasha, M. K., Batten, D. J., Sharma, R. K., Olson, D. J., Ross, A. R., and Bonham, K. (2003) Nucleic Acids Res. 31, 1502–1513[Abstract/Free Full Text]
  47. Blaxall, B. C., Pellett, A. C., Wu, S. C., Pende, A., and Port, J. D. (2000) J. Biol. Chem. 275, 4290–4297[Abstract/Free Full Text]
  48. Paulding, W. R., and Czyzyk-Krzeska, M. F. (2000) Adv. Exp. Med. Biol. 475, 111–121[Medline] [Order article via Infotrieve]
  49. Ostareck, D. H., Ostareck-Lederer, A., Wilm, M., Thiele, B. J., Mann, M., and Hentze, M. W. (1997) Cell 89, 597–606[CrossRef][Medline] [Order article via Infotrieve]
  50. Ostareck-Lederer, A., Ostareck, D. H., and Hentze, M. W. (1998) Trends Biochem. Sci. 23, 409–411[CrossRef][Medline] [Order article via Infotrieve]
  51. Peng, S. S., Chen, C. Y., and Shyu, A. B. (1996) Mol. Cell. Biol. 16, 1490–1499[Abstract]
  52. Gravina, P., Campioni, N., Loreni, F., Pierandrei-Amaldi, P., and Cardinali, B. (2002) Gene (Amst.) 290, 193–201[Medline] [Order article via Infotrieve]
  53. Siomi, H., Matunis, M. J., Michael, W. M., and Dreyfuss, G. (1993) Nucleic Acids Res. 21, 1193–1198[Abstract/Free Full Text]
  54. Bomsztyk, K., Denisenko, O., and Ostrowski, J. (2004) Bioessays 26, 629–638[CrossRef][Medline] [Order article via Infotrieve]
  55. Makeyev, A. V., and Liebhaber, S. A. (2002) RNA 8, 265–278[Abstract]
  56. Skalweit, A., Doller, A., Huth, A., Kahne, T., Persson, P. B., and Thiele, B. J. (2003) Circ. Res. 92, 419–427[Abstract/Free Full Text]
  57. Weiss, I. M., and Liebhaber, S. A. (1995) Mol. Cell. Biol. 15, 2457–2465[Abstract]
  58. Weiss, I. M., and Liebhaber, S. A. (1994) Mol. Cell. Biol. 14, 8123–8132[Abstract/Free Full Text]
  59. Stefanovic, B., Hellerbrand, C., Holcik, M., Briendl, M., Liebhaber, S. A., and Brenner, D. A. (1997) Mol. Cell. Biol. 17, 5201–5209[Abstract]
  60. Lindquist, J. N., Parsons, C. J., Stefanovic, B., and Brenner, D. A. (2004) J. Biol. Chem. 279, 23822–23829[Abstract/Free Full Text]
  61. Czyzyk-Krzeska, M. F., and Beresh, J. E. (1996) J. Biol. Chem. 271, 3293–3299[Abstract/Free Full Text]
  62. Brody, T., Stivers, C., Nagle, J., and Odenwald, W. F. (2002) Mech. Dev. 113, 41–59[CrossRef][Medline] [Order article via Infotrieve]
  63. Fernandez-Funez, P., Nino-Rosales, M. L., de Gouyon, B., She, W. C., Luchak, J. M., Martinez, P., Turiegano, E., Benito, J., Capovilla, M., Skinner, P. J., McCall, A., Canal, I., Orr, H. T., Zoghbi, H. Y., and Botas, J. (2000) Nature 408, 101–106[CrossRef][Medline] [Order article via Infotrieve]
  64. Gervasi, C., Thyagarajan, A., and Szaro, B. G. (2003) J. Comp. Neurol. 461, 262–275[CrossRef][Medline] [Order article via Infotrieve]
  65. Goldstein, M. E., Weiss, S. R., Lazzarini, R. A., Shneidman, P. S., Lees, J. F., and Schlaepfer, W. W. (1988) Brain Res. 427, 287–291[Medline] [Order article via Infotrieve]
  66. Schwartz, M. L., Shneidman, P. S., Bruce, J., and Schlaepfer, W. W. (1990) J. Neurosci. Res. 27, 193–201[CrossRef][Medline] [Order article via Infotrieve]
  67. Leffers, H., Dejgaard, K., and Celis, J. E. (1995) Eur. J. Biochem. 230, 447–453[Medline] [Order article via Infotrieve]
  68. Zhao, Y., and Szaro, B. G. (1995) J. Neurosci. 15, 4629–4640[Abstract]
  69. Wong, J., and Oblinger, M. M. (1990) J. Neurosci. Res. 27, 332–341[CrossRef][Medline] [Order article via Infotrieve]
  70. Tesser, P., Jones, P. S., and Schecter, N. (1986) J. Neurochem. 47, 1235–1243[Medline] [Order article via Infotrieve]
  71. Keene, J. D., and Tenenbaum, S. A. (2002) Mol. Cell 9, 1161–1167[CrossRef][Medline] [Order article via Infotrieve]
  72. Ule, J., Jensen, K. B., Ruggiu, M., Mele, A., Ule, A., and Darnell, R. B. (2003) Science 302, 1212–1215[Abstract/Free Full Text]
  73. Brown, V., Jin, P., Ceman, S., Darnell, J. C., O'Donnell, W. T., Tenenbaum, S. A., Jin, X., Feng, Y., Wilkinson, K. D., Keene, J. D., Darnell, R. B., and Warren, S. T. (2001) Cell 107, 477–487[CrossRef][Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 DevelopmentHome page
Y. Liu, C. Gervasi, and B. G. Szaro
A crucial role for hnRNP K in axon development in Xenopus laevis
Development, September 15, 2008; 135(18): 3125 - 3135.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Biol. CellHome page
P.-T. Lee, P.-C. Liao, W.-C. Chang, and J. T. Tseng
Epidermal Growth Factor Increases the Interaction between Nucleolin and Heterogeneous Nuclear Ribonucleoprotein K/Poly(C) Binding Protein 1 Complex to Regulate the Gastrin mRNA Turnover
Mol. Biol. Cell, December 1, 2007; 18(12): 5004 - 5013.
[Abstract] [Full Text] [PDF]

Home page
 DNA ResHome page
N. Okazaki, K. Imai, R. F. Kikuno, K. Misawa, M. Kawai, S. Inamoto, R. Ohara, T. Nagase, O. Ohara, and H. Koga
Influence of the 3'-UTR-length of mKIAA cDNAs and their Sequence Features to the mRNA Expression Level in the Brain
DNA Res, January 1, 2005; 12(3): 181 - 189.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
279/48/49680    most recent
M408915200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Thyagarajan, A.
Right arrow Articles by Szaro, B. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Thyagarajan, A.
Right arrow Articles by Szaro, B. G.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2004 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement