JBC Anatrace, Inc.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M407695200 on September 24, 2004

J. Biol. Chem., Vol. 279, Issue 50, 52353-52360, December 10, 2004
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
279/50/52353    most recent
M407695200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Morgan, H. D.
Right arrow Articles by Petersen-Mahrt, S. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Morgan, H. D.
Right arrow Articles by Petersen-Mahrt, S. K.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Activation-induced Cytidine Deaminase Deaminates 5-Methylcytosine in DNA and Is Expressed in Pluripotent Tissues

IMPLICATIONS FOR EPIGENETIC REPROGRAMMING*

Hugh D. Morgan{ddagger}§, Wendy Dean{ddagger}, Heather A. Coker¶, Wolf Reik{ddagger}**, and Svend K. Petersen-Mahrt¶||{ddagger}{ddagger}

From the {ddagger}Laboratory of Developmental Genetics and Imprinting, Developmental Genetics Programme, The Babraham Institute, Cambridge CB2 4AT, United Kingdom, the DNA Editing Laboratory, Cancer Research UK, Clare Hall Laboratories, South Mimms EN6 3LD, United Kingdom, and the ||Protein and Nucleic Acid Chemistry Division, Medical Research Council Laboratory of Molecular Biology, Cambridge CB2 2QH, United Kingdom

Received for publication, July 8, 2004 , and in revised form, September 7, 2004.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
DNA deaminases of the Aid/Apobec family convert cytosine into uracil and play key roles in acquired and innate immunity. The epigenetic modification by methylation of cytosine in CpG dinucleotides is also mutagenic, but this is thought to occur by spontaneous deamination. Here we show that Aid and Apobec1 are 5-methylcytosine deaminases resulting in a thymine base opposite a guanine. Their action can thus lead to C -> T transition mutations in methylated DNA, or in conjunction with repair of the T:G mismatch, to demethylation. The Aid and Apobec1 genes are located in a cluster of pluripotency genes including Nanog and Stella and are co-expressed with these genes in oocytes, embryonic germ cells, and embryonic stem cells. These results suggest that Aid and perhaps some of its family members may have roles in epigenetic reprogramming and cell plasticity. Transition in CpG dinucleotides is the most frequent mutation in human genetic diseases, and sequence context analysis of CpG transitions in the APC tumor suppressor gene suggests that DNA deaminases may play a significant role in tumor etiology.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
DNA in multicellular organisms is generally maintained intact during development and in various adult tissues. Notable exceptions to this rule are recombination in lymphoid tissues and immunoglobulin diversification during B cell development. These are initiated by the Rag recombinase, and by Activation induced cytidine deaminase (Aid or Aicda), respectively. Aid is required both for somatic hypermutation and for class switch recombination of immunoglobulin genes (1, 2). Aid is related to Apobec1, a known cytidine deaminase that acts on a specific RNA (for apolipoprotein B), converting a C residue to a U resulting in a premature stop codon (3). Although it was initially envisaged that Aid would also act on RNA (2), subsequent studies have shown that Aid can act as a cytosine deaminase on DNA in Escherichia coli (4), yeast (5), vertebrate cells (2, 6), and in vitro (7-9). Importantly, loss of uracil DNA glycosylase (UDG),1 which repairs U:G mismatches in DNA, affects both hypermutation and class switching (1, 10, 11). Thus the current more widely accepted model envisages that Aid deaminates C to U in the DNA of immunoglobulin genes, leading to somatic mutations or class switch recombination depending on the subsequent pathway of DNA repair (1).

In addition to Aid and Apobec1, there are other members of this deaminase family, including Apobec2 and Apobec3g. Some of these can mutate DNA in E. coli (12) and single-stranded DNA in vitro (13-15). Apobec3g is also known as the cellular Cem15 protein and is critical for innate immunity to retroviruses, partly by mutating viral single-stranded DNA (14). Thus Aid and Apobec3g (and perhaps other members of the family) have roles in acquired and innate immunity by mutating cytosine in DNA. An ancestral role of DNA deaminases in protecting the organism against invading DNA may hence have been adapted to mutating endogenous DNA to better combat pathogens (1).

Another mechanism for the protection of the genome against invading DNA such as transposable elements is by methylating their DNA at CpG dinucleotides (16). This leads to transcriptional silencing of transposons so that they cannot continue to spread. The methylation of cytosine also increases the rate of mutation of C (17) so that methylated transposons accumulate mutations. It is generally thought that this occurs by spontaneous deamination (17), because enzymes that can deaminate 5-methylcytosine (5meC) have not been identified. As a result the CpG dinucleotide has become depleted in species with CpG methylation. In addition to its role in genome defense, methylation is important for epigenetic gene regulation. This includes parental imprinting, X chromosome inactivation, and possibly more general gene regulatory mechanisms in development and differentiation (18, 19).

Recently it has been found that genomic patterns of DNA methylation are reprogrammed genome-wide in early embryos and in primordial germ cells (19-21). Reprogramming may be necessary for resetting the epigenetic state of the gametic genomes so that totipotency is restored to the embryonic genome. Epigenetic reprogramming involves demethylation, which can occur passively as a result of DNA replication in the absence of DNA methyltransferase 1 (16, 18-21). However, the dramatic demethylation of the paternal genome in the zygote before replication of DNA (22-24), and the rapid demethylation in primordial germ cells (25, 26) (PGCs) are likely to take place by a replication-independent mechanism. A number of mechanisms have been proposed for the loss of methylation (27), involving direct demethylation (28), oxidative demethylation (29), 5meC base excision repair (30), or nucleotide excision repair (27). However, no enzyme activity has been convincingly identified that can initiate these reactions (31-33).

We have asked whether cytosine deaminases can deaminate 5meC in DNA. We found that Aid and Apobec1 have 5meC deaminase activities, resulting in a thymine base opposite a guanine. If this mismatch is repaired, a methylated cytosine is replaced by an unmethylated one. If it is not repaired, it results in a C -> T transition mutation. The expression of Aid has previously been thought to be limited to lymphoid tissues, but embryonic tissues were not examined (34). Unexpectedly we found that Aid and Apobec1 are colocalized within a cluster of pluripotency genes and are expressed in oocytes and primordial germ cells, which undergo epigenetic reprogramming. This suggests new roles for DNA mutators in the physiology and pathology of DNA methylation.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Cloning and Expression of Sss I—The isopropyl 1-thio-{beta}-D-galactopyranoside-inducible Sss I expression cassette from the pCAL7 (New England Biolabs) plasmid was transferred into pACYC177 (NEB) by standard cloning techniques (details on request). The resulting plasmid, p15ASss I Kan, was transformed into a methylation restriction-deficient E. coli, ER1821 (Elisabeth Raleigh, NEB) (F-endA1 thi-1 supE44 spoT? rfbD? mcrA5 (mrr-hsdRMA-mcrB)1-::IS10) and checked for isopropyl 1-thio-{beta}-D-galactopyranoside-inducible methylation of DNA. We ensured the endogenous rpoB C1586 site could be methylated by bisulfite sequence analysis as described (23, 25) using rpoB-specific primers for bisulfite converted DNA (gttgttttttttgatagtagataggtagtg, ctcaatttataatccaaaacaacc). To quantitate the percentage methylation of a particular site, we isolated plasmid DNA from three independent cultures after induction of Sss I and digested them with CpG methylation-sensitive SnaBI. Digested or control undigested plasmids were transformed into a methylation non-restricting E. coli (ER1821). From this we were able to assess that in vivo methylation by Sss I caused protection of the restriction site on 82% of plasmids (unmethylated digested plasmid gave <1% transformation efficiency; see Fig. 1A). This was also consistent with the extent of methylation determined by agarose gel analysis of the digested plasmids (data not shown).



View larger version (45K):
[in this window]
[in a new window]
  		FIG. 1.
Aid deaminates 5meC in E. coli DNA. A, design of mutation assay to detect 5meC deamination. Expression of Sss I methyltransferase in E. coli leads to methylation of chromosomal DNA at CpG dinucleotides, including in the selectable marker rpoB at positions 1585 and 1586. Deamination by Aid of C results in U, and deamination by Aid of 5meC results in T. Without repair and following DNA replication, mutations will appear in the rpoB gene some of which confer rifampicin resistance (RifR) (4), including transition mutations at 1586. Viable clones are screened for the transition mutation at 1586 using a single nucleotide detection PCR assay. Regardless of the mutation, the PCR produces a constant size band (locus control PCR), but if 1586 is mutated from 5meC to T an additional band is produced because of the annealing of the detection oligonucleotide (rpoB1586 transitions). For the minority of occasions where the CpG at 1586 is not methylated, deamination would lead to a uracil, which would also give a positive band in the PCR screening assay. A representative example of the PCR screen is shown. Inset, Sss I-induced in vivo CpG methylation protects restriction of a plasmid by methylation sensitive SnaBI. Plasmids with a single SnaBI restriction site were isolated from a culture that had been grown in the absence or presence of Sss I methyltransferase. The independent plasmids were digested with restriction endonuclease SnaBI. Digested or control undigested plasmids were used to transform E. coli. The number of transformants represents the number of uncut or protected plasmids. The average percent protection by Sss I is 82%, compared with less than 1% without Sss I. B, -fold increase in transitions at rpoB1586 caused by expression of Aid and Sss I in three independent experiments. Values were calculated for each experiment from the fraction of median total number of transitions at rpoB1586 to the viable cell number. The mutation rate by Aid alone was arbitrarily set to 1. The expression of Sss I (and vector) results in transitions at rpoB1586 presumably because of spontaneous deamination of 5meC and lack of repair of the deaminated residue in E. coli. The expression of Aid in an Sss I background increases transitions at rpoB1586 by ~8-fold.

 
Screening for DNA Deamination at 5meCpG—Rifampicin screening was done as published (4) with modifications. Bacterial strains containing Aid with Sss I, Sss I without Aid (but with empty vector pTrc99A), Aid alone, and pTrc99A alone were induced with isopropyl 1-thio-{beta}-D-galactopyranoside for 24 h in culture. Rifampicin-resistant colonies were selected on 100 µg/ml rifampicin LB agar plates containing ampicillin (Aid plasmid) or kanamycin (Sss I plasmid) as appropriate. The median number of rifampicin resistant-colonies/number of viable cells was determined for each experiment consisting of 20 cultures/category (Aid and Sss I, vector and Sss I, Aid, vector). The CpG to CpA transition at the target site in rpoB was identified by a PCR assay that differentiates between the single nucleotide G or A at this position (1586). The screening primer (rpoB G -> A: ctgagattacgcacaaacgtca) with a 3'-A can only anneal when a G -> A transition has occurred at nucleotide position 1586 (1586G -> A), giving an expected product of 429 bp using rpoB reverse (caccgacggataccacctgctg) as the second primer. For the locus control PCR, forward (rpoB forward: ttggcgaaatggcggaaaacc) and reverse primers (rpoB reverse) always produce a band of 627 bp, irrespective of mutations, acting as an internal control for success of the PCR. The PCR screen was performed on two randomly selected rifampicin colonies from each of the cultures within a category. The frequency of the 5meC transition was calculated from the number of 5meC transitions (at rpoB1586) to the total number of mutations.

Preparation of Recombinant Aid and Apobec1—Human Aid was subcloned into a pET30 derived vector with a C-terminal His tag (plasmid sequences on request). Preparation of a rat Apobec1 expression vector was described previously (13). Production and purification of recombinant protein was as described (13).

UDG-based Deamination Assay—The assay was done as described previously (13) with minor modifications. Aid/Apobec1 samples (0.4-1 µl) were incubated at 37 °C for 15 min in 10 µl of buffer R (40 mM Tris, pH 8.0, 40 mM KCl, 50 mM NaCl, 5 mM EDTA, 1 mM dithiothreitol, 10% glycerol) with 2.5 pmol of 5'-biotinylated oligonucleotides, 3'-labeled with fluorescein. The oligonucleotides substrates SPM319-SPM330 are all based on 5'-biotin-ATAAGAATAGAATGAFFFFFA-ATGAATSSSSSATGAATAGTA-fluorescein-3' where F and S are the first and second motifs indicated in Fig. 2B. Oligonucleotides were purified on streptavidin magnetic beads (Dynal) and washed at 70 °C. Deamination was monitored by incubating the bead-immobilized oligonucleotides at 37 °C for 1 h with excess uracil-DNA glycosylase (1 unit, New England Biolabs). Resultant cleaved oligonucleotides were subjected to 15-20% PAGE-urea gel electrophoresis, and the fluorescent signal was detected with a FLA-5000 scanner (Fuji). Percent conversions were calculated from the scanned images, percent conversion = pixel volume cleaved product (minus background)/pixel volume cleaved product (minus background) + pixel volume substrate (minus background). Data for rate calculations were based on numerous experiments on SPM320 and SPM348 for C deamination, and SPM347 and SPM359 for the 5meC deamination. Other oligonucleotides used: SPM348ATTATTGTTATTAGCTATTTGTTTATTTGTTTATTTATTT-fluor, SPM351ATTATTGTTATTAGCGATTTGTTTATTTGTTTATTTATTT-fluor.



View larger version (46K):
[in this window]
[in a new window]
  		FIG. 2.
Deamination of 5meC by DNA deaminases in vitro. Oligonucleotides fluorescently labeled at their 3'-end and containing 5-methylcytosine or cytosine were incubated with purified recombinant protein for 15 min. Deamination was monitored by cleavage with UDG (U) or mTDG (T). A, Aid deaminates 5meC. The oligonucleotide SPM347 containing 5meC (lanes 1-6) or oligonucleotide SPM348 containing C (lanes 7-9) were incubated with or without Aid protein. Deamination was monitored by incubating the product with mTDG or UDG and detecting cleavageproduct by electrophoresis. The mTDG reaction requires a double-stranded mismatch; complementary oligonucleotides were annealed before the reaction (lane 4, no complementary oligonucleotide). UDG does not recognize the deamination product of 5meC (lane 5). Aid cannot deaminate 5meC in a double-stranded oligonucleotide (lane 6). An unmethylated single-stranded oligonucleotide reacted with Aid is recognized by UDG in single- or double-stranded form (lanes 7 and 8). B, a panel of unmethylated oligonucleotides (see "Experimental Procedures") were incubated with recombinant Aid for 15 min, and products were analyzed with UDG as above. The preferred target sequence for deamination is WRC. C, a panel of oligonucleotides with all cytosines methylated (except *, see "Experimental Procedures") were incubated with 3x as much recombinant Aid for 15 min, and products were analyzed with mTDG as above. Lanes 11 and 12 were as lanes 1-10 but with the oligonucleotides SPM354* and SPM356*, which contained a single unmethylated cytosine in the context ATC of the second target motif. D, the same panel of oligonucleotides with all cytosines methylated were incubated with purified Apobec1 for 15 min, and products were analyzed with mTDG as above.

 
TDG-based Deamination Assay—Samples were treated as above, except that an excess (5 pmol) of the reverse complement oligonucleotide was added after the bead isolation reaction, heated to 90 °C, and allowed to anneal by cooling slowly to room temperature. Deamination of 5-methylcytosine was monitored by incubating the double-stranded, bead-immobilized oligonucleotides at 47 °C for 1 h, with excess thymine DNA-glycosylase (2 units, Trevigen). Products were resolved and analyzed as above. The 5meC containing oligonucleotides substrates SPM356-SPM363 are all based on 5'-biotin-ATAAGAATAGAATGAFFFFGAATGAATSSSSSGATGAATAGTA-fluorescein-3' where F and S are the first and second motifs indicated in Fig. 2C, and each cytosine incorporated is methylated. Other oligonucleotides used were SPM279ATTATTGTTATTAAmeCGATTTGTTTATTTGTTTATTTATT-fluor, SPM281ATTATTGTTATTAGmeCGATTTGTTTATTTGTTTATTTATTT fluor, and SPM347ATTATTGTTATTAGmeCTATTTGTTTATTTGTTTATTTATTT-fluor.

Semiquantitative RT-PCR—Total RNA was isolated from various mouse tissues using Qiagen miniRNAeasy reagents (Qiagen, Germany). Random hexamer and SuperscriptII (Invitrogen) reagents were used to make cDNA. Primers for Aid (forward cagggacggcatgagacct and reverse tcagccttgcggtcttcaca), Apobec1 (forward ctctgtcatgatctggatagtcacac and reverse catcgcagcaacataagctcc), and Hprt (forward cctgctggattacattaaagcact and reverse gtcaagggcatatccaa) were used to amplify a PCR product from cDNA using Promega HotStarTaq. The amplification cycles were as follows: Aid and Apobec1, 95 °C 15 min, then 23-32 cycles of 94 °C 30 s, 65 °C 30 s, and 72 °C 30 s; Hprt, 95 °C 15 min, then 20-29 cycles of 94 °C 30 s, 55 °C 30 s, and 72 °C 30 s. For the amplification of Aid for 35-44 cycles, a nested approach was used with the first 20 cycles with outer primers (outer forward tttctttaccatttcaaaaatgtccg and outer reverse aatagtctttgaaggtcatgatccc) at 95 °C 15 min, 20 cycles of 94 °C 30 s, 63 °C 30 s, and 72 °C 30 s, then 15-24 cycles as above for Aid. The products were resolved on a 2% agarose gel, stained, scanned on a Fuji FLA-3000, and analyzed using Aidi v3 two-dimensional densitometry software. For Fig. 3C the intensity of the Hprt signal at 29 cycles was arbitrarily set to 100 units, and the intensity of the Aid signal at 32 cycles is displayed for each tissue relative to Hprt.



View larger version (28K):
[in this window]
[in a new window]
  		FIG. 3.
Organization and expression of Aid and Apobec1 genes. A, region of mouse chromosome 6 (Build 32 form Ensembl mouse genome browser) containing Aid (also known as Aicda), Apobec1 (with a small intestine and a liver and other tissues specific promoter), Gdf3, Dppa3 (also known as Stella), and Nanog genes. Coding exons are filled. B, detection of Aid transcript in unfertilized oocytes, ovary, E12.5 PGCs, and a comparable amount of mesenteric lymph node RNA as judged by Hprt product amplification. Random-primed RT-PCR was performed on total RNA from mouse tissues with Aid- and Hprt-specific primers. Total PCR cycles are shown; nested primers were used for Aid amplification of 35-44 cycles. C, the quantity of Aid product at 32 cycles (relative to Hprt product at 29 cycles set to 100) is shown for unfertilized oocytes, ovary, 8.5 and 9.5 days post coitum (dpc)-derived EG cell lines, 11.5 dpc whole genital ridge (GR, containing primordial germ cells), ES cells, adult lung, kidney, heart, 6-week male spleen, 6-week male thymus, mesenteric lymph node, brain, liver, and testes. D, detection of Apobec1 transcript in oocytes, ovary, and liver. RT-PCR was performed on total RNA using Apobec1- and Hprt-specific primers. E, summary of transcription profiles of genes in the Aid/Nanog cluster in pluripotent tissues (oocyte, EG/PGC, ES), immune system tissues, and other somatic tissues. Data are based on this work, EST databases, and published Northern, RT-PCR, in situ RNA hybridization, and knock-in reporter constructs.

 

   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
Aid Mutates 5meC in E. coli—We were interested to see whether we could identify DNA deaminases that can deaminate 5meC. Using the deaminase motif we isolated cDNAs for candidate deaminases in the mouse genome, and screened these initially for expression in oocytes and other pluripotent tissues (data not shown). One of the cDNAs that was expressed in oocytes was Aid. We therefore tested Aid in a modified E. coli genetic system (4) which makes use of mutations of Cs in the rpoB gene leading to resistance to rifampicin. Aid mutates predominantly three Cs in the rpoB gene, one of which (position 1586) is in a CpG dinucleotide.

We expressed the CpG specific methyltransferase Sss I in E. coli; bisulfite sequencing confirmed that the selectable rpoB gene was methylated at CpG residues including C1586 (not shown), and in vivo CpG methylation by Sss I was able to protect 82% of sites from restriction (Fig. 1A). We determined the relative frequency of deamination at the methylated C1586 in rpoB using rifampicin selection and a single nucleotide discriminating PCR assay (Fig. 1A). If the methylated C were not a substrate for Aid, there would be no increase in its mutation rate over that with Sss I alone. However, the mutation rate at the C1586 position of rpoB in three independent experiments was ~8-fold higher in E. coli with both Sss I and Aid than in those having only Sss I (Fig. 1B, Table I). Thus this experimental system demonstrates Aid has a 5meC deaminase activity. It is not possible to directly compare the relative activities of Aid as a C deaminase (Aid versus vector background) to Aid as a 5meC deaminase (Aid and Sss I versus vector and Sss I), because the repair systems for U:G (without Sss I) and T:G (with Sss I) are different and their relative efficiencies are not known. The increase in frequency of mutation with expression of Sss I alone may be in part because of spontaneous deamination. Whether Apobec1 and Apobec3g can deaminate 5meC could not be tested in the E. coli assay, because they do not mutate the C1586 position.


View this table:
[in this window]
[in a new window]
  		TABLE I
Median mutation frequency (x10-9), average -fold induction, and average percent transitions at rpoB1586 for three independent experiments Each median mutation frequency was determined from >16 independent cultures.

 
Aid and Apobec1 Deaminate 5meC in Vitro—We sought to confirm the 5meC deaminase activity of Aid biochemically, using the purified protein in a previously established DNA deamination assay (13) (Fig. 2). Oligonucleotides were methylated at a single CpG, and upon incubation with Aid any T resulting from deamination of 5meC was detected using a thermostable thymine DNA glycosylase from Methanobacterium thermoautotrophicum (mTDG). Aid showed strong deamination activity (Fig. 2A), which was dependent on the presence of the protein (lane 1 versus lane 2) and the substrate being single-stranded (lane 2 versus lane 6). Specific detection of deaminated 5meC by mTDG requires double-stranded DNA (lane 2 versus lane 4). Because mTDG can act on either T:G or U:G mismatches (35) (data not shown), we needed to verify that no U was produced from C that had remained unmethylated. UDG (36) was unable to cleave the Aid-treated oligonucleotide containing 5meC, while being able to cleave a control unmethylated oligonucleotide treated with Aid (lane 5 versus lane 8). The methylated oligonucleotide reacted with Aid was also not cleaved by SMUG, an enzyme that recognizes a number of mismatches including U and 5-hydroxy meC, but not T (37) (data not shown). A catalytic inactive mutation of Aid (E58G) did not show any deamination activity toward either the unmethylated or methylated C (data not shown). These experiments clearly show that Aid produces T from 5meC in DNA by deamination.

DNA deaminases require particular sequence motifs as targets, on unmethylated DNA Aid prefers the sequence WRC (A/T, A/G, C) in vivo and in vitro (8, 15, 38), which we confirmed with a panel of oligonucleotides containing different target motifs (Fig. 2B). In a subset of these oligonucleotides all Cs were replaced by 5meCs, and we found that the WRC motif is still the preferred target (Fig. 2C), with a minor difference. Although in the unmethylated oligonucleotides all four possible WRC targets were deaminated to the same extent, once methylated, there does appear to be a preference for AGC (Fig. 2C, lane 1 versus lane 2, lane 4 first motif versus lane 8 first motif). From Fig. 2A we estimate that the activity of Aid on 5meC is ~3-fold lower than on C in the context AGC (SPM347 lane 2, SPM348 lane 8). Oligonucleotides containing both methylated and unmethylated targets demonstrate that the sequence context of each cytosine can render the deamination reaction of 5meC equivalent to C (Fig. 2C, lane 11, AA5meC versus ATC), or 5meC preferred to C (Fig. 2C, lane 12, AGmeC versus ATC). For the analysis in Fig. 2C we used three times as much enzyme than in Fig. 2B. From Coomassie and Western analysis (data not shown) we estimate a turnover of 60-70 fmol/min/µg for unmethylated (SPM320 and SPM348) and 20-25 fmol/min/µg methylated C deamination (SPM347 and SPM359) based on a 15-min incubation of 2.5 pmol of substrate and an ~40% conversion rate using 1 and 3 µg of Aid, respectively. Deaminase activity on 5meC by purified Aid has been observed previously (7).

Apobec1 has also been shown to have C deaminase activity but could not be tested for 5meC deaminase activity in the E. coli assay. We previously showed that in vitro Apobec1 has a preference for NTC (13, 15). Apobec1 was also able to deaminate 5meC, but the target preference was considerably altered to AC (Fig. 2D). Thus both Aid and Apobec1 have 5meC deaminase activity in vitro that is affected by the sequence context.

Aid and Apobec1 Genes Are Colocalized with Nanog and Stella and Are Expressed in Pluripotent Tissues—Aid is thought to be exclusively expressed in B cells undergoing class switch recombination or somatic hypermutation (34) and thus finding it expressed in oocytes in our initial screen was unexpected. However, bioinformatic analysis revealed a striking arrangement of the Aid and Apobec1 genes within a 200-kb cluster of pluripotency genes, including Nanog, Stella (Dppa3), and Gdf3 on mouse chromosome 6 (Fig. 3A). Nanog and Stella have important roles in embryonic stem (ES) cell identity (39, 40) and preimplantation development (41), respectively, and all three genes are expressed in pluripotent tissues. We therefore carried out semiquantitative RT-PCR analysis of Aid mRNA and found high levels of expression in oocytes and ovaries, and moderate levels in embryonic germ (EG) cells, ES cells, E12.5 PGCs (isolated from genital ridges using a green fluorescent protein-expressing transgene) that undergo methylation reprogramming (25, 26), and the genital ridges of E11.5-12.5 embryos containing PGCs (Fig. 3, B and C). Apobec1 mRNA was also found in ovaries, oocytes (albeit at lower levels than Aid), and ES cells (Fig. 3D). The expression profiles of the five genes in the cluster are summarized in Fig. 3E; all genes are transcribed in pluripotent tissues that can undergo epigenetic reprogramming (oocytes, EG/PGC, ES cells). The clustered organization of the five genes is also found in the human genome (data not shown). To what extent regulatory elements for expression in pluripotent tissues are shared between the genes needs to be determined. It is interesting to note that Stella and Gdf3 are also expressed in lymphoid tissues (42).


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
We have identified Aid and Apobec1 as 5meC deaminases in DNA, which are co-organized and co-expressed with a cluster of pluripotency genes. These observations raise the hypotheses that Aid and other members of this family may have physiological roles in epigenetic reprogramming and perhaps pathological roles in contributing to transition mutations at CpGs in human genetic disease and cancer.

It is now firmly established that Aid, Apobec1, and Apobec3g can mutate cytosine in DNA in a variety of different systems, including mammalian cells (4-6, 12, 14). Because a considerable proportion of Cs in mammalian genomes is methylated in the CpG dinucleotide, it is of great importance to ask whether C deaminases can act on 5meC. Although E. coli cytosine deaminase can act on both free bases cytosine and 5-methylcytosine (43), no prediction is possible for the distantly related Aid/Apobec deaminases, which work exclusively in the context of DNA/RNA. A methyl group in the 5-position of cytosine can certainly lead to steric hindrance for enzymes that act on DNA (for example, restriction enzymes). On the other hand, the deamination reaction by Aid is thought to occur by nucleophilic attack on position 4 of the pyrimidine ring of cytosine (1), and this is not necessarily hindered by the methyl group in position 5. Our results clearly established that Aid and Apobec1 deaminate 5meC in single-stranded DNA. It is difficult to compare directly their relative activities on C and 5meC, but our findings suggest they are in the same order of magnitude with other factors likely to modulate activities in vivo. The difference between the rate of spontaneous deamination (44) of 5meC and the enzymatically catalyzed one is thus 5-6 orders of magnitude (calculated from Refs. 7 and 13).

The DNA deaminase activity of Aid poses a potential danger to the genome in cells in which the enzyme is expressed. Deaminated 5meC is particularly vulnerable to mutation, because the resulting T can escape correction if not immediately repaired while mispaired with G; U can always be recognized as an error in DNA. Indeed, the ectopic expression of Aid and of Apobec1 in mice causes cancer (45, 46), and the preferred target sequences of the C deaminases are found around many C transitions in oncogenes and tumor suppressor genes in human tumors (15). Our work reveals the preferred sequence context for Aid as a 5meC deaminase to be AG5meCG. We analyzed the sequence context of all CpG mutations leading to a premature stop codon of the APC tumor suppressor gene in colorectal cancer (47). The sequence context of the 27 possible CpGs is shown in Fig. 4A; yet in tumors, of 73 CpG mutations analyzed, 55 (75%) occurred in the preferred target for Aid, AG(C)G (Fig. 4B). This is an enrichment of over 25-fold over the expected frequency of random CpG mutations giving rise to a stop codon, and is consistent with the possibility that misregulated or mistargeted activity of Aid can cause CpG mutations in methylated DNA.



View larger version (25K):
[in this window]
[in a new window]
  		FIG. 4.
Sequence context of CpG mutations in the APC gene. The APC gene has 1264 possible codons that can be mutated to a stop codon by a single base change. Of these at least 500 are near the N terminus of APC, giving rise to a premature stop codon with an established phenotypic loss of function (47), of these, 27 are in CpGs. A, the sequence context (-1 and -2 of mutated C) of all 27 targets. B, the sequence context of C transition mutations in sporadic tumors (n = 73). (Data derived from Thierry Soussi APC data base).

 
The expression of Aid (and Apobec1) in pluripotent tissues, particularly in ovulated oocytes and in primordial germ cells, was unexpected. The transcripts of Aid in some of these tissues reach the same level as in lymphoid tissues. Aid expression in non-lymphoid tissues is thus particularly targeted to the tissues that undergo large scale epigenetic reprogramming, including demethylation, during development. There is no confirmed enzymatic pathway for demethylation of DNA (31-33). Our observations suggest that Aid, Apobec1, and perhaps other members of this protein family play a role in epigenetic reprogramming. Targeted deamination of 5meC can be repaired by mismatch glycosylases such as TDG (35) or Mbd4 (ref. 48), whose action could also initiate regional nucleotide excision repair. Although Aid has been knocked out in mice, there is no published analysis of any developmental phenotypes of these mice (49). Of particular importance are the reproductive performance and offspring phenotypes when breeding from homozygous parents. Alternatively, there could be redundancy with other 5meC deaminases (including Apobec1); thus a careful genetic analysis in vivo of all of the components of the pathway discovered here is needed to unravel the precise role in development of DNA deaminases.

In vivo the activity and targeting of Aid is likely to be tightly regulated, probably involving control of nuclear trafficking (50, 51), sequence preference (15, 38), the requirement for single-stranded DNA, and chromatin modifications (52). Both transcription and chromatin remodeling (53) can lead to the exposure of single-stranded DNA. Thus the large scale chromatin remodeling at fertilization that removes protamines from the sperm genome and replaces them with histones is likely to lead to a widespread exposure of single-stranded DNA. Single-stranded DNA could also be exposed by transcription or chromatin remodeling occurring during reprogramming in PGCs.

It is possible that similar pathways play similar roles in organisms other than mammals. In the seed plant Arabidopsis, the DNA glycosylase Demeter is required for the expression of the imprinted genes Medea and FWA and acts antagonistically to DNA methylation (54), suggesting that a similar system (perhaps involving yet unidentified 5meC deaminases) plays a role in epigenetic reprogramming in plants. In Neurospora, duplicated DNA becomes methylated and mutated at cytosines, which is likely to involve deamination (55). It is intriguing that the only enzymes thus far identified as being able to modify bases in DNA as part of a physiological process are DNA methyltransferases and DNA deaminases. Thus an ancestral system using methylases and deaminases to protect the organism from invading DNA may have evolved to take on additional roles in acquired immunity and the regulation of epigenetic information.


   FOOTNOTES
 
* This work was supported by the Medical Research Council, Biotechnology and Biological Sciences Research Council, and Cancer Research United Kingdom. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

§ Funded in part by a C. J. Martin Postdoctoral Fellowship. Back

{ddagger}{ddagger} Supported in part by the Arthritis Research Campaign. Back

** To whom correspondence should be addressed. E-mail: wolf.reik{at}bbsrc.ac.uk.

1 The abbreviations used are: UDG, uracil DNA glycosylase; 5meC, 5 methylcytosine; PGCs, primordial germ cells; EG, embryonic germ; ES, embryonic stem; E, embryonic day; mTDG, Methanobacterium thermoautotrophicum; RT, reverse transcription. Back


   ACKNOWLEDGMENTS
 
We thank C. Rada, S. Conticello, T. Lindahl, and M. Neuberger for advice and help, S. Andrews for help with bioinformatics, G. Durcova-Hills and A. McLaren for EG cells, G. Echenery for technical assistance, I. Watt for APOBEC1, E. Raleigh for E. coli strains, the oligosynthesis group at Cancer Research UK, and F. Santos for discussion.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Neuberger, M. S., Harris, R. S., Di Noia, J., and Petersen-Mahrt, S. K. (2003) Trends Biochem. Sci. 28, 305-312[CrossRef][Medline] [Order article via Infotrieve]
  2. Honjo, T., Kinoshita, K., and Muramatsu, M. (2002) Annu. Rev. Immunol. 20, 165-196[CrossRef][Medline] [Order article via Infotrieve]
  3. Scott, J. (1995) Cell 81, 833-836[CrossRef][Medline] [Order article via Infotrieve]
  4. Petersen-Mahrt, S. K., Harris, R. S., and Neuberger, M. S. (2002) Nature 418, 99-103[Medline] [Order article via Infotrieve]
  5. Poltoratsky, V. P., Wilson, S. H., Kunkel, T. A., and Pavlov, Y. I. (2004) J. Immunol. 172, 4308-4313[Abstract/Free Full Text]
  6. Martin, A., Bardwell, P. D., Woo, C. J., Fan, M., Shulman, M. J., and Scharff, M. D. (2002) Nature 415, 802-806[Medline] [Order article via Infotrieve]
  7. Bransteitter, R., Pham, P., Scharff, M. D., and Goodman, M. F. (2003) Proc. Natl. Acad. Sci. U. S. A. 100, 4102-4107[Abstract/Free Full Text]
  8. Pham, P., Bransteitter, R., Petruska, J., and Goodman, M. F. (2003) Nature 424, 103-107[CrossRef][Medline] [Order article via Infotrieve]
  9. Chaudhuri, J., Tian, M., Khuong, C., Chua, K., Pinaud, E., and Alt, F. W. (2003) Nature 422, 726-730[CrossRef][Medline] [Order article via Infotrieve]
  10. Rada, C., Williams, G. T., Nilsen, H., Barnes, D. E., Lindahl, T., and Neuberger, M. S. (2002) Curr. Biol. 12, 1748-1755[CrossRef][Medline] [Order article via Infotrieve]
  11. Imai, K., Slupphaug, G., Lee, W. I., Revy, P., Nonoyama, S., Catalan, N., Yel, L., Forveille, M., Kavli, B., Krokan, H. E., Ochs, H. D., Fischer, A., and Durandy, A. (2003) Nat. Immunol. 4, 1023-1028[CrossRef][Medline] [Order article via Infotrieve]
  12. Harris, R. S., Petersen-Mahrt, S. K., and Neuberger, M. S. (2002) Mol. Cell. 10, 1247-1253[CrossRef][Medline] [Order article via Infotrieve]
  13. Petersen-Mahrt, S. K., and Neuberger, M. S. (2003) J. Biol. Chem. 278, 19583-19586[Abstract/Free Full Text]
  14. Harris, R. S., Bishop, K. N., Sheehy, A. M., Craig, H. M., Petersen-Mahrt, S. K., Watt, I. N., Neuberger, M. S., and Malim, M. H. (2003) Cell 113, 803-809[CrossRef][Medline] [Order article via Infotrieve]
  15. Beale, R. C., Petersen-Mahrt, S. K., Watt, I. N., Harris, R. S., Rada, C., and Neuberger, M. S. (2004) J. Mol. Biol. 337, 585-596[CrossRef][Medline] [Order article via Infotrieve]
  16. Bestor, T. H. (2000) Hum. Mol. Genet. 9, 2395-2402[Abstract/Free Full Text]
  17. Jones, P. A., and Baylin, S. B. (2002) Nat. Rev. Genet. 3, 415-428[Medline] [Order article via Infotrieve]
  18. Jaenisch, R., and Bird, A. (2003) Nat. Genet. 33, 245-254
  19. Li, E. (2002) Nat. Rev. Genet. 3, 662-673[CrossRef][Medline] [Order article via Infotrieve]
  20. Reik, W., Dean, W., and Walter, J. (2001) Science 293, 1089-1093[Abstract/Free Full Text]
  21. Surani, M. A. (2001) Nature 414, 122-128[CrossRef][Medline] [Order article via Infotrieve]
  22. Mayer, W., Niveleau, A., Walter, J., Fundele, R., and Haaf, T. (2000) Nature 403, 501-502[Medline] [Order article via Infotrieve]
  23. Oswald, J., Engemann, S., Lane, N., Mayer, W., Olek, A., Fundele, R., Dean, W., Reik, W., and Walter, J. (2000) Curr. Biol. 10, 475-478[CrossRef][Medline] [Order article via Infotrieve]
  24. Dean, W., Santos, F., Stojkovic, M., Zakhartchenko, V., Walter, J., Wolf, E., and Reik, W. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 13734-13738[Abstract/Free Full Text]
  25. Hajkova, P., Erhardt, S., Lane, N., Haaf, T., El-Maarri, O., Reik, W., Walter, J., and Surani, M. A. (2002). Mech. Dev. 117, 15-23[CrossRef][Medline] [Order article via Infotrieve]
  26. Lee, J., Inoue, K., Ono, R., Ogonuki, N., Kohda, T., Kaneko-Ishino, T., Ogura, A., and Ishino, F. (2002) Development 129, 1807-1817[Abstract/Free Full Text]
  27. Cedar, H., and Verdine, G. L. (1999) Nature 379, 568-569
  28. Bhattacharya, S. K., Ramchandani, S., Cervoni, N., and Szyf, M. (1999) Nature 397, 579-583[CrossRef][Medline] [Order article via Infotrieve]
  29. Trewick, S. C., Henshaw, T. F., Hausinger, R. P., Lindahl, T., and Sedgwick, B. (2002) Nature 419, 174-178[CrossRef][Medline] [Order article via Infotrieve]
  30. Zhu, B., Zheng, Y., Hess, D., Angliker, H., Schwarz, S., Siegmann, M., Thiry, S., and Jost, J. P. (2000). Proc. Natl. Acad. Sci. U. S. A. 97, 5135-5139[Abstract/Free Full Text]
  31. Ng, H. H., Zhang, Y., Hendrich, B., Johnson, C. A., Turner, B. M., Erdjument-Bromage, H., Tempst, P., Reinberg, D., and Bird, A. (1999) Nat. Genet. 23, 58-61[Medline] [Order article via Infotrieve]
  32. Wade, P. A., Gegonne, A., Jones, P. L., Ballestar, E., Aubry, F., and Wolffe, A. P. (1999) Nat. Genet. 23, 62-66[Medline] [Order article via Infotrieve]
  33. Santos, F., Hendrich, B., Reik, W., and Dean, W. (2002) Dev. Biol. 241, 172-182[CrossRef][Medline] [Order article via Infotrieve]
  34. Muramatsu, M., Sankaranand, V. S., Anant, S., Sugai, M., Kinoshita, K., Davidson, N. O., and Honjo, T. (1999) J. Biol. Chem. 274, 18470-18476[Abstract/Free Full Text]
  35. Hardeland, U., Bentele, M., Jiricny, J., and Schar, P. (2003) Nucleic Acids Res. 31, 2261-2271[Abstract/Free Full Text]
  36. Lindahl, T. (1976) Nature 259, 64-66[CrossRef][Medline] [Order article via Infotrieve]
  37. Boorstein, R. J., Cummings, A., Jr., Marenstein, D. R., Chan, M. K., Ma, Y., Neubert, T. A., Brown, S. M., and Teebor, G. W. (2001) J. Biol. Chem. 276, 41991-41997[Abstract/Free Full Text]
  38. Yu, K., Huang, F. T., and Lieber, M. R. (2004) J. Biol. Chem. 279, 6496-6500[Abstract/Free Full Text]
  39. Mitsui, K., Tokuzawa, Y., Itoh, H., Segawa, K., Murakami, M., Takahashi, K., Maruyama, M., Maeda, M., and Yamanaka, S. (2003) Cell 113, 631-642[CrossRef][Medline] [Order article via Infotrieve]
  40. Chambers, I., Colby, D., Robertson, M., Nichols, J., Lee, S., Tweedie, S., and Smith, A. (2003) Cell 113, 643-655[CrossRef][Medline] [Order article via Infotrieve]
  41. Payer, B., Saitou, M., Barton, S. C., Thresher, R., Dixon, J. P., Zahn, D., Colledge, W. H., Carlton, M. B., Nakano, T., and Surani, M. A. (2003) Curr. Biol. 13, 2110-2117[CrossRef][Medline] [Order article via Infotrieve]
  42. Clark, A. T., Rodriguez, R. T., Bodnar, M. S., Abeyta, M. J., Cedars, M. I., Turek, P. J., Firpo, M. T., and Reijo Pera, R. A. (2004) Stem Cells 22, 169-179[Abstract/Free Full Text]
  43. Cohen, S. S., and Barner, H. D. (1957) J. Biol. Chem. 226, 631-642[Free Full Text]
  44. Ehrlich, M., Norris, K. F., Wang, R. Y., Kuo, K. C., and Gehrke, C. W. (1987) Biosci. Rep. 6, 387-393
  45. Okazaki, I. M., Hiai, H., Kakazu, N., Yamada, S., Muramatsu, M., Kinoshita, K., and Honjo, T. (2003) J. Exp. Med. 197, 1173-1181[Abstract/Free Full Text]
  46. Yamanaka, S., Balestra, M. E., Ferrell, L. D., Fan, J., Arnold, K. S., Taylor, S., Taylor, J. M., and Innerarity, T. L. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 8483-8487[Abstract/Free Full Text]
  47. Beroud, C., and Soussi, T. (1996) Nucleic Acids Res. 24, 121-124[Abstract/Free Full Text]
  48. Millar, C. B., Guy, J., Sansom, O. J., Selfridge, J., MacDougall, E., Hendrich, B., Keightley, P. D., Bishop, S. M., Clarke, A. R., and Bird, A. (2002) Science 297, 403-405[Abstract/Free Full Text]
  49. Muramatsu, M., Kinoshita, K., Fagarasan, S., Yamada, S., Shinkai, Y., and Honjo, T. (2000) Cell 102, 553-563[CrossRef][Medline] [Order article via Infotrieve]
  50. Ito, S., Nagaoka, H., Shinkura, R., Begum, N., Muramatsu, M., Nakata, M., and Honjo, T. (2004) Proc. Natl. Acad. Sci. U. S. A. 101, 1975-1980[Abstract/Free Full Text]
  51. McBride, K. M., Barreto, V., Ramiro, A. R., Stavropoulos, P., and Nussenzweig, M. C. (2004) J. Exp. Med. 199, 1235-1244[Abstract/Free Full Text]
  52. Nambu, Y., Sugai, M., Gonda, H., Lee, C. G., Katakai, T., Agata, Y., Yokota, Y., and Shimizu, A. (2003) Science 302, 2137-2140[Abstract/Free Full Text]
  53. Havas, K., Flaus, A., Phelan, M., Kingston, R., Wade, P. A., Lilley, D. M., and Owen-Hughes, T. (2000) Cell 103, 1133-1142[CrossRef][Medline] [Order article via Infotrieve]
  54. Xiao, W., Gehring, M., Choi, Y., Margossian, L., Pu, H., Harada, J. J., Goldberg, R. B., Pennell, R. I., and Fischer, R. L. (2003) Dev. Cell 5, 891-901[CrossRef][Medline] [Order article via Infotrieve]
  55. Freitag, M., Williams, R. L., Kothe, G. O., and Selker, E. U. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, 8802-8807[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 Toxicol SciHome page
J. M. Phillips and J. I. Goodman
Identification of Genes that May Play Critical Roles in Phenobarbital (PB)-Induced Liver Tumorigenesis due to Altered DNA Methylation
Toxicol. Sci., July 1, 2008; 104(1): 86 - 99.
[Abstract] [Full Text] [PDF]

Home page
 CarcinogenesisHome page
P. Perez-Duran, V. G. de Yebenes, and A. R. Ramiro
Oncogenic events triggered by AID, the adverse effect of antibody diversification
Carcinogenesis, December 1, 2007; 28(12): 2427 - 2433.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Endocrinol.Home page
R. Gallais, F. Demay, P. Barath, L. Finot, R. Jurkowska, R. Le Guevel, F. Gay, A. Jeltsch, R. Metivier, and G. Salbert
Deoxyribonucleic Acid Methyl Transferases 3a and 3b Associate with the Nuclear Orphan Receptor COUP-TFI during Gene Activation
Mol. Endocrinol., September 1, 2007; 21(9): 2085 - 2098.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Biol. CellHome page
C. T. Freberg, J. A. Dahl, S. Timoskainen, and P. Collas
Epigenetic Reprogramming of OCT4 and NANOG Regulatory Regions by Embryonal Carcinoma Cell Extract
Mol. Biol. Cell, May 1, 2007; 18(5): 1543 - 1553.
[Abstract] [Full Text] [PDF]

Home page
 Toxicol SciHome page
J. M. Phillips, Y. Yamamoto, M. Negishi, R. R. Maronpot, and J. I. Goodman
Orphan Nuclear Receptor Constitutive Active/Androstane Receptor-Mediated Alterations in DNA Methylation during Phenobarbital Promotion of Liver Tumorigenesis
Toxicol. Sci., March 1, 2007; 96(1): 72 - 82.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
M. Larijani, A. P. Petrov, O. Kolenchenko, M. Berru, S. N. Krylov, and A. Martin
AID Associates with Single-Stranded DNA with High Affinity and a Long Complex Half-Life in a Sequence-Independent Manner
Mol. Cell. Biol., January 1, 2007; 27(1): 20 - 30.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
C. Kress, H. Thomassin, and T. Grange
Active cytosine demethylation triggered by a nuclear receptor involves DNA strand breaks
PNAS, July 25, 2006; 103(30): 11112 - 11117.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
G. Cattoretti, M. Buttner, R. Shaknovich, E. Kremmer, B. Alobeid, and G. Niedobitek
Nuclear and cytoplasmic AID in extrafollicular and germinal center B cells
Blood, May 15, 2006; 107(10): 3967 - 3975.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
T. Morales-Ruiz, A. P. Ortega-Galisteo, M. I. Ponferrada-Marin, M. I. Martinez-Macias, R. R. Ariza, and T. Roldan-Arjona
DEMETER and REPRESSOR OF SILENCING 1 encode 5-methylcytosine DNA glycosylases
PNAS, May 2, 2006; 103(18): 6853 - 6858.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
G. Babbage, C. H. Ottensmeier, J.