Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M406591200 on October 7, 2004

J. Biol. Chem., Vol. 279, Issue 50, 52238-52246, December 10, 2004
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
279/50/52238    most recent
M406591200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dinour, D.
Right arrow Articles by Romero, M. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dinour, D.
Right arrow Articles by Romero, M. F.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

A Novel Missense Mutation in the Sodium Bicarbonate Cotransporter (NBCe1/SLC4A4) Causes Proximal Tubular Acidosis and Glaucoma through Ion Transport Defects*

Dganit Dinour{ddagger}§, Min-Hwang Chang§, Jun-ichi Satoh¶||, Brenda L. Smith¶, Nathan Angle¶, Aaron Knecht{ddagger}, Irina Serban{ddagger}, Eli J. Holtzman{ddagger}, and Michael F. Romero¶**{ddagger}{ddagger}

From the {ddagger}Department of Nephrology and Hypertension, Chaim Sheba Medical Center, Tel-Hashomer, and Tel-Aviv University, 52621 Israel and the Department of Physiology and Biophysics and **Department of Pharmacology, Case Western Reserve University, Cleveland, Ohio 44106-4970

Received for publication, June 14, 2004 , and in revised form, October 1, 2004.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
In humans and terrestrial vertebrates, the kidney controls systemic pH in part by absorbing filtered bicarbonate in the proximal tubule via an electrogenic Na+/ cotransporter (NBCe1/SLC4A4). Recently, human genetics revealed that NBCe1 is the major renal contributor to this process. Homozygous point mutations in NBCe1 cause proximal renal tubular acidosis (pRTA), glaucoma, and cataracts (Igarashi, T., Inatomi, J., Sekine, T., Cha, S. H., Kanai, Y., Kunimi, M., Tsukamoto, K., Satoh, H., Shimadzu, M., Tozawa, F., Mori, T., Shiobara, M., Seki, G., and Endou, H. (1999) Nat. Genet. 23, 264–266). We have identified and functionally characterized a novel, homozygous, missense mutation (S427L) in NBCe1, also resulting in pRTA and similar eye defects without mental retardation. To understand the pathophysiology of the syndrome, we expressed wild-type (WT) NBCe1 and S427L-NBCe1 in Xenopus oocytes. Function was evaluated by measuring intracellular pH ( transport) and membrane currents using microelectrodes. -elicited currents for S427L were ~10% of WT NBCe1, and CO2-induced acidification was ~4-fold faster. Na+-dependent transport (currents and acidification) was also ~10% of WT. Current-voltage (I-V) analysis reveals that S427L has no reversal potential in , indicating that under physiological ion gradient conditions, NaHCO3 could not move out of cells as is needed for renal absorption and ocular pressure homeostasis. I-V analysis without Na+ further shows that the S427L-mediated NaHCO3 efflux mode is depressed or absent. These experiments reveal that voltage- and Na+-dependent transport by S427L-hkNBCe1 is unfavorably altered, thereby causing both insufficient absorption by the kidney (proximal RTA) and inappropriate anterior chamber fluid transport (glaucoma).


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Maintenance of body fluid pH within a narrow range is critical for a wide variety of essential biochemical and metabolic functions. The kidney plays a key role in normal homeostasis, due to its ability to reclaim and excrete acid. Renal tubular acidosis (RTA)1 is a clinical syndrome characterized by hyperchloremic metabolic acidosis resulting from two physiologically distinct disorders of renal acidification. In distal RTA (dRTA), the kidney fails to produce an appropriately acid urine in the presence of systemic metabolic acidosis or after acid loading, due to impaired hydrogen ion secretion in the distal nephron. Both autosomal dominant (OMIM 179800 [OMIM] ) (1–5) and autosomal recessive (OMIM 602722 [OMIM] ) (6, 7) patterns have been observed in kindreds with primary dRTA, and the spectrum of clinical severity is wide. Proximal RTA (pRTA) is caused by an impairment of bicarbonate absorption in the proximal tubule (PT) and is characterized by a decreased renal threshold (8).

The kidney receives 20% of the cardiac output, translating to a renal blood flow of 1 liter/min in humans (i.e. 1,800 liters/day). Daily glomerular filtration is ~10% of renal blood flow (~180 liters/day of ultrafiltrate). The PT isotonically absorbs ~67% of filtered ions, solutes and water (i.e. ~120 liters/day of isotonic solution). Thus, the PT is a major player in ion and H2O (volume) homeostasis. The PT can increase absorption by up to 90% of total via "new synthesis" (i.e. ammoniagenesis). This absorption is a transepithelial process. First, crosses the apical membrane as CO2 after being titrated with H+ (from the NHE3 Na+-H+ exchanger). This process is facilitated by an apical carbonic anhydrase IV (CAIV). Once CO2 and H2O are in the proximal tubule cells, carbonic anhydrase II (CAII) facilitates the reformation of H+ and . Finally, exits the basolateral membrane, into the blood, coupled to Na+ via the electrogenic Na+/ cotransporter (NBCe1) (9). Thus, when is absorbed, Na+ and water come along to maintain isotonic absorption. In humans, this proximal absorption is ~340 g (0.75 pounds) of NaHCO3/day.

A rare syndrome characterized by profound pure pRTA (blood pH <7.1 and blood [] = 5–11 mM), short stature, mental retardation, and bilateral glaucoma with or without cataracts and band keratopathy has been described so far in only three families (10, 11) (i.e. Igarashi et al. (10, 11) identified three homozygous SLC4A4 mutations (R298S, R501H, and Q29X) in three unrelated Japanese patients). These mutations reveal that NBCe1 is the major transporter of the proximal tubule and a major kidney controller of systemic acid-base status.

We have identified a novel, SLC4A4 missense mutation, S427L, located in the beginning of the predicted first transmembrane span (TM1) (9, 12–14) in a female Israeli patient with uncompensated pRTA. Here we provide a patient description, biophysical characterization of the S427L-hkNBCe1 transport defect, and additional insight to the pathology of this genetic disorder.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Patient Description—The patient is a 44-year-old Jewish-Georgian woman with pRTA, short stature (140 cm), normal intelligence, deformed teeth, and blindness (Fig. 1a). Bilateral glaucoma was diagnosed in early childhood. She underwent several eye operations for high intraocular pressure and was treated with acetazolamide from 6 years of age. Bilateral cataracts and corneal opacity developed over the years. She was completely blind at age 16. Metabolic acidosis was first noted when she was admitted to the hospital for rectal bleeding at 33 years. Stopping acetazolamide treatment did not improve her systemic acid-base status and thus was not the cause of the renal or ocular pathologies.



View larger version (75K):
[in this window]
[in a new window]
  		FIG. 1.
S427L-NBCe1 mutation. a, patient's facial manifestations (blind eye with cataract and corneal opacity (top) and abnormal dentition (bottom)). b, sequence analysis of C-> T transition (see "Experimental Procedures"): b1, normal; b2, mother; b3, patient. c, ethidium bromide-stained 3% agarose gel showing the Taq{alpha}I digest of b. PCR amplification using the primers F8 and R9 yielded a 92-bp fragment (upper arrow). Following PCR, products were digested with Taq{alpha}I to yield 25-bp (not shown) and 67-bp (lower arrow) fragments in WT individuals. The C-> T transition abolishes this restriction site. M, marker; A, normal; B, mother; C, patient, D, sister, E, normal. d, analysis of polymorphic markers on chromosome 4q21 was performed using fluorescent primers. Genomic distances are indicated in centimorgans using a deCODE map and megabase pairs (mbp) using the STS map numbering. Markers D4S398 (4.7 centimorgans, 10.4 mbp) and D4S392 (1.5 centimorgans, 1.8 mbp) are 5' to the sense direction of SLC4A4. Markers D4S2964 (4.7 centimorgans, 8.3 mbp) and D4S1534 (6.6 centimorgans, 13.8 mbp) are 3' of SLC4A4. For each family member, two alleles in the SLC4A4 region were created. The father's alleles are predicted. Disease-carrying alleles are shown in boldface type. The patient is homozygous for D4S392 (1.5 centimorgans from SLC4A4) but heterozygous for other markers in the area. A recombination is seen in the sister between D4S392 and D4S2964 (underlined). The patient and her sister inherited different alleles from the father.

 
The patient is the daughter of nonconsanguineous parents. Her father died of end stage renal failure. Her mother suffers from mixed connective tissue disease but has no obvious renal or vision abnormalities. A brother and a sister are healthy. No one else in the family has pRTA, eye pathologies, short stature, or poor dentition (Fig. 1a).

At diagnosis, serum analysis revealed the following levels: Na+, 137 meq/liter; K+, 3.5 meq/liter; Cl–, 122 meq/liter; creatinine, 0.7 mg/100 ml; urea, 30 mg/100 ml. Liver function tests and serum amylase were normal. Blood gas analysis revealed a pH of 7.09, [] of 11 meq/liter, and PCO2 of 38 mm Hg. Urine pH was 4.92. Intravenous bicarbonate loading (130 meq/3 h) raised blood level to 16 meq/liter and increased the fractional excretion of from 0 to 41%, confirming the pRTA diagnosis. Subsequent urinalysis showed a pH of 5.0, osmolality of 500 mosM/kg, and no glucose, blood, or protein. The urinary excretion of amino acids, calcium, and phosphate was normal. An abdominal ultrasound revealed normal sized kidneys without nephrocalcinosis. Brain computed tomography showed no calcifications, and skeletal X-rays excluded osteopetrosis.

Oral sodium bicarbonate and potassium were discontinued after 5 years due to hypertension and edema development. The patient is now taking only CaCO3. Amylase levels, not separated for pancreatic and salivary, have been repeated since diagnosis but remain normal. Recent blood work shows pH 7.215, PCO2 37 mm Hg, and 15 meq/liter, still indicating a severe, uncompensated pRTA and/or a mixed metabolic-respiratory acidosis.

The patient, her mother, and her sister gave informed consent to participate in this study.

Sequence Analysis of Carbonic Anhydrase II (CAII) and Carbonic Anhydrase IV (CAIV) Genes—Genomic DNA was extracted from the patient's peripheral blood leukocytes (PBLs). From proximal tubule absorption models, NHE3, CAII, CAIV, and NBCe1 are several of the proteins involved in transepithelial absorption. As a start, the coding areas of CAII and CAIV were amplified from genomic DNA by PCR. We used previously described primers for CAII (5) and designed intronic primers for CAIV based on its previously reported genomic structure (18). All PCR products were sequenced directly (ABI Prism 3100; Applied Biosystems).

Sequence Analysis of NBCe1 cDNA—At the time of the initial genetic study, the genomic organization of NBCe1 was unknown. Therefore, we performed sequence analysis with the NBCe1 cDNA. PBLs were isolated with Histopaque-1077 (Sigma). RNA was extracted from PBLs with Tri Reagent (MRC Inc.). First strand cDNA of pNBC1 (SLC4A4-B) used an eAMV reverse transcriptase enzyme (Sigma) with a gene-specific reverse primer (AGAGAGCGCTGTATTATTTGGCCTGTGACC), random nonamers, and anchored oligo(dT)23. Nested PCRs were performed using forward (F) and reverse (R) primers as follows: (i) external (E), F1 (5'-ATTACTATAGGATGGAGGATG) and R1 (5'-TCTGAACATTCTCTCCACCTGAGT); internal (In), F2 (5'-GCAGCAGCATCCTAAAACCTCTCA) and R2 (5'-CATGGAACACCTCATCAGACATCA); (ii) E, F3 (5'-CAGTCTGAATGACATTTCTGATAAACCGGA) and R3 (5'-AGAGAGCGCTGTATTATTTGGCCTGTGACC); In, F4 (5'-ATGATCAAGCTTGCAGATTACTACCCCATC) and R4 (5'-GATCCAAAGCAGGGCCAGACACAACACCTG); F5 (5'-GCAGTTCATGGATCGTCTGA) and R5 (5'-GCAGGTTACAATGTAGTTTCTGTTC); F6 (5'-CGTGATGCAGAAGCTTCCAACG) and R6 (5'-GTTGGCAAATACTCTGGGGCCA).

The NBCe1 cDNA obtained from PBLs was the pancreatic isoform (SLC4A4-B). Therefore, the kidney-specific 5'-end of the kNBC1 (NBCe1-A/SLC4A4-A) gene was amplified from genomic DNA of the patient using the following primers: F7 (5'-CGTTCAGAACCAAAGGAATAGAGAAGGGC) and R7 (5'-CTGCAGAAGTGAAAATACTGTG).

Confirmation of the Mutation by Genomic DNA Sequencing— Genomic DNA was extracted from PBLs of the patient, her mother, and her sister. A healthy brother was unavailable for genetic analysis. A 131-bp segment of the SLC4A4 gene comprising the mutation at position 1429 was amplified using the primers F8/R8 and sequenced (Fig. 1b): F8 (5'-ACATAAAGAGGAAAGCGCCATT) and R8 (5'-CCCCAAGCAGTCCTCCAAAAGT).

Detection of S427L Mutation by Restriction Enzyme Analysis—We used restriction enzyme analysis to reconfirm the presence of the mutation in the patient and her family and to screen 90 healthy control Israelis. Since the S427L mutation does not change a restriction site in the NBCe1 gene, we introduced by PCR a second mutation (1431G-> A), which created a Taq{alpha}I restriction site in PCR products of wild type DNA but not of mutant DNA (1429C-> T). Mutagenesis was performed by PCR amplification of genomic DNA, using F8 and R9 (5'-GCCAGATAAATGAAGAGAATTGTC). PCR products (from DNA of the patient, her family, and 90 control Israelis) were cut with Taq{alpha}I, run on 3% agarose gel, and stained with ethidium bromide (Fig. 1c).

Analysis of Polymorphic Markers on Chromosome 4q21—To exclude loss of heterozygosity of the SLC4A4 gene in our patient due to a large chromosomal deletion or whole chromosomal loss, we analyzed polymorphic markers located on chromosome 4q21 near the SLC4A4 gene. We used fluorescent primers to amplify the following markers from genomic DNA of the patient, her mother, and sister: D4S398, D4S392, D4S2964, and D4S1534. Results are illustrated in Fig. 1d.

Oocyte Experiments: hkNBCe1 and S427L cDNAs—The hkNBCe1 cDNA was generated by RT-PCR using oligo(dT)-primed human kidney poly(A)+ RNA (Clontech) and primers corresponding to the start and stop of the known sequence (19): F10 (5'-ATgTCCACTgAAAATgTggAAgggAAgCCC), R10 (5'-TTATCAgCATgATgTgTggCgTTC).

This PCR product was subcloned into TOPO-pCRII (Invitrogen) and sequenced (W. M. Keck, New Haven, CT). hkNBCe1 was excised from pCRII with BglII and EcoRI and cloned into the EcoRI site of pTLN, a Xenopus expression vector (13, 20). Sense orientation was determined by restriction analysis and verified by sequencing.

The S427L mutation (C-> T) was made by site-directed mutagenesis using QuikChange (Stratagene, La Jolla, CA) with mutagenesis primers S427L_F (5'-caagctctttTggcaattctcttcatttatctggc) and S427L_R (5'-gccagataaatgaagagaattgccAaaagagcttg). The single nucleotide change was confirmed by sequencing the entire S427L cDNA.

Oocyte Isolation and Injection—Female Xenopus laevis were purchased from Xenopus Express (Beverly Hills, FL). Oocytes were removed, and collagenase dissociated as previously described (13). Capped cRNA was synthesized using a linearized cDNA template and the SP6 mMessage mMachine kit (Ambion, Austin, TX). Oocytes were injected with 50 nl of hkNBCe1 cRNA (0.2 µg/µl), S427L-hkNBCe1 cRNA (0.5 µg/µl), or water and incubated at 18 °C in OR3 media (13). Since S427L could cause less efficient protein processing than WT, we injected 0.2, 0.5, and 1.0 µg/µl cRNA. We chose 0.5 to maximize S427L protein expression. Oocytes were studied 3–10 days after injection.

Electrophysiology—Experimental solutions were previously described (21). All solutions were either ND96 (96 mM NaCl, 2 mM KCl, 1.8 mM CaCl2, 1 mM MgCl2, 5 mM HEPES, pH 7.5) or iso-osmotic ion replacements as described (21).

Two-electrode Voltage Clamp—Oocyte currents were recorded with an OC-720C voltage clamp (Warner Instruments, Hamden, CT), filtered at 2–5 kHz, digitized at 10 kHz, and recorded using the Pulse software, and data were analyzed using the PulseFit program (HEKA) as previously (21). For periods when I-V protocols were not being run, oocytes were clamped at a holding potential (Vh) of –60 mV, and current was constantly monitored and recorded at 1 Hz. I-V protocols consisted of 100-ms steps from Vh in 20 mV steps between –160 and +60 mV as previously (21).

Ion-selective Microelectrode—Ion-selective microelectrodes were used to monitor intracellular pH (pHi) of hkNBCe1- and water-injected oocytes as previously described (13) using the H+ ionophore I-mixture B ion-selective resin (Fluka Chemical). Intracellular pH was measured as the difference between the pH electrode and a KCl voltage electrode impaled into the oocyte, and membrane potential (Vm) was the potential difference between the KCl microelectrode and an extracellular calomel (9, 13) or output Vh for clamped experiments (22, 23). pH electrodes were calibrated using pH 6.0 and 8.0 (Fisher), followed by point calibration in ND96 (pH 7.50) as previously (9, 13), and had slopes of at least –54 mV/pH unit.

Calculations—Oocytes were perfused with ND96 for 5 min, at which time initial pHi was measured. The solution was switched to CO2/ for 8–10 min (i.e. pHi and Vm or I plateau), and the final pHi was measured. []i was calculated from the Henderson-Hasselbach equation, and buffering power ({beta}T) was calculated as {beta}T = {Delta}[]i/{Delta}pHi (24). {beta}T is an apparent {beta} in the case of NBCe1 oocytes, because the acid-base transporter hkNBCe1 has been functionally "added" to the "true" buffering power of the H2O-injected oocytes. Thus, {Delta}{beta}hkNBCe1 can be represented as the difference of {beta}T (hkNBCe1 oocytes) and {beta}T (H2O oocytes). "ND96" values refer to responses elicited by removal of CO2/. n indicates the total number of experiments. Oocytes came from at least two separate donor animals.

Immunohistochemistry—Oocytes were washed with PBS, fixed with 4% paraformaldehyde in PBS for 1 h at room temperature, and processed for cryosectioning as previously described (25). Immunostaining was performed using a 1:200 dilution of the primary kNBCe1 antibody (20) and a Cy3 secondary antibody. Epifluorescent images were captured using a Zeiss AxioVert 25 microscope and acquired with an AxioCam digital camera and AxioVision software (Zeiss) (25).


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
Genomic Screening— absorption by the PT is a transepithelial transport process, relying on apical and basolateral transporters and cellular metabolism. Since pRTA could arise from defects in one of several proximal tubule proteins, we examined genes directly associated with absorption. No mutations were found in the entire coding areas of CAII or CAIV in the affected patient (not shown).

Sequencing of the patient's NBCe1 cDNA identified a homozygous missense mutation 1429C-> T, which changes Ser427 to Leu (S427L). This mutation is in both patient alleles (Fig. 1b). Genomic DNA sequencing (Fig. 1b) and restriction enzyme analysis (Fig. 1c) confirmed the presence of homozygous mutation in the patient and showed that the patient's mother and sister are heterozygous carriers. The 1429C-> T mutation was not detected in 90 unrelated Israelis (not shown).

Analysis of polymorphic markers located on chromosome 4q21 near the SLC4A4 gene showed that the patient has two alleles in this area (Fig. 1d) and is homozygous only for D4S392, a marker located only 1.5 centimorgans from the SLC4A4 gene. Haplotype analysis also showed that the sister inherited a different paternal allele than the patient, consistent with her being a heterozygous carrier of the NBCe1 mutation.

Expression of WT hkNBCe1 in Oocytes—To gain insight to the pathophysiological consequences of the S427L mutation, we cloned the hkNBCe1 cDNA (WT) from human kidney and expressed it in Xenopus oocytes (20). Fig. 2 shows representative experiments with a control (left) oocyte and a WT hkNBCe1-injected oocyte (middle). As with Ambystoma and rat kidney NBCe1 (9, 13), Fig. 2 (middle, a') illustrates that the addition of 5% CO2, 33 mM elicits a hyperpolarization (–67 mV, Na+ and n influx) WT oocytes. This CO2 causes an acidification (–0.55 pH units at –265 x 10–5 pH units/s; Fig. 2, middle, a–b). Na+ removal in CO2/ results in an additional acidification (–18 x 10–5 pH units/s; Fig. 2, middle, b–c) and depolarization (+81 mV, b'–c'). A water control has a similar CO2-evoked acidification (–0.46 pH units at –207 x 10–5 pH units/s, Fig. 2, left, a–b) and slow depolarization (+13 mV; a'). Na+ removal in this control cell slightly acidified (–11 x 10–5 pH units/s; left, b–c) and hyperpolarized the cell (–2 mV; b'). Average responses for nonclamped cells are indicated in Table I.



View larger version (22K):
[in this window]
[in a new window]
  		FIG. 2.
NBCe1 expression. First, oocytes were used for electrophysiology experiments (pHi and unclamped Vm). After electrophysiology, the oocyte was embedded in OCT, cryosectioned, and stained with a NBCe1 antibody and visualized by epifluorescence (bottom). Representative results are shown for controls (water-injected), hkNBCe1, and S427L. The left panel illustrates that water-injected oocytes have no NBCe1 activity and no NBCe1 protein. The middle panel shows that hkNBCe1 oocytes function as electrogenic cotransporters and express the NBCe1 protein at the plasma membrane. The right panel illustrates that S427L oocytes have lower NBCe1 activity, but immunoreactivity is similar. Lowercase letters mark solution changes (a–e for pHi trace; a'–e' for Vm) and are included to designate specific points of the individual experiments to make text descriptions more explicit. 030123pf, 030123pb, and 030123pe designate the specific cell's data illustrated.

 


View this table:
[in this window]
[in a new window]
  		TABLE I
Non-voltage-clamped transport measurements

Calculations are as indicated under "Experimental Procedures" and "Results." Vm is membrane potential. For these data, oocytes are not voltage-clamped. {Delta}{beta}hkNBCe1 is {beta}T(hkNBCe1) – {beta}T(water).

 
Further analysis reveals that []i for hkNBCe1 is elevated with respect to the control (10.0 versus 7.4 mM). Total buffering rose from 16.0 (control) to 18.2 mM/pH unit (hkNBCe1). Buffering due to CO2 was increased from 17.0 (control) to 23.1 mM/pH unit (hkNBCe1).

S427L-hkNBCe1 in Oocytes—S427L-hkNBCe1 shows small voltage responses after CO2/ (–15.8 mV, Fig. 2, right, a') yet clearly different from WT (Fig. 2, left, a'). For this S427L oocyte, CO2/ caused an acidification (–0.49 pH units) at an initial rate of –269 x 10–5 pH units/s (Fig. 2, right, initial a–b). Na+ removal decreases pHi by –17 x 10–5 pH units/s (Fig. 2, right, b–c) and causes a depolarization (+22.7 mV, b'). Cellular [] was 7.4 mM, equivalent to the water control. {beta}T was 14.9 mM/pH unit, and {beta}CO2 was 16.8 mM/pH unit, both similar to control values. Averages from several experiments show that the unclamped buffering of S427L is not statistically different from water-injected controls (Table I).

Decreased S427L function was not due to decreased membrane protein expression. We cryosectioned and immunostained the oocytes with a kNBC1 antibody (Fig. 2, bottom) (20). Fig. 2 illustrates that control, water-injected oocytes do not make NBCe1-immunoreactive protein (left) and that the membrane protein associated with WT (middle) or S427L expression is similar (right).

Control of Vm Affects WT hkNBCe1 and S427L-hkNBCe1 Function—Voltage clamp experiments indicated that the S427L transport defect was more severe than initial unclamped pHi experiments indicated. To recreate the PT basolateral membrane environment, we voltage-clamped our oocytes to –60 mV while simultaneously measuring pHi as previously for other transporters (22, 23). The S427L phenotype as well as the differences between control oocytes and S427L-hkNBCe1 were more obvious in these experiments (Fig. 3, Table II) due to greater experimental control.



View larger version (21K):
[in this window]
[in a new window]
  		FIG. 3.
NBCe1 expression (pHi and voltage clamping). Oocytes were treated as indicated in Fig. 2, and another KCl electrode was added to clamp at –60 mV while measuring pHi. Solution changes are indicated by bars and a–e on each panel. Left, a water-injected control; middle, hkNBCe1; right, S427L. Lowercase letters have the same meaning as in Fig. 2, except a'–e' indicate current. Capital letters (A–D) refer to time points for which current-voltage (I-V) responses were analyzed (see Fig. 4). 031007fd, 031007fa, and 031006fe designate the specific cell's data illustrated.

 


View this table:
[in this window]
[in a new window]
  		TABLE II
Membrane current (Im) and intracellular activity for oocytes clamped at –60 mV

These data are similar to Table I except that this distinct data set was collected using the three-electrode experiments (see "Experimental Procedures") to voltage-clamp oocytes at –60 mV while also measuring pHi. Im is membrane current. For pHi and {Delta}pHi values, there are actually four significant figures, although three are shown for readability.

 
addition changes both the extent and rate of acidification. A water control oocyte acidifies by –0.63 pH units at –472 x 10–5 pH units/s (Fig. 3, left, a–b). A S427L oocyte acidifies by –0.38 pH units at –330 x 10–5 pH units/s (Fig. 3, right). Table II shows that under voltage clamp conditions, CO2-induced acidification for S427L and control oocytes is similar. By comparison, a wild-type hkNBCe1-injected oocyte only acidifies by –0.11 pH units at –99 x 10–5 pH units/s (Fig. 3, middle, a–b) (i.e. clamped hkNBCe1 oocytes transport enough (18.1 mM) into the oocyte to buffer the normal CO2-induced acidification by ~60%).

Currents measured by these solution changes are quite sensitive. Positive current indicates influx of Na+ + n (net "–") into the cell, whereas negative current indicates efflux. The addition of 33 mM to WT hkNBCe1 elicits a +1100-nA peak current (Fig. 3, middle, A). The same addition to S427L causes a +99-nA current (Fig. 3, right) compared with –27 nA in control oocytes (Fig. 3, left).

By controlling Vm (clamped to –60 mV), removal of Na+ (resulting in Na+ + n efflux as in the PT) reveals obvious acidification rate and current differences between control (+35 x 10–5 pH units/s; –14 nA), hkNBCe1 (–253 x 10–5 pH units/s; –1103 nA), and S427L (–26 x 10–5 pH units/s; –163 nA) (Fig. 3, c–d). The pooled data in Table II reiterate these results. These dpHi/dt data resulting from Na+ removal in Tables I and II are initial rates. In the case of hkNBCe1, this acidification rate is nearly constant for 3 min, thereby decreasing pHi by 0.3 pH units, and would continue to less than 7.0 if the absence of Na+ persisted. However, for S427L, the initial rate is not maintained, and pHi does not significantly change from ~7.0 observed in control oocytes. Specifically, Table II enumerates {Delta}pHi (0Na+ CO2) (i.e. NaHCO3 efflux magnitude) after 3 min for WT (–0.198 ± 0.031 pH units) and S427L (–0.001 ± 0.007 pH units). The ratio of these NaHCO3 effluxes is 0.3% rather than 10% as calculated from the initial rates (dpHi/dt). The Vm clamped data illustrate that the unclamped experiments underestimate the magnitude of the S427L defect. Furthermore, the {Delta}pHi (0Na+ CO2) data illustrate that S427L does not work well in the NaHCO3 efflux mode.

Total buffering for an unclamped hkNBCe1 oocytes is 32.1 ± 5.6 mM/pH unit (13.9 ± 2.0 mM []i). Clamping hkNBCe1 oocytes raises {beta}T to 127.8 mM/pH unit by raising []i to 16.1 ± 1.0 mM. Nevertheless, for controls, clamping does not significantly change []i (9.4 ± 1.8 mM clamped versus 8.0 ± 0.3 mM unclamped) or {beta}T (22.9 ± 4.6 mM/pH unit clamped versus 18.0 ± 1.0 mM/pH unit unclamped). For S427L, clamping also does not statistically affect []i (7.6 ± 0.5 mM clamped versus 7.6 ± 0.6 unclamped) or {beta}T (18.5 ± 1.7 mM/pH unit clamped versus 15.7 ± 1.9 unclamped).

Voltage Dependence of WT NBCe1 and S47L-NBCe1—To further examine the S427L phenotype, we performed rapid voltage steps and monitored the current responses using the same solution protocol as in Fig. 3 (at points A–D) and previously (21). Fig. 4 shows the results of these experiments: addition (initial = HCO3A and steady state = HCO3B), Na+ removal (0Na-), and removal of CO2/ (ND96-w). -elicited currents were subtracted from the currents in ND96 just prior to CO2/ addition. The instantaneous current (HCO3A) reveals an apparent reversal potential (Erev) of –120 mV, whereas current at steady state (HCO3B, ~5 min when pHi has stabilized) reveals (Erev)hkNBCe1 = –83.0 ± 4.8 mV (Fig. 4, middle). Erev is the voltage at which the steady-state current changes direction (i.e. positive current (NaHCO3 influx) to negative current (NaHCO3 efflux)). HCO3B was reported in our analysis of rat NBCe1 (21), and the hkNBCe1 current-response is similar. No -elicited currents are observed in control oocytes (Fig. 4, left). The S427L response to this voltage clamp protocol shows obvious but attenuated NBCe1 activity (Fig. 4, right). In the steady state, S427L does not have an Erev; nor does it show negative currents. Mere current reversal (e.g. +200 to +100 nA) means that NaHCO3 influx has decreased rather than true NaHCO3 efflux. Negative current and continued acidification in the absence of Na+ would indicate true reversal of S427L-mediated NaHCO3 transport (NaHCO3 efflux) (i.e. it is not possible to use Vm (the electrical driving force) to move Na+ + out of the S427L oocyte. In other words, S427L does not appear to efficiently work in the direction needed for proper PT and ocular anterior chamber function.



View larger version (19K):
[in this window]
[in a new window]
  		FIG. 4.
NBCe1 I-V relationships. Oocytes were clamped at –60 mV. Voltage step protocols were executed 30–60 s before a solution change. Step protocols were run at peak currents (A in Fig. 3; diamonds) and at 5 min (B in Fig. 3; squares). IHCO3 was calculated as (21). Likewise, the I0NaHCO33 was from calculated I(0Na-, C in Fig. 3) – I(ND96) as previously (21) and shown in triangles (dashed line). Finally, the X curve was calculated from I(ND96 at end, D in Fig. 3) – I(ND96, start) representing recovery after HCO– washout. Average responses are indicated: water (n = 10); hkNBCe1 (n = 9); S427L (n = 25).

 
This S427L transport defect is further highlighted by Na+ removal. Na+ replacement with choline in hkNBCe1 supports outward currents at positive Vm values (influx not efflux). S427L oocytes respond yet differently. First, IS427L at –60 mV with "0 Na+" is ~10% of the WT response. Second, the S427L I-V response has a different shape than WT. Specifically, although S427L oocytes have slight inward currents (current reversal) with respect to -elicited currents, the currents are not less than 0. Negative current (I < 0) is defined as NaHCO3 efflux, since a current reversal that is not less than 0 could result from decreased NaHCO3 influx rather than actual NaHCO3 efflux. In fact, –160 mV does not electrically force S427L to have net NaHCO3 efflux (Fig. 4, HCO3B). Removal of CO2/ from solutions (Figs. 3D and 4, ND96-w) shows that S427L oocytes have difficulty with NaHCO3 efflux driven by 0 (–81 ± 56 nA at +60 mV versus –451 ± 208 nA for WT).

Fig. 5 further illustrates the WT and S427L I(HCO3) (Fig. 5a) and the difference currents for Na+ removal in continued (Fig. 5b; Fig. 3, point C minus B). For an easier qualitative comparison, the IS427L is amplified by 10-fold. As indicated, WT has an Erev, whereas at –160 mV, S427L does not support NaHCO3 exit from oocytes (I < 0), and IS427L appears to rectify. Plotting the current reversals associated with 0NaHCO3 (Fig. 5b) shows that IhkNBCe1 strongly rectifies but is always inward (NaHCO3 efflux). S427L does not rectify and shows an Erev of about –150 mV.



View larger version (17K):
[in this window]
[in a new window]
  		FIG. 5.
Comparison of hkNBCe1 and S427L-hkNBCe1 -dependent current with and without Na+. The data set is the same as Fig. 4. a illustrates I0NaHCO3 data (B in Fig. 3 at stable pHi). WT data is indicated by closed squares (solid line). S427L data are indicated by X (dashed line) and are plotted on a 0.1-fold of wild-type scale (nA scale). b, plot of I, I(0Na-, C in Fig. 3) – I(, B in Fig. 3) as a different view of the Na+-dependent current.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
We report a new missense mutation in NBCe1 (SLC4A4) from an Israeli kindred. As reported for other NBCe1 mutations (11, 26), S427L is a homozygous, single nucleotide transition (1429C-> T). The mother and sister, who are heterozygous carriers of the mutation, are phenotypically normal. The patient's father died, so we could not show that he carried the mutation too. However, since both parents belong to a small close community of Georgian Jews, it is very likely that they had a common ancestor and hence carried the same mutation. Our data cannot exclude a loss of heterozygosity of the SLC4A4 gene, but a whole chromosomal loss or a large chromosomal deletion were excluded by marker analysis (Fig. 1d). In addition, previous reports of a very similar phenotype in Japanese patients with NBCe1 point mutations (11, 26) support our belief that the clinical features of our patient are the result of the novel S427L-NBCe1 mutation.

Although the patient has a persistent pRTA, therapy helps (latest blood gases: pH 7.215, PCO2 37 mm Hg, [] = 15 mM). The serious clinical pathophysiology is dominated by the kidney and eye: pRTA, bilateral glaucoma, and cataracts. Thus, NBCe1 function is crucial for ion and fluid transport in both the kidney and the eye. This patient with S427L also presents with abnormal dentition not found in other family members. She has normal intelligence rather than retardation associated with other NBCe1 mutations (11, 26). Finally, PCO2 levels are abnormally high for the patient's blood pH and , indicating a probable respiratory acidosis in addition to the pRTA rather than the respiratory system compensating for the pRTA.

S427L and the other NBCe1 mutations highlight that NBCe1 is the major absorption path for the PT and that NBCe1 is the dominant renal transporter. That is, the other acid-base transporters of the kidney, e.g. Cl–- exchange and H+ pump activities of the distal nephron cannot compensate for loss or decreased NBCe1 function. We would expect better respiratory compensation, e.g. increased ventilation causing decreased blood PCO2, thereby increasing blood pH. Thus, poor or lacking compensation in S427L and other NBCe1 mutation patients indicates that the NBCe1 defect may also impair other systemic acid-base homeostatic mechanisms. For example, NBCe1 is found in central nervous system glia and neurons (27–29). Perhaps NBCe1 plays a crucial role in feedback control mediated by the chemoreceptor neurons of the carotid body, glomus cells, and/or brain respiratory center or CO2/ exchange by the lung epithelia.

Ocular defects with NBCe1 mutations (S427L, R298S, R510H) indicate that NBCe1 is critical for fluid homeostasis (glaucoma) and transparency (cataracts) in the eye. Two groups have localized eye NBCe1 isoforms (30, 31). Bok and co-workers (31) found that NBCe1-B (pNBCe1) expressed throughout the rat eye (ciliary body, conjunctiva surface cells, cornea, lens epithelium, and retina), whereas NBCe1-A (kNBCe1) was only present in the conjunctiva basal cells. These investigators postulated that all of the eye pathologies are associated with mutations in pNBCe1. Usui et al. (30) used different NBCe1 isoform antibodies on human eyes. They found that k- and p-NBCe1 are both present in human eyes. Recently, a nonsense mutation (Q29X) that removes only kNBCe1 was discovered in a patient with pRTA and glaucoma but no cataract or keratopathy (10). This patient's phenotype reveals that kNBCe1 loss of dysfunction is sufficient to cause both pRTA and glaucoma, implying that other eye pathologies are due to pNBCe1 loss. Since defects of kNBCe1 increase intraocular pressure, its normal role in the eye must be to move NaHCO3 out of the anterior chamber.

S427L resides in a domain common to k-/p-NBCe1, yet no clinical evidence of pancreatic dysfunction in our patient exists, and amylase levels are always in the normal range. Other tissues that use NBCe1 to move Na+ and into cells (e.g. intestine and heart) are also apparently spared. We speculated that NBCe1 function is not critical due to redundant transport mechanisms in these tissues. Fig. 1a illustrates a dental phenotype associated with the S427L mutation (i.e. amylase secretion may not be predictive of salivary or even pancreatic NaHCO3 secretion). Several groups have reported NBCe1 protein in basolateral membrane of salivary glands (parotid and submandibular) (32–34). In salivary glands, the NBCe1-B but not NBCe1-A is found. In this secretory tissue as in the pancreas, NBCe1 mediates the uptake of NaHCO3 from the blood into the cell. Our experiments illustrate that at –60 mV, NaHCO3 influx mediated by S427L-NBCe1 is reduced by ~10-fold compared with WT. In the pancreas, this activity, now attributed to NBCe1-B, accounts for 75% of uptake for secretion (35). Salivary glands seem to mirror these activities. Salivary secretion buffers acids (H+) generated from oral bacterial fermentation. Thus, decreased salivary secretion should accelerate tooth decay and compromise dentition. In Sjögren syndrome (OMIM 270150 [OMIM] ), expression of Cl–- exchange, the apical transport step, is lost. Among the Sjögren phenotypes are salivary gland dysfunction leading to poor dentition.

Poor dentition may also be NBCe1-phenotypic, because oral carbonic anhydrase inhibition affects mineralization of tooth enamel (36). Recently, NBCe1 has been demonstrated to interact with CAII/CAIV (37, 38). The physiologic role of this CA-NBCe1 interaction in the kidney is not understood. Inhibition of renal CA (acetazolamide) is known to reduce PT bicarbonate absorption and can lead to metabolic acidosis. Grichtchenko and Boron (39) provided experimental evidence that CA-NBCe1 interaction reveals transport by NBCe1. Given these data, CA inhibition and NBCe1 mutations should present with some similar phenotypes.

Overall, the S427L activity reduction is predicted to also decrease salivary secretion. Poor dentition is found in our S427L patient but not the family (Fig. 1). Whether severe tooth decay is a result of S427L specifically or NBCe1 mutations in general or prolonged, chronic acidosis is unclear. Dental phenotypes have not been reported for other NBCe1 mutations; however, in 1979, Winsnes reported brothers with pRTA, bilateral glaucoma and cataracts, short stature, and poor dentition (40). Unfortunately, these individuals are not available for molecular analysis.

The S427L Transport Defect—We have evaluated S427L protein expression and transporter function using Xenopus oocyte expression. The S427L protein traffics normally to the plasma membrane similar to WT hkNBCe1 (Fig. 2) (17). Our pHi and voltage clamp experiments reveal that S427L has about 10% of WT NBCe1 function (Figs. 3 and 4). We predict that either kinetics or capacity (apparent affinity) of S427L is altered versus WT. WT NBCe1 is a low affinity/high capacity cotransporter (21). NBCe1 affinity for Na+ is 30 mM (21), and affinity for is ~6.5 mM (41). Reducing affinity is not predicted to reduce whole cell currents as measured here, unless there is an interdependence of Na+ and "binding." Previous experiments with rkNBCe1 indicated that apparent Km for Na+ is voltage- and -independent (21).

Our results indicate that S427L has both voltage and Na+-dependent transport defects. Analysis of the S427L Vm dependence of the -stimulated current (IHCO3) and the Na+-dependent -stimulated current (I0NaHCO3) provides a more accurate description of S427L dysfunction. Thermodynamics allows us to calculate an Erev and predict in which direction NaHCO3 should move by knowing ion concentrations and Vm (21). However, the biophysical defect of S427L is such that with Na+, even –160 mV does not elicit NaHCO3 efflux (Figs. 4 and 5). These data imply that either a voltage sensor or a Na+ binding site of S427L is defective. We speculate that the location of S427L, the beginning third of TM1,... YDALNIQALSA-ILFIYLATVTNAITFGGLL..., contributes to the lack of a S427L-Erev. A pile-up of the animal members of the Slc4 gene family (excluding BTR1, also known as SLC4A11, since it is very different and transport is unknown) reveals that the "LSA" sequence among the Slc4 family is only modestly changed2: LAA, LAS, LSA (NBCe1), ISA, IAA, VAA, MAA, FAS, FSA, LST (fugu-clone).3 Interestingly, "LSA" is found in all NBCe1 clones, whereas "ISA" is found in all NBCe2 (NBC4/Slc4A5) clones to date, implying that lack of side chain bulk (S or A) may interfere with TM-helix packing or ion permeation. In support of this conjecture are our preliminary data with a "SLA" double NBCe1 mutant (L426S/S427L-NBCe1; not shown) that is functionally dead. However, helical wheel predictions indicate that the TM1 hydrophobic character/packing is not altered by the S-> L transition (i.e. S427L is unlikely to cause a structural problem per se). S427T reveals roughly wild-type transport function (not shown), implying that -OH Biochemistry at Ser427 is important for normal function. Perhaps helix interaction, via the -OH side chain or packing, controls voltage sensing or Na+"unbinding/dissociation" at the NBCe1 intracellular face.

Our model may not encompass the extended complexity of the NBCe1 mutation phenotype. 0Na-HCO3 reveals another aspect to the S427L defect. WT hkNBCe1 currents show strong rectification whether expressed as a difference to non- solution (I0NaHCO3 – IND96; Fig. 4) or to NaHCO3 solution (I0NaHCO3 – IHCO3; Fig. 5b). S427L data analysis reveals a small, voltage-dependent current associated with reversal of the Na+ chemical gradient. I(0Na)S427L does not rectify but has a near linear voltage dependence and an Erev (Fig. 5b). However, I(0NaHCO3)S427L is virtually voltage-independent (Fig. 4). Nevertheless, experiment summaries in Figs. 3, 4, 5 reveal a small outward current compared with the state. Since I(0Na)S427L does not exceed background currents observed in the absence of CO2, this current could represent true NaHCO3 efflux, a dissociation of charges from NBCe1, or merely decreased NaHCO3 influx. However, our {Delta}pHi data (Table II) indicate that NaHCO3 efflux of S427L is only ~0.3% (not 10% as for NaHCO3 influx) of WT hkNBCe1.

In summary, we have identified a novel missense mutation (S427L) in NBCe1 located at or near the beginning of TM1. This recessive mutation is phenotypically manifest in the kidney (pRTA), eye (cataracts, glaucoma, and band keratopathy), teeth, and perhaps the respiratory system. Interestingly, this patient has no mental retardation. Transport experiments reveal that S427L has ~10% WT NBCe1 activity for NaHCO3 influx. S427L operates poorly in the NaHCO3 efflux mode necessary for renal absorption and ocular fluid transport in the anterior chamber. That is, S427L-NBCe1 is a severe ion transport defect.


   FOOTNOTES
 
* This work was supported in part by a Howard Hughes Medical Institute institutional grant to Case Western Reserve University (to M. F. R.) and National Institutes of Health Grant DK-56218 (to M. F. R.). Portions of this work have been reported in preliminary form (15–17). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

§ Both authors contributed equally to this work. Back

|| Supported by a postdoctoral fellowship from the American Heart Association. Present address: Dept. of Pharmacology, Jichi Medical School, 3311-1 Yakushiji, Minamikawachi, Tochigi, Japan. Back

{ddagger}{ddagger} To whom correspondence should be addressed. Tel.: 216-368-3180; Fax: 216-368-3952; E-mail: Michael.romero{at}case.edu.

1 The abbreviations used are: RTA, renal tubular acidosis; pRTA, proximal RTA; PT, proximal tubule; CAII and CAIV, carbonic anhydrase II and IV, respectively; PBL, peripheral blood leukocyte; mbp, megabase pair(s). Back

2 Modifications of "LSA" in the Slc4 family: Slc4a1 (AE1): LAA; Slc4a2 (AE2): LAA, IAA, MAA; Slc4a3 (AE3): VAA; Slc4a4 (NBCe1): LSA; Slc4a5 (NBC4/NBCe2): ISA; Slc4a7 (mNBC3, NBCn1): LAS (ceNBC is also LAS); Slc4a8 (NDCBE1, kNBC3): LAS; Slc4a9 (AE4, NBCn2): VSA, FSA; Slc4a10 (NCBE): LAS; Dros NDAE1: VAS. Back

3 M. F. Romero, unpublished results. Back


   ACKNOWLEDGMENTS
 
We thank the patient, her family, and other participants for consent for this study. We thank Dr. Frank Sönnichsen for helpful discussion of protein structure and packing. We thank Dr. Terry Hassold (Genetics, Case Western Reserve University) for valuable discussions and data assessment with regard to uniparental disomy. We thank Patricia Caldwell, Montelle Sanders, and Gerold Babcock for technical support.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Bruce, L. J., Cope, D. L., Jones, G. K., Schofield, A. E., Burley, M., Povey, S., Unwin, R. J., Wrong, O., and Tanner, M. J. (1997) J. Clin. Invest. 100, 1693–1707[Medline] [Order article via Infotrieve]
  2. Alper, S. L. (2002) Annu. Rev. Physiol. 64, 899–923[CrossRef][Medline] [Order article via Infotrieve]
  3. Stehberger, P. A., Schulz, N., Finberg, K. E., Karet, F. E., Giebisch, G., Lifton, R. P., Geibel, J. P., and Wagner, C. A. (2003) J. Am. Soc. Nephrol. 14, 3027–3038[Abstract/Free Full Text]
  4. Karet, F. E., Gainza, F. J., Gyory, A. Z., Unwin, R. J., Wrong, O., Tanner, M. J., Nayir, A., Alpay, H., Santos, F., Hulton, S. A., Bakkaloglu, A., Ozen, S., Cunningham, M. J., di Pietro, A., Walker, W. G., and Lifton, R. P. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 6337–6342[Abstract/Free Full Text]
  5. Jarolim, P., Shayakul, C., Prabakaran, D., Jiang, L., Stuart-Tilley, A., Rubin, H. L., Simova, S., Zavadil, J., Herrin, J. T., Brouillette, J., Somers, M. J., Seemanova, E., Brugnara, C., Guay-Woodford, L. M., and Alper, S. L. (1998) J. Biol. Chem. 273, 6380–6388[Abstract/Free Full Text]
  6. Smith, A. N., Skaug, J., Choate, K. A., Nayir, A., Bakkaloglu, A., Ozen, S., Hulton, S. A., Sanjad, S. A., Al-Sabban, E. A., Lifton, R. P., Scherer, S. W., and Karet, F. E. (2000) Nat. Genet. 26, 71–75[CrossRef][Medline] [Order article via Infotrieve]
  7. Stover, E. H., Borthwick, K. J., Bavalia, C., Eady, N., Fritz, D. M., Rungroj, N., Giersch, A. B., Morton, C. C., Axon, P. R., Akil, I., Al-Sabban, E. A., Baguley, D. M., Bianca, S., Bakkaloglu, A., Bircan, Z., Chauveau, D., Clermont, M. J., Guala, A., Hulton, S. A., Kroes, H., Li Volti, G., Mir, S., Mocan, H., Nayir, A., Ozen, S., Rodriguez Soriano, J., Sanjad, S. A., Tasic, V., Taylor, C. M., Topaloglu, R., Smith, A. N., and Karet, F. E. (2002) J. Med. Genet. 39, 796–803[Abstract/Free Full Text]
  8. Igarashi, T., Sekine, T., Inatomi, J., and Seki, G. (2002) J. Am. Soc. Nephrol. 13, 2171–2177[Abstract/Free Full Text]
  9. Romero, M. F., Hediger, M. A., Boulpaep, E. L., and Boron, W. F. (1997) Nature 387, 409–413[CrossRef][Medline] [Order article via Infotrieve]
  10. Igarashi, T., Inatomi, J., Sekine, T., Seki, G., Shimadzu, M., Tozawa, F., Takeshima, Y., Takumi, T., Takahashi, T., Yoshikawa, N., Nakamura, H., and Endou, H. (2001) J. Am. Soc. Nephrol. 12, 713–718[Abstract/Free Full Text]
  11. Igarashi, T., Inatomi, J., Sekine, T., Cha, S. H., Kanai, Y., Kunimi, M., Tsukamoto, K., Satoh, H., Shimadzu, M., Tozawa, F., Mori, T., Shiobara, M., Seki, G., and Endou, H. (1999) Nat. Genet. 23, 264–266[CrossRef][Medline] [Order article via Infotrieve]
  12. Romero, M. F., and Boron, W. F. (1999) Annu. Rev. Physiol. 61, 699–723[CrossRef][Medline] [Order article via Infotrieve]
  13. Romero, M. F., Fong, P., Berger, U. V., Hediger, M. A., and Boron, W. F. (1998) Am. J. Physiol. 274, F425–F432
  14. Tatishchev, S., Abuladze, N., Pushkin, A., Newman, D., Liu, W., Weeks, D., Sachs, G., and Kurtz, I. (2003) Biochemistry 42, 755–765[Medline] [Order article via Infotrieve]
  15. Dinour, D., Knecht, A., Serban, I., and Holtzman, E. J. (2000) J. Am. Soc. Nephrol. 11, 0012 (abstr.)
  16. Romero, M. F., and Smith, B. L. (2002) FASEB J. 16, 52–53 (abstr.)
  17. Chang, M.-H., Satoh, J.-I., Brenda L. Smith, and Romero, M. F. (2004) FASEB J. 18, 1269 (abstr.)
  18. Okuyama, T., Batanian, J. R., and Sly, W. S. (1993) Genomics 16, 678–684[CrossRef][Medline] [Order article via Infotrieve]
  19. Burnham, C. E., Amlal, H., Wang, Z., Shull, G. E., and Soleimani, M. (1997) J. Biol. Chem. 272, 19111–19114[Abstract/Free Full Text]
  20. Sciortino, C. M. (2001) Characterization and Localization of the Sodiummediated Bicarbonate Transporters NBC and NDAE1. Ph.D. thesis, Case Western Reserve University, Cleveland, OH
  21. Sciortino, C. M., and Romero, M. F. (1999) Am. J. Physiol. 277, F611–F623
  22. Gunshin, H., Mackenzie, B., Berger, U. V., Gunshin, Y., Romero, M. F., Boron, W. F., Nussberger, S., Gollan, J. L., and Hediger, M. A. (1997) Nature 388, 482–488[CrossRef][Medline] [Order article via Infotrieve]
  23. Becker, H. M., Broer, S., and Deitmer, J. W. (2004) Biophys. J. 86, 235–247[CrossRef][Medline] [Order article via Infotrieve]
  24. Roos, A., and Boron, W. F. (1981) Physiol. Rev. 61, 296–434[Free Full Text]
  25. Sciortino, C. M., Fletcher, B. R., Shrode, L. D., Harte, P. J., and Romero, M. F. (2001) Am. J. Physiol. Cell Physiol. 281, C449–C463[Abstract/Free Full Text]
  26. Igarashi, T., Inatomi, J., Sekine, T., Takeshima, Y., Yoshikawa, N., and Endou, H. (2000) J. Am. Soc. Nephrol. 11, A0573
  27. Bevensee, M. O., Schmitt, B. M., Choi, I., Romero, M. F., and Boron, W. F. (2000) Am. J. Physiol. 278, C1200–C1211
  28. Schmitt, B. M., Berger, U. V., Douglas, R. M., Bevensee, M. O., Hediger, M. A., Haddad, G. G., and Boron, W. F. (2000) J. Neurosci. 20, 6839–6848[Abstract/Free Full Text]
  29. Douglas, R. M., Schmitt, B. M., Xia, Y., Bevensee, M. O., Biemesderfer, D., Boron, W. F., and Haddad, G. G. (2001) Neuroscience 102, 217–228[CrossRef][Medline] [Order article via Infotrieve]
  30. Usui, T., Hara, M., Satoh, H., Moriyama, N., Kagaya, H., Amano, S., Oshika, T., Ishii, Y., Ibaraki, N., Hara, C., Kunimi, M., Noiri, E., Tsukamoto, K., Inatomi, J., Kawakami, H., Endou, H., Igarashi, T., Goto, A., Fujita, T., Araie, M., and Seki, G. (2001) J. Clin. Invest. 108, 107–115[CrossRef][Medline] [Order article via Infotrieve]
  31. Bok, D., Schibler, M. J., Pushkin, A., Sassani, P., Abuladze, N., Naser, Z., and Kurtz, I. (2001) Am. J. Physiol. 281, F920–F935
  32. Park, K., Hurley, P. T., Roussa, E., Cooper, G. J., Smith, C. P., Thevenod, F., Steward, M. C., and Case, R. M. (2002) Arch. Oral Biol. 47, 1–9[CrossRef][Medline] [Order article via Infotrieve]
  33. Luo, X., Choi, J. Y., Ko, S. B., Pushkin, A., Kurtz, I., Ahn, W., Lee, M. G., and Muallem, S. (2001) J. Biol. Chem. 276, 9808–9816[Abstract/Free Full Text]
  34. Roussa, E., Romero, M. F., Schmitt, B. M., Boron, W. F., Alper, S. L., and Thévenod, F. (1999) Am. J. Physiol. 277, G1288–G1296
  35. Ishiguro, H., Steward, M. C., Lindsay, A. R., and Case, R. M. (1996) J. Physiol. (Lond.) 495, 169–178[Abstract/Free Full Text]
  36. Kakei, M., and Nakahara, H. (1996) Biochim. Biophys. Acta 1289, 226–230[Medline] [Order article via Infotrieve]
  37. Gross, E., Pushkin, A., Abuladze, N., Fedotoff, O., and Kurtz, I. (2002) J. Physiol. (Lond.) 544, 679–685[Abstract/Free Full Text]
  38. Alvarez, B. V., Loiselle, F. B., Supuran, C. T., Schwartz, G. J., and Casey, J. R. (2003) Biochemistry 42, 12321–12329[CrossRef][Medline] [Order article via Infotrieve]
  39. Grichtchenko, I. I., and Boron, W. F. (2002) FASEB J. 16, 795–796 (abstr.)
  40. Winsnes, A., Monn, E., Stokke, O., and Feyling, T. (1979) Acta Paediatr. Scand. 68, 861–868[Medline] [Order article via Infotrieve]
  41. Grichtchenko, I. I., Romero, M. F., and Boron, W. F. (2000) J. Gen. Physiol. 115, 533–546[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
H. S. Yang, E. Kim, S. Lee, H. J. Park, D. S. Cooper, I. Rajbhandari, and I. Choi
Mutation of Aspartate 555 of the Sodium/Bicarbonate Transporter SLC4A4/NBCe1 Induces Chloride Transport
J. Biol. Chem., June 5, 2009; 284(23): 15970 - 15979.
[Abstract] [Full Text] [PDF]

Home page
 J. Exp. Biol.Home page
W. F. Boron, L. Chen, and M. D. Parker
Modular structure of sodium-coupled bicarbonate transporters
J. Exp. Biol., June 1, 2009; 212(11): 1697 - 1706.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
Q. Zhu, R. Azimov, L. Kao, D. Newman, W. Liu, N. Abuladze, A. Pushkin, and I. Kurtz
NBCe1-A Transmembrane Segment 1 Lines the Ion Translocation Pathway
J. Biol. Chem., March 27, 2009; 284(13): 8918 - 8929.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Cell Physiol.Home page
C. Perry, D. O. Quissell, M. E. Reyland, and I. I. Grichtchenko
Electrogenic NBCe1 (SLC4A4), but not electroneutral NBCn1 (SLC4A7), cotransporter undergoes cholinergic-stimulated endocytosis in salivary ParC5 cells
Am J Physiol Cell Physiol, November 1, 2008; 295(5): C1385 - C1398.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Renal Physiol.Home page
R. Azimov, N. Abuladze, P. Sassani, D. Newman, L. Kao, W. Liu, N. Orozco, P. Ruchala, A. Pushkin, and I. Kurtz
G418-mediated ribosomal read-through of a nonsense mutation causing autosomal recessive proximal renal tubular acidosis
Am J Physiol Renal Physiol, September 1, 2008; 295(3): F633 - F641.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Renal Physiol.Home page
G. Wang, C. Li, S. W. Kim, T. Ring, J. Wen, J. C. Djurhuus, W. Wang, S. Nielsen, and J. Frokiaer
Ureter obstruction alters expression of renal acid-base transport proteins in rat kidney
Am J Physiol Renal Physiol, August 1, 2008; 295(2): F497 - F506.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
M.-H. Chang, J. DiPiero, F. D. Sonnichsen, and M. F. Romero
Entry to "Formula Tunnel" Revealed by SLC4A4 Human Mutation and Structural Model
J. Biol. Chem., June 27, 2008; 283(26): 18402 - 18410.
[Abstract] [Full Text] [PDF]

Home page
 JDRHome page
M.L. Paine, M.L. Snead, H.J. Wang, N. Abuladze, A. Pushkin, W. Liu, L.Y. Kao, S.M. Wall, Y.-H. Kim, and I. Kurtz
Role of NBCe1 and AE2 in Secretory Ameloblasts
Journal of Dental Research, April 1, 2008; 87(4): 391 - 395.
[Abstract] [Full Text] [PDF]

Home page
 Nephrol Dial TransplantHome page
Z. Katzir, D. Dinour, H. Reznik-Wolf, A. Nissenkorn, and E. Holtzman
Familial pure proximal renal tubular acidosis--a clinical and genetic study
Nephrol. Dial. Transplant., April 1, 2008; 23(4): 1211 - 1215.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
A. Brandes, O. Oehlke, A. Schumann, S. Heidrich, F. Thevenod, and E. Roussa
Adaptive redistribution of NBCe1-A and NBCe1-B in rat kidney proximal tubule and striated ducts of salivary glands during acid-base disturbances
Am J Physiol Regulatory Integrative Comp Physiol, December 1, 2007; 293(6): R2400 - R2411.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
B. V. Alvarez, E. N. Vithana, Z. Yang, A. H. Koh, K. Yeung, V. Yong, H. J. Shandro, Y. Chen, P. Kolatkar, P. Palasingam, et al.
Identification and Characterization of a Novel Mutation in the Carbonic Anhydrase IV Gene that Causes Retinitis Pigmentosa
Invest. Ophthalmol. Vis. Sci., August 1, 2007; 48(8): 3459 - 3468.
[Abstract] [Full Text] [PDF]

Home page
 PhysiologyHome page
A. C. Fry and F. E. Karet
Inherited Renal Acidoses
Physiology, June 1, 2007; 22(3): 202 - 211.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Cell Physiol.Home page
P. M. Piermarini, I. Choi, and W. F. Boron
Cloning and characterization of an electrogenic Na/HCO3- cotransporter from the squid giant fiber lobe
Am J Physiol Cell Physiol, June 1, 2007; 292(6): C2032 - C2045.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
C. Plata, C. R. Sussman, A. Sindic, J. O. Liang, D. B. Mount, Z. M. Josephs, M.-H. Chang, and M. F. Romero
Zebrafish Slc5a12 Encodes an Electroneutral Sodium Monocarboxylate Transporter (SMCTn): A COMPARISON WITH THE ELECTROGENIC SMCT (SMCTe/Slc5a8)
J. Biol. Chem., April 20, 2007; 282(16): 11996 - 12009.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Renal Physiol.Home page
H. C. Li, E. Y. Li, L. Neumeier, L. Conforti, and M. Soleimani
Identification of a novel signal in the cytoplasmic tail of the Na+:HCO3- cotransporter NBC1 that mediates basolateral targeting
Am J Physiol Renal Physiol, April 1, 2007; 292(4): F1245 - F1255.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
L. R. Gawenis, E. M. Bradford, V. Prasad, J. N. Lorenz, J. E. Simpson, L. L. Clarke, A. L. Woo, C. Grisham, L. P. Sanford, T. Doetschman, et al.
Colonic Anion Secretory Defects and Metabolic Acidosis in Mice Lacking the NBC1 Formula Cotransporter
J. Biol. Chem., March 23, 2007; 282(12): 9042 - 9052.
[Abstract] [Full Text] [PDF]

Home page
 J. Physiol.Home page
I. Choi, H. Soo Yang, and W. F. Boron
The electrogenicity of the rat sodium-bicarbonate cotransporter NBCe1 requires interactions among transmembrane segments of the transporter
J. Physiol., January 1, 2007; 578(1): 131 - 142.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Cell Physiol.Home page
A. M. Toye, M. D. Parker, C. M. Daly, J. Lu, L. V. Virkki, M. F. Pelletier, and W. F. Boron
The human NBCe1-A mutant R881C, associated with proximal renal tubular acidosis, retains function but is mistargeted in polarized renal epithelia
Am J Physiol Cell Physiol, October 1, 2006; 291(4): C788 - C801.
[Abstract] [Full Text] [PDF]

Home page
 J. Am. Soc. Nephrol.Home page
W. F. Boron
Acid-Base Transport by the Renal Proximal Tubule
J. Am. Soc. Nephrol., September 1, 2006; 17(9): 2368 - 2382.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
K. Shirakabe, G. Priori, H. Yamada, H. Ando, S. Horita, T. Fujita, I. Fujimoto, A. Mizutani, G. Seki, and K. Mikoshiba
IRBIT, an inositol 1,4,5-trisphosphate receptor-binding protein, specifically binds to and activates pancreas-type Na+/HCO3- cotransporter 1 (pNBC1)
PNAS, June 20, 2006; 103(25): 9542 - 9547.
[Abstract] [Full Text] [PDF]

Home page
 JGPHome page
S. D. McAlear, X. Liu, J. B. Williams, C. M. McNicholas-Bevensee, and M. O. Bevensee
Electrogenic Na/HCO3 Cotransporter (NBCe1) Variants Expressed in Xenopus Oocytes: Functional Comparison and Roles of the Amino and Carboxy Termini
J. Gen. Physiol., May 30, 2006; 127(6): 639 - 658.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Renal Physiol.Home page
A. Pushkin and I. Kurtz
SLC4 base (HCO3-, CO32-) transporters: classification, function, structure, genetic diseases, and knockout models
Am J Physiol Renal Physiol, March 1, 2006; 290(3): F580 - F599.
[Abstract] [Full Text] [PDF]

Home page
 J. Am. Soc. Nephrol.Home page
S. Horita, H. Yamada, J. Inatomi, N. Moriyama, T. Sekine, T. Igarashi, Y. Endo, M. Dasouki, M. Ekim, L. Al-Gazali, et al.
Functional Analysis of NBC1 Mutants Associated with Proximal Renal Tubular Acidosis and Ocular Abnormalities
J. Am. Soc. Nephrol., August 1, 2005; 16(8): 2270 - 2278.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Renal Physiol.Home page
H. C. Li, P. Szigligeti, R. T. Worrell, J. B. Matthews, L. Conforti, and M. Soleimani
Missense mutations in Na+:HCO3- cotransporter NBC1 show abnormal trafficking in polarized kidney cells: a basis of proximal renal tubular acidosis
Am J Physiol Renal Physiol, July 1, 2005; 289(1): F61 - F71.
[Abstract] [Full Text] [PDF]

Home page
 J. Physiol.Home page
N. Abuladze, R. Azimov, D. Newman, P. Sassani, W. Liu, S. Tatishchev, A. Pushkin, and I. Kurtz
Critical amino acid residues involved in the electrogenic sodium-bicarbonate cotransporter kNBC1-mediated transport
J. Physiol., June 15, 2005; 565(3): 717 - 730.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
279/50/52238    most recent
M406591200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dinour, D.
Right arrow Articles by Romero, M. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dinour, D.
Right arrow Articles by Romero, M. F.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2004 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement