|
Advertisement | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
J. Biol. Chem., Vol. 279, Issue 50, 51775-51782, December 10, 2004
Human P-selectin Glycoprotein Ligand-1 (PSGL-1) Interacts with the Skin-associated Chemokine CCL27 via Sulfated Tyrosines at the PSGL-1 Amino Terminus*![]() ¶![]() ![]() ![]() ![]() ![]()
From the
Received for publication, August 27, 2004 , and in revised form, October 5, 2004.
P-selectin glycoprotein ligand-1 (PSGL-1), a sialomucin expressed on leukocytes, is a major ligand for P-selectin and mediates leukocyte rolling on the endothelium. Here we show that human PSGL-1 interacts with CCL27 (CTACK/ILC/ESkine), a skin-associated chemokine that attracts skin-homing T lymphocytes. A recombinant soluble form of PSGL-1 (rPSGL-Ig) preferentially bound CCL27 among several chemokines tested. This interaction was abrogated by arylsulfatase treatment of rPSGL-Ig, suggesting that sulfated tyrosines play a critical role. In contrast, removal of either N-glycans or O-glycans by glycosidase treatment of rPSGL-Ig did not affect the interaction. The binding of CCL27 to a recombinant PSGL-1 synthesized in the presence of a sulfation inhibitor was lower than that produced in normal medium. Moreover, mutation of the tyrosines at the amino terminus of PSGL-1 to phenylalanine abolished the binding, further supporting the role of sulfated tyrosines in the CCL27-PSGL-1 interaction. Functionally, rPSGL-Ig reduced the chemotaxis of L1.2 cells expressing CCR10, the receptor for CCL27. In addition, the expression of human PSGL-1 on CCR10-expressing L1.2 cells resulted in reduced chemotaxis to CCL27. These findings suggest a role for PSGL-1 in regulating chemokine-mediated responses, in addition to its role as a selectin ligand.
Leukocyte migration from the blood to tissues is initiated by transient and reversible interactions that capture leukocytes from flowing blood and allow them to roll on the surface of endothelial cells under blood flow. These interactions are primarily mediated by selectins, a family consisting of three cell adhesion molecules: L-selectin (CD62L), which is expressed on most leukocytes, and E-selectin (CD62E) and P-selectin (CD62P), which are expressed on activated vascular endothelium (1, 2). The rolling cells sense activating factors such as chemokines presented on the endothelium, which induce the activation of leukocyte integrins, leading to stable cell attachment and the subsequent transmigration of leukocytes into tissues (3).
P-selectin glycoprotein-1 (PSGL-11; CD162) has been identified as the major ligand for P-selectin on myeloid cells and subsets of activated T cells (4). PSGL-1 mediates P-selectin-mediated neutrophil rolling and migration in vivo (5) as well as T cell migration into inflamed skin (6, 7). Besides being a P-selectin ligand, PSGL-1 functions as a ligand for E-selectin and L-selectin in vivo (79). To bind selectins, PSGL-1 must be modified by specific core-2-type O-glycans containing the sialyl Lewisx (sLex) moiety, which is synthesized by multiple glycosyltransferases, including core 2
A recombinant PSGL-1 in a selectin-binding glycoform (rPSGL-Ig), consisting of the amino-terminal region of human PSGL-1 fused to the Fc portion of human IgG1, has been developed (12), and it has been shown to have anti-inflammatory effects in various models of inflammation (1619). Although the effects of rPSGL-Ig have been attributed to its ability to bind selectins, a recent report suggests that it has additional functions, including the ability to bind the murine chemokine KC (20). Chemokines regulate leukocyte traffic throughout the body during immune surveillance and inflammation. Chemokines presented on the endothelium induce the firm adhesion of rolling leukocytes through the activation of integrins. Chemokines also direct the migration of leukocytes into specific microenvironments within tissues. Recent data reveal that chemokines and their receptors play important roles in controlling the specificity of lymphocyte subsets for certain sites (21). In inflamed skin, the expression of several chemokines, including CCL17 (TARC) and CCL27 (CTACK/ILC/ESkine), is up-regulated (22, 23). CCL27 is expressed exclusively in the skin and attracts cutaneous lymphocyte-associated antigen-positive T cells (24), which express CCR10, the receptor for CCL27 (25, 26), indicating that CCL27 is a skin-associated chemokine that mediates T cell migration into the skin. Several chemokine receptors, such as CCR5, CCR2b, CX3CR1, and CXCR4, are modified in the amino-terminal region by tyrosine sulfation (2730). In addition, CCR5 is modified by O-glycosylation in the amino-terminal region, which, together with tyrosine sulfation, contributes to its high affinity binding to chemokines (31). Chemokines also bind sulfated glycosaminoglycans, such as heparan sulfate, that are thought to anchor the chemokine for recognition by a receptor-bearing cell, further suggesting the role of sulfation in chemokine binding (32, 33). It is well established that tyrosine sulfation and O-glycosylation are the post-translational modifications of PSGL-1 required for selectin binding. Based on the similar structural requirements of PSGL-1 and some chemokine receptors to bind their ligands with high affinity, we investigated the interaction of rPSGL-Ig with chemokines. Here we show that rPSGL-Ig preferentially bound CCL27, among the various chemokines examined. Our results show that sulfated tyrosines were critical for PSGL-1 binding to CCL27, whereas neither O-glycans nor N-glycans contributed to the binding. Moreover, rPSGL-Ig and cell surface-expressed PSGL-1 partially inhibited the chemotaxis of L1.2 cells expressing CCR10. Thus, in addition to its well characterized role as a selectin ligand, these results support a role for PSGL-1 in binding certain chemokines and thereby regulating cell responses to those chemokines.
ReagentsThe rPSGL-Ig was a kind gift from Wyeth Research (Cambridge, MA). It was developed by linking a truncated human PSGL-1 to the Fc portion of human IgG1 and produced in Chinese hamster ovary cells that had been engineered to express FucT-VII and C2GlcNAcT-I (19). Two hinge-proximal amino acids at positions 234 and 237 within the IgG1 Fc portion are mutated to alanine to reduce complement activation and Fc receptor binding. The chemokine-Fc chimeric protein CCL27-Fc and control Fc were prepared as described previously (34). Human chemokines CCL1 (I-309), CCL2 (MCP-1), CCL3 (MIP-1 ), CCL4 (MIP-1 ), CCL5 (RANTES), CCL7 (MCP-3), CCL8 (MCP-2), CXCL1 (GRO- ), CXCL4 (PF-4), CXCL5 (ENA-78), CXCL8 (IL-8), CXCL10 (IP-10), and CXCL12 (SDF-1 ) were purchased from Peprotech; CCL21 (SLC) was from DakoCytomation; and CCL27 and CCL28 (MEC) were from R & D Systems. CCL17, CCL18 (PARC), CCL19 (ELC), CCL20 (LARC), XCL1 (SCM-1 ), and XCL2 (SCM-1 ) were kindly provided by Shionogi (Osaka, Japan). Recombinant human P-selectin, E-selectin, biotinylated anti-P-selectin, biotinylated anti-CCL27, and biotinylated anti-CCL28 were purchased from R & D Systems; biotinylated anti-CCL21 was from DakoCytomation; peroxidase-conjugated anti-human IgG, peroxidase-conjugated anti-rabbit IgG, and peroxidase-conjugated anti-mouse IgG+M were from American Qualex; and peroxidase-conjugated streptavidin was from Zymed Laboratories Inc.. Polyclonal anti-PSGL-1 antibodies prepared using a synthetic peptide (QATEYEYLDYDFLPETEPP) based on residues 4260 of human PSGL-1 were kindly provided by Dr. Bruce Furie (Harvard Medical School, Boston, MA). The anti-PSGL-1 mAbs PL1 and KPL1 were purchased from Immunotech and BD Biosciences, respectively. CellsCOS-7 cells were maintained in Dulbecco's modified Eagle's medium containing 10% fetal calf serum (FCS). A mouse pre-B cell line L1.2 was kindly provided by Dr. Eugene Butcher (Stanford University, Stanford, CA) and maintained in RPMI 1640 containing 10% FCS. L1.2 cells expressing human CCR10 were maintained in RPMI 1640 containing 10% FCS and 0.8 mg/ml G418 (Sigma) (34). L1.2 cells coexpressing chemokine receptor and human PSGL-1 were maintained in RPMI 1640 containing 10% FCS, 0.8 mg/ml G418, and 20 µg/ml blasticidin (Invitrogen). Generation of Wild-type and Mutant hPSGL-Fc ProteinsTo generate the hPSGL-Fc and hPSGL-long-Fc constructs, a fragment corresponding to the first 47 amino acids or the entire extracellular domain of mature human PSGL-1 was amplified by PCR using the 5' primer CGGGAGCTAGCACAGGCCACCGAATATGAG and the 3' primer GTAGGATCCCTTGCAGCAGGCTCCACAGTG or CAGCGGATCCTGCTTCACAGAGATGTGGTC. The amplified fragment was digested with NheI and BamHI and ligated into the CD5 leader-IgG1 vector, provided by Dr. Brian Seed (Massachusetts General Hospital, Boston, MA), at the NheI and BamHI sites. To generate the hPSGL-Fc constructs with mutations in tyrosines, the following 5' primers (with the mutated nucleotides underlined) were used: FFF mutant, CGGGAGCTAGCACAGGCCACCGAATTTGAGTTCCTAGATTTTGATTTCCTG; FYY mutant, CGGGAGCTAGCACAGGCCACCGAATTTGAGTACCTAGATTATGATTTCCTG; YFY mutant, CGGGAGCTAGCACAGGCCACCGAATATGAGTTCCTAGATTATGATTTCCTG; YYF mutant, CGGGAGCTAGCACAGGCCACCGAATATGAGTACCTAGATTTTGATTTCCTG; FFY mutant, CGGGAGCTAGCACAGGCCACCGAATTTGAGTTCCTAGATTATGATTTCCTG; FYF mutant, CGGGAGCTAGCACAGGCCACCGAATTTGAGTACCTAGATTTTGATTTCCTG; and YFF mutant, CGGGAGCTAGCACAGGCCACCGAATATGAGTTCCTAGATTTTGATTTCCTG. COS-7 cells were transfected with the constructs using DEAE dextran. In some experiments, COS-7 cells were cotransfected with hPSGL-Fc constructs and expression plasmids for FucT-VII and N-acetylglucosamine-6-O-sulfotransferase GST-3 (also called LSST or HEC-GlcNAc6ST) (35, 36). The culture supernatants were harvested 6 days after transfection and applied to a protein A-Sepharose column. The chimeric proteins were eluted with 4 M imidazole (pH 8.0) and dialyzed against phosphate-buffered saline (37). The protein concentration was measured by a BCA protein assay kit (Pierce). To generate unsulfated hPSGL-Fc protein, COS-7 cells transfected with the hPSGL-Fc construct were cultured for 5 days in sulfate-free medium (Invitrogen) containing 10 mM sodium chlorate. The chimeric protein was purified as described above.
Enzyme Treatment of rPSGL-IgTo remove sialic acids, rPSGL-Ig was incubated with 1 unit/ml neuraminidase from Clostridium perfringens (Sigma) in 50 mM sodium phosphate (pH 5.0) at 37 °C for 1 h. To remove O-glycan chains, the rPSGL-Ig was treated with a mixture of enzymes consisting of 1 unit/ml neuraminidase, 0.15 unit/ml Dot Blot AssaysTo study the binding of PSGL-1 to chemokines, various chemokines and selectins were spotted onto nitrocellulose membranes (Hybond-C; Amersham Biosciences). The membrane was blocked in phosphate-buffered saline containing 3% bovine serum albumin (BSA) and incubated with 4 µg/ml rPSGL-Ig or control human IgG (Sigma) for 1 h. The membrane was then washed and incubated with a 1: 50,000 dilution of peroxidase-conjugated anti-human IgG. The membrane was washed and exposed to ECL reagents (Amersham Biosciences). In some experiments, rPSGL-Ig and control human IgG, untreated or treated with glycosidases or sulfatases, and various preparations of hPSGL-Fc were spotted onto a membrane. The membrane was blocked as described above and incubated with 0.3 µg/ml CCL27 for 1 h. The bound chemokine was detected using a biotinylated anti-CCL27 antibody followed by peroxidase-conjugated streptavidin.
Enzyme-linked Immunosorbent Assay (ELISA)-like Binding Assays rPSGL-Ig, control human IgG, or various preparations of hPSGL-Fc (10 µg/ml) were immobilized on Sumilon H plates (10 µg/ml, 50 µl/well) at 37 °C for 2 h, and the plates were blocked with 3% BSA in phosphate-buffered saline at 4 °C overnight. The plates were washed and incubated with CCL27, P-selectin, or a polyclonal anti-PSGL-1 antibody (0 ELISAVarious preparations of hPSGL-Fc (10 µg/ml) were immobilized on Costar 3690 plates (10 µg/ml, 25 µl/well) at 37 °C for 2 h, and the plates were blocked with 3% BSA in phosphate-buffered saline at 4 °C overnight. The plates were washed and incubated with a polyclonal anti-PSGL-1 antibody, CSLEX-1 (BD Biosciences), G72 (38), or 2H5 (39) for 1 h at room temperature. The plates were washed and then incubated with peroxidase-labeled anti-rabbit IgG or anti-mouse IgG+M for 1 h at room temperature. Flow CytometryTo examine the PSGL-1 expression on transfected L1.2 cells, the cells were stained with phycoerythrin-labeled anti-PSGL-1 KPL-1 (BD Biosciences) or nonlabeled PL-2 (Immunotech) followed by fluorescein isothiocyanate-labeled anti-mouse IgG. For CCR10 staining, the cells were incubated with goat anti-CCR10 (ImmunoDetect) followed by Alexa Fluor 488-labeled anti-goat IgG (Molecular Probes). Stained cells were analyzed using an EPICS XL flow cytometer (Beckman Coulter). To assess the chemokine binding by flow cytometry, the cells were incubated with CCL27-Fc or control Fc for 30 min at 4 °C, then washed, incubated with biotinylated goat anti-human IgG (Cappel), and stained with streptavidin-phycoerythrin (BD Biosciences). In some experiments, the cells were treated with 120 µg/ml O-sialoglycoprotein endopeptidase (OSGE; Cedarlane) at 37 °C for 1 h and washed before staining. To examine whether anti-PSGL-1 mAbs affect CCL27 binding, the cells were preincubated with 20 µg/ml PL1, KPL1, or control mouse IgG before staining. CCL27-Fc binding was detected using biotinylated goat anti-human IgG adsorbed against mouse IgG using mouse IgG-agarose (Sigma) and streptavidin-phycoerythrin. Generation of L1.2 or L1.2-CCR10 Cells Expressing Human PSGL-1To generate the human PSGL-1 expression plasmid, the entire coding region was amplified by PCR from HL-60 cDNA using the following primers: GCTGGATCCGGTGGTGCCATGCCTCTGCAAC and AGTGAATTCAGGGAGGAAGCTGTGCAGGGTG. The amplified product was digested with BamHI and EcoRI and ligated into pcDNA/Myc-His (Invitrogen) at the BamHI and EcoRI sites. Stable L1.2 or L1.2-CCR10 cell lines expressing human PSGL-1 were made by the transfection of L1.2 or L1.2-CCR10 cells with the PSGL-1 plasmid and selection with 20 µg/ml blasticidin. Chemotaxis AssayChemotaxis assays were performed using the ChemoTx system (NeuroProbe). The cells were suspended at 5 x 106 cells/ml in RPMI 1640 containing 0.5% BSA and 10 mM HEPES. Chemokine at the indicated concentrations were placed in the lower chamber, and a filter with a 5-µm pore size was placed on top. In some experiments, rPSGL-Ig was also added to the lower chamber. Aliquots of 1.25 x 105 cells/well were applied to the top surface of the filter, and the plates were incubated at 37 °C in 5% CO2 for 4 h. The cells that migrated to the bottom were collected and counted on a FACSCalibur (Beckton Dickenson).
PSGL-1 Binds CCL27To investigate the interaction between chemokines and PSGL-1, we first examined the binding of rPSGL-Ig, a recombinant soluble form of PSGL-1, to chemokines immobilized on a nitrocellulose membrane. rPSGL-Ig consists of the 47 amino-terminal amino acids of mature human PSGL-1, fused to a mutated hinge region of human IgG1 that has reduced complement binding and Fc receptor binding (19). rPSGL-Ig is produced in Chinese hamster ovary cells that have been engineered to express FucT-VII and C2GlcNAcT-I, so it carries the glycans required for binding to P-selectin. In agreement with previous results (12), rPSGL-Ig, which contains only the first 47 amino acids of PSGL-1, bound to P-selectin but not detectably to E-selectin immobilized on the membrane (Fig. 1A). Among the human chemokines tested (CCL1, CCL2, CCL3, CCL4, CCL5, CCL7, CCL8, CCL17, CCL18, CCL19, CCL20, CCL21, CCL27, CCL28, CXCL1, CXCL4, CXCL5, CXCL8, CXCL10, CXCL12, XCL1, and XCL2), rPSGL-Ig preferentially bound to CCL21, CCL27, and CCL28, whereas control human IgG did not bind to these chemokines (Fig. 1A). The binding of rPSGL-Ig to the other chemokines was either undetectable or very weak. We next examined the binding of chemokines to rPSGL-Ig and control human IgG immobilized on the membrane. CCL27 bound to rPSGL-Ig but not to control IgG (Fig. 1B). Incubation of the membrane with secondary reagents without prior incubation with CCL27 did not result in any binding (data not shown), confirming that the signals represented CCL27 binding. Although rPSGL-Ig had bound to CCL21 and CCL28 when these chemokines were immobilized on the membrane, specific binding of CCL21 and CCL28 to immobilized rPSGL-Ig was difficult to detect because of high background binding of these chemokines to the membrane, and thus PSGL-1 interaction with these chemokines was not investigated further in this study. CCL27 also bound to rPSGL-Ig immobilized on a microtiter plate in a dose-dependent manner (Fig. 1C). These results indicate that the amino-terminal region of PSGL-1 binds CCL27.
PSGL-1 Glycans Are Not Involved in CCL27 Binding PSGL-1 is modified by sialylated and fucosylated glycans, which are required for its binding to selectins. To study the role of sialylated glycans in PSGL-1 binding to CCL27, we examined the effect of removing the sialic acids from the rPSGL-Ig glycans on the CCL27 binding. Treatment of rPSGL-Ig with sialidase from C. perfringens, which hydrolyzes the -2,3, -2,6, and -2,8 glycosidic linkages of terminal sialic residues, did not affect the CCL27 binding, whereas it completely abrogated P-selectin binding (Fig. 2A). We next investigated the role of the O-glycan chains in rPSGL-Ig binding to CCL27. rPSGL-Ig was treated with a combination of glycosidases that removed O-glycan chains. As expected, no binding of P-selectin to rPSGL-Ig was observed after this treatment. In contrast, CCL27 bound to the O-deglycosylated rPSGL-1-Ig, suggesting that O-glycans are not required for the CCL27 binding (Fig. 2A). Because PSGL-1 is also N-glycosylated, the role of N-glycan chains was also examined by treating rPSGL-Ig with N-glycosidase. P-selectin bound to the N-deglycosylated rPSGL-Ig, confirming the previous results that N-glycans are not required for P-selectin binding (40). CCL27 also bound to the N-deglycosylated rPSGL-Ig (Fig. 2A). In these experiments, each treatment of rPSGL-Ig led to a shift in its migration on SDS-PAGE (Fig. 2B), confirming the effectiveness of the enzymes. The treatment of rPSGL-Ig with a combination of enzymes that removed both the O-glycan and N-glycan chains did not abrogate the CCL27 binding (data not shown). These results suggest that neither the O-glycan nor the N-glycan chains on rPSGL-Ig are required for CCL27 binding.
rPSGL-Ig contains only the amino-terminal region of PSGL-1. The remaining extracellular region of PSGL-1 contains a mucin domain with many putative O-glycosylation sites. To examine the role of glycans attached to this region, we generated constructs that contained either the same amino-terminal region as rPSGL-Ig, here termed hPSGL-Fc, or the entire extracellular domain of mature human PSGL-1, termed hPSGL-long-Fc; both were fused to the hinge region of human IgG1. These constructs were introduced into COS-7 cells that endogenously express C2GlcNAcT but not FucT-VII. As shown in Fig. 2C, CCL27 bound similarly to the hPSGL-long-Fc protein and the hPSGL-Fc protein, suggesting that the mucin domain does not play a role in CCL27 binding to PSGL-1. The cotransfection of COS-7 cells with a plasmid expressing FucT-VII, which enables the chimeric proteins to bind P-selectin, did not significantly affect the CCL27 binding (data not shown). Together, these results suggest that no glycosylation of PSGL-1 is required for its binding to CCL27. Sulfated Tyrosines Are Required for CCL27 Binding to PSGL-1It has been shown that in addition to O-glycosylation, tyrosine sulfation of the amino-terminal region of PSGL-1 is required for its high affinity binding to P-selectin. Treatment of rPSGL-Ig with sulfatase from abalone entrails, which removes sulfates from tyrosines, not only abrogated the P-selectin binding but also the CCL27 binding (Fig. 3A). Sulfatase treatment did not alter the efficiency of immobilization of rPSGL-Ig onto the membrane as shown by an anti-IgG blot (Fig. 3A). This treatment did not alter the migration pattern of rPSGL-Ig on SDS-PAGE (Fig. 3B). In an ELISA-like binding assay where plate-immobilized rPSGL-Ig was treated with sulfatase or left untreated, the binding of both CCL27 and P-selectin to the sulfatase-treated rPSGL-Ig was reduced, whereas a polyclonal antibody that recognizes the amino-terminal region of PSGL-1 bound similarly to the untreated and sulfatase-treated rPSGL-Ig proteins (Fig. 3C). These results suggest that the tyrosine sulfation of PSGL-1 plays an important role in its binding to CCL27.
To further define the role of tyrosine sulfation in the CCL27-PSGL-1 interaction, we examined the effect of sodium chlorate, which is an inhibiter of sulfation. COS-7 cells were transfected with the hPSGL-Fc construct and incubated in sulfate-free medium containing sodium chlorate. The unsulfated hPSGL-Fc protein prepared in the presence of sodium chlorate and the hPSGL-Fc prepared from cells grown in regular medium did not differ significantly in the amount secreted into the culture medium or in their migration pattern on SDS-PAGE (data not shown). Although CCL27 bound to hPSGL-Fc prepared in the presence of sulfate, it did not detectably bind to unsulfated hPSGL-Fc in a dot blot assay (Fig. 4A). In this experiment, these hPSGL-Fc preparations were similarly immobilized on the membrane (Fig. 4A). The reduced binding of CCL27 to unsulfated hPSGL-Fc was also observed in an ELISA-like binding assay (Fig. 4B). In contrast, a polyclonal anti-PSGL-1 antibody similarly bound to the sulfated and unsulfated hPSGL-Fc proteins (Fig. 4B). These results, together with the effect of sulfatase treatment, strongly indicate that sulfation on tyrosines is critical for PSGL-1 binding to CCL27.
Sulfation of PSGL-1 Glycans Does Not Enhance CCL27 BindingSulfation can occur not only on tyrosines but also on glycan chains. To investigate whether sulfation on the PSGL-1 glycans would enhance the CCL27 binding, we transfected COS-7 cells with the hPSGL-Fc construct together with a plasmid for N-acetylglucosamine-6-O-sulfotransferase GST-3, which can sulfate the N-acetylglucosamines in glycans. To compare the CCL27 binding with P-selectin binding, the COS-7 cells were cotransfected with the FucT-VII-expressing plasmid and the hPSGL-Fc and GST-3 constructs. As shown in Fig. 5A, CCL27 binding to the hPSGL-Fc protein was not enhanced when GST-3 was cotransfected. Similar results were obtained when the hPSGL-long-Fc construct was used for transfection instead of the hPSGL-Fc construct (data not shown). The hPSGL-Fc protein produced in the presence of GST-3 was shown to react with the mAb G72, which recognizes sialyl 6-sulfo LacNAc, confirming that the hPSGL-Fc glycan was sulfated (Fig. 5B). In contrast, P-selectin binding to the hPSGL-Fc protein prepared in the presence of GST-3 and FucT-VII appeared to be slightly enhanced, compared with that produced in the presence of FucT-VII alone (Fig. 5A). The generation of the fucosylated glycan was confirmed by reactivity with the mAb CSLEX-1, which recognizes sLex, and the mAb 2H5, which recognizes sLex as well as 6-sulfo sLex (Fig. 5B). All of the hPSGL-Fc preparations were similarly recognized by an anti-PSGL-1 antibody (Fig. 5B). Thus, the sulfation of glycans on PSGL-1 by GST-3 did not play a significant role in CCL27 binding.
All Three Tyrosines in the Amino-terminal Region of PSGL-1 Are Important for CCL27 BindingThere are three tyrosine residues in the amino-terminal region of human PSGL-1 that can be sulfated. To examine which tyrosine residue is important for CCL27 binding, hPSGL-1-Fc mutants with alterations in one or more of the tyrosines at positions 46, 48, and 51 were generated (Fig. 6A). To evaluate the P-selectin binding, wild-type and mutant hPSGL-Fc proteins were also prepared from COS-7 cells cotransfected with the FucT-VII-expressing plasmid. As shown in Fig. 6B, CCL27 binding to the hPSGL-Fc protein was dramatically reduced when even one tyrosine was mutated to phenylalanine. In contrast, P-selectin bound to the FYY, YYF, and FYF mutants. Thus, although tyrosine sulfation plays an important role in both the PSGL-1-P-selectin and PSGL-1-CCL27 interactions, the relative contribution of each tyrosine to the binding is different in each case. The results suggest that all three tyrosines are required for CCL27 binding, whereas the tyrosine at position 48 plays a dominant role in P-selectin binding.
PSGL-1 Affects CCL27-induced ChemotaxisTo investigate whether PSGL-1 affected CCL27 function, we examined the effect of rPSGL-Ig on the chemotaxis of L1.2 cells expressing human CCR10. rPSGL-Ig reduced the CCL27-induced chemotaxis in a dose-dependent manner, whereas control human IgG1 Fc did not (Fig. 7A). The inhibition was observed when rPSGL-Ig was added at 30100 µg/ml (a molar ratio of 1:310). These results suggest that PSGL-1 binding to CCL27 may regulate the chemokine-mediated responses of cells.
We next examined whether cell surface-expressed PSGL-1 would bind CCL27 and affect cell responses to CCL27. The interaction of CCL27 with cell surface-expressed PSGL-1 was studied by examining the binding of a CCL27-Fc chimeric protein to L1.2 cells expressing human PSGL-1. CCL27-Fc bound to L1.2 clones expressing human PSGL-1 more strongly than to the parental L1.2 cells that do not express human PSGL-1 (Fig. 7B). The binding of CCL27-Fc to these clones was reduced by treating the cells with OSGE, which cleaves O-sialoglycoproteins such as PSGL-1 (Fig. 7B). A decrease in CCL27-Fc binding to parental L1.2 cells by treatment with OSGE was smaller compared with L1.2 clones expressing human PSGL-1. There was no alteration in the control Fc binding to any of these cells by this treatment. These results suggest that human PSGL-1 expressed on the cell surface may bind CCL27. We next tested whether anti-PSGL-1 mAbs that inhibit P-selectin binding would affect CCL27 binding. Neither PL1 nor KPL1 affected the binding of CCL27-Fc to L1.2 clones expressing human PSGL-1 (Fig. 7C). PL1 and KPL1 also failed to inhibit the CCL27 binding to rPSGL-Ig immobilized on an ELISA plate (data not shown). These results suggest that the CCL27 binding site on PSGL-1 may not exactly overlap with the epitopes recognized by these antibodies. We next prepared L1.2 cells expressing both human CCR10 and human PSGL-1 and assayed these cells for the CCL27-induced chemotaxis. The chemotaxis of L1.2 clones expressing both human CCR10 and PSGL-1 was significantly reduced compared with that of L1.2 cells expressing CCR10 alone (Fig. 7D). The level of CCR10 expression was similar for all these clones (data not shown). Together, these results support the hypothesis that cell surface-expressed human PSGL-1 binds CCL27 and thereby regulates cell responses to CCL27.
In the present study, we investigated the interaction of PSGL-1 with chemokines. We demonstrated that PSGL-1 can bind several chemokines including CCL27. Our data showed that the PSGL-1 interaction with CCL27 is dependent on tyrosine sulfation but not the glycosylation of PSGL-1. All three tyrosines positioned at the amino terminus of PSGL-1 are required for the CCL27 binding. In addition, we showed that PSGL-1 is able to modulate the CCL27-induced response of CCR10-bearing cells. Tyrosine sulfation is a late post-translational modification that occurs in the trans-Golgi network and is found in a number of secreted and membrane proteins (41). It plays an important role in various protein-protein interactions. Tyrosine sulfation of the amino terminus of PSGL-1 plays an essential role in P-selectin binding (1214). Recently, sulfation of amino-terminal tyrosine residues of several G protein-coupled receptors, including chemokine and chemoattractant receptors as well as glycoprotein hormone receptors, has been demonstrated (2730, 42). In these receptors, tyrosine sulfation contributes to the high affinity binding of their ligands. Our data showed that mutation in any one of the tyrosines in the amino terminus of PSGL-1 abrogated the CCL27 binding, indicating that all three tyrosines are required for this binding. Electrostatic interactions are likely to play a role in the binding of the negatively charged region of PSGL-1 generated by sulfated tyrosines to CCL27, which has several basic residues. The requirement of all three tyrosines for CCL27 binding is in contrast to the binding of P-selectin, which was retained to some extent even when tyrosine 46 or 51 was mutated. These findings are in agreement with the results of crystallographic studies showing tyrosine 48 as an important component of the high affinity interaction of PSGL-1 with P-selectin (43). The requirement of all three tyrosines for CCL27 binding might explain why mouse PSGL-1, which has only two tyrosines at its amino terminus, does not bind CCL27 in our assays (data not shown). Although CCL27 interacts with tyrosine-sulfated PSGL-1, it is unclear whether the binding of CCL27 to its receptor CCR10 requires sulfation of the receptor. Human CCR10 has three tyrosine residues at positions 14, 22, and 32 from the amino terminus, but the Sulfinator, a software tool that predicts tyrosine sulfation sites in protein sequences (44), does not predict the sulfation of any of these tyrosines. The Sulfinator also does not predict tyrosine sulfation in mouse CCR10, which has four tyrosine residues at positions 14, 17, 22, and 32 in the amino-terminal region. It should be experimentally verified whether these tyrosines located in the amino-terminal region of CCR10 are sulfated and contribute to CCL27 binding to CCR10. Our data also showed that the CCL27 binding to PSGL-1 is not dependent on the glycosylation of PSGL-1. This is in contrast to the selectin binding, which requires sialylated and fucosylated O-glycans of PSGL-1. Sialylated O-glycans of CCR5 were also shown to contribute to high affinity binding of CCR5 ligands (31). Whether O-glycans are attached to CCR10 and contribute to the binding of CCL27 has not yet been shown. rPSGL-Ig is a recombinant, soluble, and chimeric form of PSGL-1 that was developed as an antagonist to P-selectin. rPSGL-Ig has been shown to exert anti-inflammatory effects in many models of inflammation; it reduces hepatic ischemia/reperfusion injury in rats (45), accelerates thrombolysis and prevents reocclusion in a porcine model (19), ameliorates acute traumatic shock in rats (16), and protects against myocardial ischemic reperfusion injury in cats (17). A recent report showed that rPSGL-Ig binds the murine chemokine KC, which may in part account for its anti-inflammatory effect (20). Our results also show that rPSGL-Ig binds to several chemokines, supporting the idea that its effect in various inflammatory conditions is not exclusively due to its inhibition of selectin function but also of chemokine function. The mechanisms by which rPSGL-Ig inhibits chemokine function may involve the inhibition of chemokine binding to its receptor or the inhibition of chemokine-induced signal transduction. Although the in vivo relevance of the interaction of PSGL-1 with CCL27 is not yet clear, the modulation of CCL27-induced cell responses by PSGL-1 may confer an additional level of regulation on the trafficking of skin-homing T cells. CCR10 is expressed on a subset of skin-homing T cells, which also express PSGL-1. PSGL-1 on the surface of T cells that have migrated into the skin may bind CCL27 and regulate its function in the local microenvironment. Alternatively, soluble PSGL-1 in the vicinity of these cells may bind CCL27 and affect cell responses to CCL27. A previous study showed that the phorbol ester PMA induces the ectodomain shedding and secretion of PSGL-1 from human neutrophils (46). Several proteases such as BACE1 have been implicated in mediating PSGL-1 shedding (47). In support of this idea, soluble PSGL-1 is found in human bronchoalveolar lavage fluids and in serum (46, 48). A raised concentration of soluble PSGL-1 in serum is associated with a lower frequency and severity of pulmonary fibrosis in systemic sclerosis (48), suggesting that soluble PSGL-1 could function as a protective factor by binding to certain chemokines that promote the progression of the disease. Because CCL27 is critically involved in various T cell-mediated inflammatory diseases of the skin such as atopic dermatitis and contact dermatitis (23), the identification of molecules that regulate the function of CCL27 should lead to the development of treatments to control these human skin diseases.
* This work was supported by a Grant-in-aid for Scientific Research from the Ministry of Education, Culture, Sports, Science and Technology, Japan, a Grant-in-Aid for the 21st Century Center of Excellence Program from the Ministry of Education, Culture, Sports, Science and Technology, Japan, and in part by National Institutes of Health Grant CA71932. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. ¶ To whom correspondence should be addressed: Laboratory of Molecular and Cellular Recognition, Osaka University Graduate School of Medicine C8, 2-2 Yamada-oka, Suita, Osaka 565-0871, Japan. Tel.: 81-6-6879-3974; Fax: 81-6-6879-3979; E-mail: thirata{at}orgctl.med.osaka-u.ac.jp.
1 The abbreviations used are: PSGL-1, P-selectin glycoprotein ligand-1; sLex, sialyl Lewisx; C2GlcNAcT-I, core 2
We thank Mahiru Kamiya for preparing the hPSGL-Fc construct and Dr. Myoung-Ho Jang and Tomoharu Kikuchi for preparing the CCL27-Fc protein. We also thank Drs. Toshiyuki Tanaka, Toshiyuki Murai, and Haruko Hayasaka for valuable comments and Shinobu Yamashita and Miyuki Komine for secretarial assistance.
This article has been cited by other articles:
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Advertisement | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||