Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M401625200 on September 22, 2004

J. Biol. Chem., Vol. 279, Issue 51, 53506-53515, December 17, 2004
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
279/51/53506    most recent
M401625200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lovmar, M.
Right arrow Articles by Ehrenberg, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lovmar, M.
Right arrow Articles by Ehrenberg, M.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Kinetics of Macrolide Action

THE JOSAMYCIN AND ERYTHROMYCIN CASES*{boxs}

Martin Lovmar{ddagger}, Tanel Tenson§, and Måns Ehrenberg{ddagger}

From the {ddagger}Department of Cell and Molecular Biology, Molecular Biology Program, BMC, Box 596, Uppsala University, S-75124 Uppsala, Sweden and §Institute of Technology, Tartu University, Riia 23, Tartu 51010, Estonia

Received for publication, February 13, 2004 , and in revised form, September 21, 2004.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Members of the macrolide class of antibiotics inhibit peptide elongation on the ribosome by binding close to the peptidyltransferase center and blocking the peptide exit tunnel in the large ribosomal subunit. We have studied the modes of action of the macrolides josamycin, with a 16-membered lactone ring, and erythromycin, with a 14-membered lactone ring, in a cell-free mRNA translation system with pure components from Escherichia coli. We have found that the average lifetime on the ribosome is 3 h for josamycin and less than 2 min for erythromycin and that the dissociation constants for josamycin and erythromycin binding to the ribosome are 5.5 and 11 nM, respectively. Josamycin slows down formation of the first peptide bond of a nascent peptide in an amino acid-dependent way and completely inhibits formation of the second or third peptide bond, depending on peptide sequence. Erythromycin allows formation of longer peptide chains before the onset of inhibition. Both drugs stimulate the rate constants for drop-off of peptidyl-tRNA from the ribosome. In the josamycin case, drop-off is much faster than drug dissociation, whereas these rate constants are comparable in the erythromycin case. Therefore, at a saturating drug concentration, synthesis of full-length proteins is completely shut down by josamycin but not by erythromycin. It is likely that the bacterio-toxic effects of the drugs are caused by a combination of inhibition of protein elongation, on the one hand, and depletion of the intracellular pools of aminoacyl-tRNAs available for protein synthesis by drop-off and incomplete peptidyl-tRNA hydrolase activity, on the other hand.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Macrolides form a large group of antibiotics that target the protein synthesis machinery (1, 2). All macrolides contain a 14-, 15-, or 16-membered lactone ring with sugar residues (2). This study concerns the action of two members of the macrolide family, erythromycin and josamycin. Erythromycin, a frequently used drug in the clinic (2), contains a 14-membered lactone ring, whereas josamycin contains a 16-membered lactone ring (Fig. 1A).



View larger version (84K):
[in this window]
[in a new window]
  		FIG. 1.
Structures of the macrolides in this study. A, chemical structures of the antibiotics discussed in this paper: josamycin, carbomycin A, and erythromycin. The crystal structure of carbomycin A (C) has been used to model the binding of josamycin, and the green ovals indicate the differences between these macrolides. Carbomycin A and erythromycin are color-coded according to their respective chemical structures. B, crystal structure of the Haloarcula marismortui 50 S subunit with a dipeptidyl-tRNA analogue in the A site (39). Parts of the analogue (caproic acid and biotin residues) are not shown for clarity. The N-terminal phenylalanine is shown in red, the next tyrosine residue in black, and A76 of tRNA in magenta. Nucleotides A2058, A2059, and A2062 (E. coli numbering) of the 23 S ribosomal RNA, essential for macrolide binding, are shown in green; A2451, an important component of the peptidyltransferase center (40–42), is shown in red, and C2452 is shown in blue. N3 of A2451 of 23 S RNA is shown in yellow, and the proteins L4 and L22 that form part of the tunnel wall (40–42) are shown in blue and yellow, respectively. C, carbomycin A bound to the H. marismortui 50 S ribosomal subunit (13). Carbomycin A has been used to illustrate josamycin-ribosome interactions in this study. These compounds have very similar chemical structures and have the same groups (mycaminose, mycarose, and isobutyrate residues) approaching the peptidyltransferase center (A). The lactone ring is shown in red, the mycaminose and mycarose residues in black, and the isobutyrate residue, which approaches the peptidyltransferase center, in magenta. D, erythromycin, bound to the Deinococcus radiodurans 50 S ribosomal subunit (12). The desosamine residue of erythromycin is shown in black and the cladinose moiety (not present in carbomycin A or josamycin) in magenta.

 
The molecular mechanism of macrolide action has remained puzzling during decades of scientific studies. All macrolides bind competitively to a site in the vicinity of the peptidyltransferase center (3), but direct inhibition of the peptidyltransferase reaction has been observed only for macrolides with 16-membered lactone rings (4, 5). Erythromycin, in contrast, allows synthesis of short peptides before nascent protein elongation is inhibited (5). Macrolides also induce drop-off of peptidyl-tRNAs from translating ribosomes both in vitro (6, 7) and in vivo (8). The macrolide induced drop-off events may be toxic for bacterial cells because accumulation of peptidyl-tRNA in the cell depletes pools of free tRNA isoacceptors (9–11).

Recently, high resolution crystal structures of several macrolides in complex with the large ribosomal subunit were obtained (12–16). Together with new biochemical data from a cell-free translation system (7), these structures have clarified some aspects of macrolide action. The crystal structures show that all macrolides bind to the beginning of the nascent peptide exit tunnel, with their C-5 sugars extending toward the peptidyltransferase center (Fig. 1). The biochemical data suggest a common mechanism for macrolide action, based on the space that is available between the peptidyltransferase center and the ribosome bound macrolide (7).

At the same time, several questions have remained unanswered. (i) Are the rate constants for peptidyl-tRNA drop-off enhanced by macrolides, or are these events an indirect consequence of the inhibition of the peptidyltransferase reaction by the drugs? (ii) At which step in the elongation cycle does peptidyl-tRNA drop-off occur? (iii) Do macrolides inhibit translocation of peptidyl-tRNA from the A to P site? (iv) Can protein synthesis be resumed by the dissociation of a macrolide that has caused ribosomal stalling? (v) Are the growth inhibitory effects of macrolides because of direct inhibition of protein elongation on the ribosome, or are they an indirect effect of depletion of tRNA pools because of frequent drop-off events and insufficient intracellular peptidyl-tRNA hydrolase activity?

In this study we have clarified some of these issues for the macrolides erythromycin and josamycin by studying their kinetic properties in a cell-free system for protein synthesis with Escherichia coli components of high purity (7, 17).


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Chemicals and Buffers
GTP, ATP, and [3H]Met were from Amersham Biosciences. Putrescine, spermidine, phosphoenolpyruvate, myokinase, and nonradioactive amino acids were from Sigma. Pyruvate kinase was from Roche Applied Science. Erythromycin was from Sigma. Josamycin was from ICN Biomedicals.

All experiments were performed in polymix buffer, containing 5 mM magnesium acetate, 5 mM ammonium chloride, 95 mM potassium chloride, 0.5 mM calcium chloride, 8 mM putrescine, 1 mM spermidine, 5 mM potassium phosphate, and 1 mM dithioerythritol (18).

mRNA
The template DNAs for in vitro transcription were prepared by annealing the following oligonucleotides at the complementary sequences (underlined) and filling the gaps by PCR: forward oligonucleotide, CTCTCTGGTACCGAAATTAATACGACTCACTATAGGGAATTCGGGCCCTTGTTAACAATTAAGGAGG, and reverse oligonucleotide for MVSN, TTTTTTTTTTTTTTTTTTTTTCTGCAGATTTAGTTAGAAACCATAGTATACCTCCTTAATTGTTAACAAGGGCCCG; reverse oligonucleotide for MFSN, TTTTTTTTTTTTTTTTTTTTTCTGCAGATTTAGTTAGAAAACATAGTATACCTCCTTAATTGTTAACAAGGGCCCG. The reverse oligonucleotide used to prepare the MS mRNA encoding the N-terminal fragment of the MS2 phage coat protein was described previously (7). In vitro transcription and purification of mRNAs containing a poly(A) tail were as described previously (19).

Protein Synthesis with Factors of High Purity
Components of the translation system were purified as described previously (7, 20).

Composition of the Translation Reactions
All experiments were performed in polymix buffer at 37 °C using equal volumes of preinitiated ribosomes and pre-formed ternary complexes containing EF-Tu,1 GTP, and aminoacyl-tRNA. The reactions were quenched by adding 10 volumes of 15% formic acid to 1 volume of reaction mixture, and the peptides were analyzed as described previously (7).

The initiation mixture, containing ribosomes (1.6 µM, ~50% active in peptidyl transfer), [3H]fMet-tRNAfMet (2 µM), mRNA 3.2 µM, IF2 (0,3 µM), IF1 (0.6 µM) and IF3 (0.6 µM), was preincubated for 10 min at 37 °C to allow for formation of initiated ribosome complexes.

The elongation mixture, containing EF-G (1.6 µM), EF-Tu (24 µM), EF-Ts (0.24 µM), and tRNAbulk (~0.18 mM), the relevant aminoacyl-tRNA synthetases (0.1 units/µl) (defined in Ref. 21), peptidyl-tRNA hydrolase (1.12 µM), and amino acids (160 µM each), was preincubated for 8 min at 37 °C to allow for formation of ternary complexes. In addition, both mixtures contained ATP (1 mM), GTP (1 mM), phosphoenolpyruvate (10 mM), myokinase (3 µg/ml), and pyruvate kinase (50 µg/ml).

Procedures
Kinetic Experiments with Quench-flow Techniques—Preinitiated ribosomes, formed in the absence or presence of josamycin, were rapidly mixed with the elongation mixture in a quench-flow instrument (KinTek Corp.), and the reaction was quenched with formic acid after different incubation times. The composition of peptides was determined by RP-HPLC, as described in Ref. 7.

Association Rate Constant for Josamycin—Josamycin at different concentrations (2, 3, 4, and 6 µM) was added to preinitiated ribosomes to start the incubation. One volume of elongation mix was added to 1 volume of reaction mix at each incubation time, and after 10 s the reaction was quenched with formic acid. The association rates were estimated from the fraction of tri-peptide-forming ribosomes.

Ratio between the Association Rate Constants for Erythromycin and Josamycin—An experiment, where josamycin and erythromycin competed for ribosome binding, was carried out by adding mixtures of josamycin and erythromycin to preinitiated ribosomal complexes. The josamycin concentration was 100 µM and the erythromycin concentration was varied between 0.5 and 16 µM. After 20 s of incubation, 1 volume of elongation mix was added to 1 volume of reaction mix, and the reaction was quenched by formic acid after 10 s. The extent of tri-peptide formation was analyzed as in the previous case.

Macrolide Dissociation Rate Constants from Chase Experiments—To determine the dissociation rate constants for josamycin and erythromycin, in a first experiment initiated ribosome complexes were formed in the presence of 4 µM josamycin during 10 min. Then 300 µM erythromycin was added to start the chase. At varying incubation times, 1 volume of elongation mixture was added to 1 volume of reaction mixture. The reaction was quenched with formic acid after 10 s, and the amount of tri-peptide formed was analyzed by RP-HPLC as in the previous experiments. The fraction of ribosomes competent in tri-peptide formation increased with a rate determined by the first order compounded rate constant kobs1.

In a second experiment, the initiated ribosome complexes were formed with 4 µM erythromycin by incubation for 10 min at 37 °C. Then 250 µM josamycin was added to start the chase. The reaction was stopped, and the extent of tri-peptide formation was analyzed as described above. The fraction of ribosomes competent in tri-peptide formation decayed with a rate determined by the compounded rate constant kobs2. Together with the association rate constants for josamycin (ka,J) and erythromycin (ka,E), the estimates of kobs1 and kobs2 were used to estimate the dissociation rate constants for josamycin (kd,J) and erythromycin (kd,E), as described below.

Peptidyl-tRNA Drop-off—Preinitiated ribosome complexes were mixed with translation factors including peptidyl-tRNA hydrolase. The reaction was quenched with formic acid after varying incubation times, and the amounts of peptides on the ribosome (pellet) and peptides originating from drop-off events (supernatant) were analyzed by RP-HPLC as described previously (7).

Quantitative Analysis
Translation and Drop-off Model—To estimate the compounded rate constants k1–k5 in Fig. 4 from the translation and drop-off experiments, we described the model with ordinary differential Equations 1–5,

{zbc0500454940eq1}(EQUATIONS 1-5)
where c1 is the concentration of initiation complex normalized to the concentration of active ribosomes; c2 and c3 are the normalized concentrations of di-peptide complexes before and after translocation, respectively. c4 is the normalized concentration of tri-peptide complex, and c5 is the normalized concentration of peptidyl-tRNA that has dissociated from ribosomes in drop-off events. In the translation experiments (Fig. 2) we could not separate c2 from c3, and therefore rate constants k2 and k3 were combined to k23 when fitting the model parameters to the experimental data as shown in Equation 6,

(Eq. 6)



View larger version (32K):
[in this window]
[in a new window]
  		FIG. 4.
Scheme for di- and tri-peptide formation with drop-off events. The scheme explains the kinetic model (see "Experimental Procedures") for di- and tri-peptide formation and drop-off events. This model was used to obtain the compounded kinetic parameters presented in Table II from the data in Fig. 2 and Fig. 5, A–D. Parameters: k1 is overall rate constant of di-peptide formation, k2 is translocation rate constant, k3 is rate constant of the second peptidyl transfer, k4 and k5 are rate constants of peptidyl-tRNA drop-off from A or P site, respectively.

 



View larger version (28K):
[in this window]
[in a new window]
  		FIG. 2.
Inhibition of di- and tri-peptide formation by josamycin. Formation and disappearance of fMet-Phe (A) or fMet-Val (B) followed by formation of fMet-Phe-Ser (A) or fMet-Val-Ser (B) in the presence or absence of josamycin. Di-peptides are represented by circles (open circles indicate without josamycin and filled circles indicate with josamycin). Tri-peptides are represented by triangles (open triangles indicate without josamycin and filled triangles indicate with josamycin). The solid lines were obtained from the model in Fig. 4 by fitting its parameter values (Table II) to the data in Fig. 2.

 
The equation system was solved analytically using Maple 7 (Waterloo Maple Inc.), and the solution was used to fit the parameters (k1 to k5) to the experimental data. The fitting was performed using the Marquardt algorithm (22) implemented in Origin 7 (OriginLab Corp.).

Rate Constants for Macrolide Binding to and Dissociation from Active Ribosomes—It has been suggested (23, 24) that macrolide antibiotics bind to the ribosome in two steps, according to Reaction 1,

(REACTION 1)
where S is free antibiotic; R is free ribosome; C1 is an initial weak complex, and C2 is a strong complex formed between the ribosome and the drug. When the total drug concentration s0 is much larger than the total ribosome concentration r0, then the kinetics of drug binding is described by two coupled linear differential equations, and the solution is always the sum of two exponentially decaying terms and one constant term. When k-1 >> k12, the first binding step equilibrates much faster than the subsequent strong binding of the drug. Elimination of the fast variable (25) can then be used to simplify the slow binding step according to Reaction 2 (26).

(REACTION 2)
Formation of C2 can then be approximated by Equation 7,

(Eq. 7)
c2(t) and are the current and equilibrium concentrations of C2, respectively. The compounded rate constant kobs is given by Equation 8,

(Eq. 8)
The binding of josamycin at different concentrations to the ribosome (Fig. 3A) can be described as a single step reaction, and the equilibration rate constant kobs is perfectly linear in the josamycin concentration (Fig. 3A, inset). Thus in this concentration interval, s0 << K and s0k12 >> k21, meaning that Equation 8 approximates to Equation 9.

(Eq. 9)
A putative pre-equilibrium complex C1 for ribosome bound josamycin must have a dissociation constant K larger than 5 x 10-5 M to be compatible with the observed linear dependence of kobs on s0 (Fig. 3A, inset).



View larger version (22K):
[in this window]
[in a new window]
  		FIG. 3.
Binding kinetics for josamycin and erythromycin. This set of experiments was used to determine binding kinetics for both josamycin and erythromycin. The equations used to fit the data points are shown under the "Experimental Procedures." A, fraction of ribosomes free of josamycin plotted as a function of the time after addition of different concentrations of josamycin. The josamycin-free ribosome fraction was determined by the extent of fMet-Phe-Ser formation, which occurs in the absence but not in the presence of josamycin. The concentrations were 2 µM ({blacksquare}), 3 µM (•), 4 µM ({blacktriangleup}), and 6 µM ({blacktriangledown}). Inset, the estimated rates are proportional to the concentration of josamycin. The slope gives the compounded association rate constant ka,J. B, the inverse of the fraction of josamycin-bound ribosomes plotted as a function of the ratio between the concentrations of erythromycin and josamycin in an experiment where the two drugs were added simultaneously to drug-free ribosomes. The incubation time was 20 s, and the fraction of josamycin-free ribosomes was obtained from the extent of tri-peptide formation at each point. C, the fraction of ribosomes, originally bound to josamycin, competent in tri-peptide formation plotted as a function of time after addition of erythromycin in 75-fold excess over josamycin. The reaction is described by a single exponential with the compounded rate constant kobs1. D, the fraction of ribosomes, originally bound to erythromycin, competent in tri-peptide formation plotted as a function of time after addition of josamycin in 62-fold excess over erythromycin. The reaction is described by a single exponential with the compounded rate constant kobs2. The rate constants were used to estimate the rate constants for dissociation of josamycin and erythromycin from the ribosome as described (see "Experimental Procedures").

 
To enhance the precision of the evaluation by accounting for the decrease of concentration of free josamycin, the data points in Fig. 3A were not fitted directly to Equation 7 but instead to Equation 10,

(Eq. 10)
where j0 is the total josamycin concentration, and r0 is the total concentration of active ribosomes.

When the two macrolide antibiotics, josamycin (J) and erythromycin (E), compete for the same binding site on the ribosome, their binding kinetics is described by Reaction 3, provided that the criteria for elimination of fast variables are fulfilled as in Reaction 2.

(REACTION 3)
In experiments at high concentrations j0 and e0 of J and E, respectively, the probability PJ that a ribosome becomes strongly bound to J rather than to E is given by Equations 11 and 12,

(Eq. 11)
so that

(Eq. 12)
The probability, PE, that the ribosome binds strongly to E instead, follows from conservation of probability as given in Equation 13.

(Eq. 13)
The compounded rate constants ka,J and ka,E are defined in analogy with ka in Equation 9 as given in Equation 14,

(Eq. 14)
The effective association rate constant ka,J or ka,E approximates either one of the association rate constants for drug binding in the pre-equilibrium complex C1 multiplied with the probability that it continues to the strong complex C2 instead of dissociating. The approximation is valid in the limit of high dissociation probability (k-1 >> k12), which brings Reaction 1 to Reaction 2. The experiment in Fig. 3B was designed with josamycin and erythromycin concentrations in large excess over the ribosome concentration. The incubation time (20 s) was long enough to allow for formation of a strong binding complex with either one of the drugs, as verified in experiments where the extent of binding was monitored as a function of time. The incubation time was also short enough to make exchange of drugs between their strong binding sites negligible (see Table I and below). The slope of the straight line in Fig. 3B was used to obtain the ratio between ka,E and ka,J according to Equation 12.


View this table:
[in this window]
[in a new window]
  		TABLE I
Josamycin and erythromycin ribosome binding kinetics

 
When ribosomes have been equilibrated with one macrolide and then another macrolide is added, there will be an exchange of macrolides strongly bound to the ribosome, and this can be monitored experimentally. In addition, when both macrolides are present in large excess over ribosomes as well as over their respective dissociation constants and the affinity of each drug to its strong binding site is large compared with its affinity to the pre-equilibrium site, the exchange kinetics takes a particularly simple form.

To see this, assume that all ribosomes are bound to a macrolide at all times. Assume further that kJ >> kd,J and kE >> kd,E so that the ribosomes are in one of their strong complexes CJ2 or CE2. Under those conditions, the full reaction dynamics can be accounted for as transitions between CJ2 and CE2 complexes (Reaction 5).

(REACTION 4)
The compounded rate constant kJE is the dissociation rate constant kd,J for J, leaving complex CJ2 multiplied with the probability PE that J will be replaced by E. Similarly, the compounded rate constant kEJ is the dissociation rate constant kd,E for E, leaving complex CE2 multiplied by the probability PJ that E is replaced by J (Equation 15).

(Eq. 15)
The time variation of the concentration cJ2 is determined by the differential Equation 16,

(Eq. 16)
The concentration cE2 of complex CE2 can be eliminated by the conservation relation cJ2 + cE2 = r0. With the relaxation rate kobs = kJE + kEJ, this gives Equation 17.

(Eq. 17)
Two chase experiments can be used to determine the dissociation rate constants kd,J and kd,E. In the first, ribosomes are pre-equilibrated with J and then E is added (relaxation rate kobs1, see Fig. 3C). In the second experiment, ribosomes are pre-equilibrated with E and then J is added (relaxation rate kobs2, see Fig. 3D). The dissociation rate constants follow from Equation 18,

(Eq. 18)
which has the solution shown in Equation 19,

(Eq. 19)
The approximations leading to Equation 19 require that the C2 complexes have much higher affinity than the C1 complexes and that the ribosomes are fully saturated with a macrolide at all times. We have estimated the pre-equilibriums for josamycin and erythromycin to be at least a factor of 10,000 or 100, respectively, weaker than their strong binding states, so that these criteria are fulfilled in the experiments in Fig 3, C and D. For the analysis in this section we have assumed for simplicity that the total drug concentrations are always much larger than the ribosome concentration. In some cases, the drug excess was only 3-fold, and here we have accounted for the disappearance of drugs from their free state by ribosome binding in our analysis.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
Josamycin and erythromycin belong to two different subclasses of the macrolide family and have been reported to inhibit protein synthesis in principally different ways (4). This study elucidates their modes of action with kinetic data from a cell-free translation system with pure E. coli components (7, 19).

Inhibition of Di- and Tripeptide Formation by Josamycin—It was proposed from the crystal structure of the 50 S ribosomal subunit in complex with carbomycin A, a macrolide very similar to josamycin (Fig. 1A), that the isobutyrate residue of the drug occupies the same site as the side chain of the amino acid on the aminoacyl-tRNA in the A site of the large subunit (Fig. 1C) (13). This is in line with results from biochemical experiments, showing that carbomycin A inactivates peptidyl transfer in an artificial system with puromycin as the acceptor and N-acetyl-Phe-tRNAPhe as the donor (4, 5). In contrast, experiments in a more realistic system with heteropolymeric mRNAs show that both fMet-Val-tRNAVal and fMet-Gly-Ile-tRNAIle can be formed on ribosomes in complex with josamycin (7). This suggests that the inhibitory action of josamycin can be affected by the identities of the amino acids on the tRNAs in the A and P sites as well as by the length of the amino acid chain on the peptidyl-tRNA in the P site. To study this phenomenon further, we prepared two different mRNAs: one encoding fMet-Phe-Ser and the other encoding fMet-Val-Ser. Ribosomes, initiated with either one of these mRNAs in the absence or presence of josamycin, were rapidly mixed in a quench-flow instrument with all components necessary for the formation fMet-Val-Ser or fMet-Phe-Ser tri-peptides. The amounts of di- and tri-peptides at different incubation times were quantified in an HPLC system with on-line radiometry, and the results are shown in Fig. 2. The kinetics of the four reactions could in each case be approximated by a scheme containing only one rate constant for di-peptide formation (k1) and one combined rate constant for tri-peptide formation (k23), including both the rate constant for translocation (k2) and second peptidyl transfer rate constant (k3) (Fig. 4).

In the absence of josamycin, k1 was 54 s-1 for fMet-Phe formation and 61 s-1 for fMet-Val formation. The rate constant k23 was 5.7 s-1 for fMet-Phe-Ser formation and 2.3 s-1 for fMet-Val-Ser formation in the absence of josamycin. In the presence of josamycin, k1 was about 0.06 s-1 for fMet-Phe formation and 14 s-1 for fMet-Val formation. The rate constant k23 was too slow to be detected both for fMet-Phe-Ser and fMet-Val-Ser formation in the presence of josamycin. We also studied the effects of erythromycin on the rate constants for di- and tri-peptide formation in the same two cases, and we found no inhibition of any rate constant for either of the two mRNAs (data not shown). In summary, the rate of di-peptide formation was inhibited about 1000-fold by josamycin in the formation of fMet-Phe, and only about 5-fold in the formation of fMet-Val. The rate of tri-peptide formation was reduced to virtually zero by josamycin, but the rates of both di- and tri-peptide formation were unaffected by erythromycin for both mRNAs. This means that ribosomes that contain josamycin can be separated from those that do not contain a macrolide or contain erythromycin by their ability to form the tri-peptide fMet-Phe-Ser. This kinetic difference between ribosomes containing josamycin and ribosomes that do not was used to obtain the complete binding kinetics of both josamycin and erythromycin, as will be described next.

Kinetics of Josamycin and Erythromycin Binding to the Ribosome—Josamycin and erythromycin bind competitively to the ribosome, but they block protein synthesis at different lengths of the nascent peptide (7). A ribosome that contains josamycin cannot form an fMet-Phe-Ser peptide, whereas a ribosome that contains erythromycin makes this tri-peptide with the same rate and efficiency as a macrolide-free ribosome (Fig. 2). By using this assay we only monitor the ribosomes that are active in peptidyl transfer. The advantage is that our results become independent of whether macrolides bind to the nonactive ribosomes or not, as long as we use macrolides in large stoichiometric excess over ribosomes.

To measure the rate constant for josamycin binding to the ribosome, we prepared ribosome complexes that were programmed with the mRNA encoding fMet-Phe-Ser and contained fMet-tRNAfMet in the P site. Then josamycin was added at different concentrations, and the ability of the ribosomes to form fMet-Phe-Ser was probed at varying incubation times by adding all factors necessary for tri-peptide formation. The elongation reaction was quenched after 10 s, and the labeled fMet was separated from di- and tri-peptides with RP-HPLC (7). The disappearance rate for ribosomes that were active in tri-peptide formation was estimated for four different josamycin concentrations (Fig. 3A), and the association rate constant (ka,J) was estimated to be 3.25 x 104 M-1 s-1.

To determine the rate constant for association of erythromycin to the same preinitiated ribosomes (ka,E), mixtures with high concentration of josamycin and erythromycin in different ratios were added to the initiation complexes. The fraction of josamycin-bound ribosomes, unable to rapidly form tri-peptides, was monitored. With this experimental design, one can neglect re-dissociation events after the initial binding step, meaning that the fraction of ribosome-bound josamycin corresponds to the probability that this drug, and not erythromycin, binds first to a ribosome. When the inverse of this probability was plotted versus the ratio between the erythromycin and josamycin concentrations (Fig. 3B), a straight line was obtained, with a slope (30.8) equal to the ratio between the association rate constants for erythromycin and josamycin. From the association rate constant for josamycin, we estimated the rate constant for erythromycin binding to the ribosome to be 30.8 x 3.25 x 104 = 1.0 x 106 M-1 s-1.

To determine the rate constants for dissociation of josamycin (kd,J) and erythromycin (kd,E) from active ribosomes, either josamycin or erythromycin was first added at a saturating concentration to the preinitiated ribosome complexes, and the binding reaction was allowed to equilibrate. The ribosomes, which had been saturated with josamycin, were then chased by a 75-fold excess of erythromycin over josamycin, and the gain in their ability to synthesize fMet-Phe-Ser was probed at varying incubation times. This gain reaction followed first order kinetics with a compounded rate constant kobs1 (Fig. 3C). To the ribosomes that had been saturated with erythromycin, josamycin was added at a 62-fold excess over erythromycin, and the loss in their ability to synthesize fMet-Phe-Ser was monitored at varying incubation times. Also this reaction followed first order kinetics, with a compounded rate constant kobs2 (Fig. 3D). The compounded rate constants kobs1 and kobs2 depend on the rate constants for dissociation of josamycin (kd,J) and erythromycin (kd,E) from the ribosome, the association rate constants for both drugs (ka,J and ka,E) as well as on their concentrations in the two experiments (see "Experimental Procedures"). Note that with an infinitely high concentration of the chasing compound, i.e. erythromycin in the first experiment and josamycin in the second, the observed rate constants would have been equal to the dissociation rate for the chased compound. From these data we estimated that kd,J = 1.8 x 10-4 s-1 and kd,E = 1.08 x 10-2 s-1. We estimated the equilibrium dissociation constant for josamycin (KD,J) to be 5.5 nM and the dissociation constant for erythromycin (KD,E) to be 10.8 nM. These experiments revealed that the average time for josamycin to dissociate from the ribosome is about 1.5 h, whereas it takes on average about 1.5 min for erythromycin to dissociate.

Peptidyl-tRNA Drop-off—It is known that macrolide treatment causes peptidyl-tRNA drop-off from ribosomes both in vitro (6, 7) and in vivo (8). However, it is not known whether macrolides enhance the rate constant for peptidyl-tRNA drop-off or whether this reaction is an indirect effect of macrolide-dependent stalling of ribosomes. It is also not known at which step in the elongation cycle the drop-off reaction can occur. To clarify those issues, we designed experiments that allowed selective monitoring of the josamycin-dependent rate of peptidyl-tRNA drop-off from the A and P sites of the ribosome. In a different type of experiment, we also measured the overall rate of erythromycin-induced drop-off of peptidyl-tRNA.

To study the josamycin-induced drop-off reaction, preinitiated ribosomes containing either mRNA encoding fMet-Val-Ser or mRNA encoding fMet-Phe-Ser were prepared as before (see the scheme of events in Fig. 4). To the first initiation complex was added the ternary complex containing EF-Tu, GTP, and Val-tRNAVal for formation of fMet-Val, and to the second initiation complex was added the ternary complex containing EF-Tu, GTP, and Phe-tRNAPhe for formation of fMet-Phe. The experiments were performed both in the absence and presence of EF-G·GTP. In the absence of EF-G, the di-peptidyl-tRNAs remained in the A site after peptidyl transfer, and in the presence of EF-G they were translocated to the P site (Fig. 4). When josamycin was present, the drug was either added to the preinitiated ribosomes or, alternatively, together with the ternary complexes so that peptide bond formation occurred before, rather than after, josamycin binding to the ribosome.

The drop-off reactions were monitored by the emergence of free di-peptides by the action of peptidyl-tRNA hydrolase that was present in the incubation mixtures at a high concentration. Peptidyl-tRNA hydrolase hydrolyzes free but not ribosome-bound peptidyl-tRNA (11) and rapidly created a free di-peptide after each drop-off event. Because the free di-peptides remained in the supernatant after formic acid precipitation, they could easily be distinguished from their corresponding di-peptidyl-tRNAs in the pellet. The results of the drop-off experiments are shown in Fig. 5 and are summarized in Table II.



View larger version (41K):
[in this window]
[in a new window]
  		FIG. 5.
Drop-off rates for josamycin and erythromycin. The amount of dipeptides as a fraction of the amount of active ribosomes was plotted as a function of time. The upper plot in each panel shows the amount of di-peptides bound to ribosomes, and the lower plot shows di-peptides dissociated from the ribosomes. A–D, the filled squares represent experiments where josamycin was added before formation of di-peptide; the half-filled squares indicate that the di-peptide was formed before binding of josamycin; and the empty squares are control experiments without josamycin. The lines are least square fittings to the model described in Fig. 4 resulting in parameters presented in Table II. The data points from the decrease of the ribosome-bound di-peptidyl tRNA have been fitted together with the increase in the corresponding dissociated di-peptidyl tRNA. E, the peptidyl-tRNA drop-off induced by erythromycin during translation of the MS mRNA encoding the N-terminal of the MS2 phage coat protein. These drop-off products contained six or seven amino acids and they were detected using RP-HPLC as described previously (7).

 


View this table:
[in this window]
[in a new window]
  		TABLE II
Compounded rate constants in the josamycin experiments (Fig. 4)

 
In the absence of josamycin, the rate constants for drop-off of fMet-Phe-tRNAPhe and fMet-Val-tRNAVal from the A site (k4) were 0.040 and 0.0080 s-1, respectively. The rate constants for drop-off of the same di-peptidyl-tRNAs from the P site (k5) were about an order of magnitude smaller and were estimated to be 0.0032 and 0.0011 s-1, respectively. In the presence of josamycin, added to the preinitiated ribosomes, the rate constants for drop-off from both A and P sites were considerably faster than in the absence of the macrolide. The rate constants for drop-off of fMet-Phe-tRNAPhe and fMet-Val-tRNAVal from the A site (k4) were in this case 0.26 and 0.086 s-1, respectively. The rate constants for drop-off of the same di-peptidyl-tRNAs from the P site (k5) in the presence of josamycin were 0.0091 and 0.011 s-1. This means that josamycin accelerated drop-off of fMet-Phe-tRNAPhe 6-fold from the A site and 3-fold from the P site. The drop-off of fMet-Val-tRNAVal was accelerated about 10-fold from both the A and P sites. Very similar drop-off rate constants were obtained when josamycin became ribosome-bound after peptidyl transfer and, when EF-G was present, after translocation (Table II). This comparison shows that the drop-off of peptidyl-tRNAs does not occur concomitantly with the peptidyl transfer or the translocation reaction but from the A site after peptidyl transfer or from the P site after translocation.

Measuring erythromycin-induced peptidyl-tRNA drop-off is technically more demanding, because erythromycin allows formation of peptides with lengths in the interval between six and eight amino acids before ribosomes are stalled and drop-off events occur (7). Ribosomes were initiated with fMet-tRNAfMet and an mRNA encoding the N-terminal fragment of the MS2 phage coat protein, as described earlier (7). After addition of all factors required for protein elongation, the extent of drop-off was monitored as a function of time from the amount of [3H]fMet-labeled peptides that by the action of peptidyl-tRNA hydrolase were rapidly cleaved off peptidyl-tRNAs that had dissociated from the ribosome in drop-off events caused by the presence of erythromycin (Fig. 5E). From these experiments, we obtained a drop-off rate constant of 8.7 x 10-3 s-1, which is comparable with the rate constants for drop-off of fMet-Val-tRNAVal and fMet-Phe-tRNAPhe from the ribosomal P site in the presence of josamycin (Table II).

Inhibition of Synthesis of Long Peptides by Erythromycin and Josamycin—At a saturating concentration of josamycin or erythromycin, all initiated ribosomes in a bacterial cell will carry either one of these macrolides. We wanted to examine whether the synthesis of long peptide chains, like full-length proteins, is completely shut down under those conditions, or whether residual synthetic activity remains. In the case of josamycin, a di-peptidyl-tRNA (Fig. 2) or a tri-peptidyl-tRNA (7) may form and then leave the ribosome in a drop-off event. The rate constants for drop-off are a hundred times larger (Table II) than the rate constant for dissociation of josamycin from the ribosome (Table I). Therefore, the probability that josamycin dissociates before the drop-off of the peptidyl-tRNA is expected to be less than ~1%, which leads to the prediction that josamycin at a saturating concentration will completely shut down the synthesis of long peptides. However, in the case of erythromycin, the situation is different. Here we measured the rate constant for erythromycin dissociation (10.8 x 10-3 s-1; Table I) to be in the same range as the drop-off rate constant of peptidyl-tRNA (8.7 x 10-3 s-1). The prediction here is that when erythromycin and a peptidyl-tRNA are simultaneously bound to a stalled ribosome, the drug will dissociate before drop-off of the peptidyl-tRNA in about 50% of the cases. When this happens, protein elongation will be resumed very rapidly, and the ribosome will become refractory to erythromycin (27, 28), which will allow the synthesis of long peptides like full-length proteins. From this, one can predict that even when the erythromycin concentration is high enough to saturate all initiated ribosomes, about 50% of residual synthesis of long peptides will remain.

These predictions were tested in experiments where the mRNA that encodes the first 12 amino acids of the N-terminal of the MS2 coat protein (7) was translated in the presence of varying concentrations of josamycin or erythromycin. At saturating josamycin concentrations, synthesis of the dodecapeptide was completely inhibited. At saturating erythromycin concentrations, in contrast, almost 40% of the ribosomes were able to synthesize the dodecapeptide (Fig. 6), in line with the hypothesis.



View larger version (13K):
[in this window]
[in a new window]
  		FIG. 6.
Inhibition of synthesis of a dodecapeptide by josamycin or erythromycin. The fraction of synthesis of a dodecapeptide plotted as a function of varying concentrations of josamycin ({blacktriangleup}) or erythromycin (•).

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
There are several reports in the literature on the mechanism of action of macrolide antibiotics. It has been found that 16-membered ring macrolides such as josamycin, but not 14-membered macrolides such as erythromycin, inhibit the peptidyltransferase (PT) reaction itself (4, 5). It has also been shown that both these types of macrolides cause peptidyl-tRNA drop-off from the ribosome (8). However, the kinetic relations between PT inhibition and drop-off have never been described, and the present results fill that gap in our knowledge. Josamycin was chosen as one of the model compounds, as it reaches close to the PT center (13) (Fig. 1) and abolishes synthesis of peptides containing more than three amino acids (7). Macrolides that do not reach the PT center allow formation of longer peptides, and erythromycin, which belongs to this sub-class, was chosen as the other model compound. The mechanisms of action of josamycin and erythromycin were studied in a cell-free translation system, reconstituted from pure E. coli components (7, 17).

We have found that josamycin decreases the PT rate constant for formation of fMet-Phe-tRNAPhe or fMet-Val-tRNAVal 1000- or 5-fold, respectively (Fig. 2; Table II). The rates of formation of the tri-peptides fMet-Phe-Ser and fMet-Val-Ser were virtually zero in the presence of josamycin (Fig. 2), whereas formation of the tri-peptide fMet-Gly-Ile has been observed previously (7). This demonstrates that the effects of josamycin on peptide synthesis strongly depend on both peptide length and amino acid sequence. Sequence effects have also been reported for erythromycin, which poorly inhibits polyphenylalanine synthesis (29–31) but strongly inhibits incorporation of basic amino acids into nascent peptides (32). Most interestingly, expression of erythromycin resistance genes is regulated with the help of the peptide sequence-specific inhibitory properties of erythromycin (33, 34).

We have also characterized the kinetics of binding of josamycin and erythromycin to active ribosomes, by taking advantage of the observation that formation of the tri-peptide fMet-Phe-Ser is totally inhibited by the presence of josamycin (Fig. 2) but unhindered by the presence of erythromycin (Table I). The effective rate constant for association of erythromycin to the ribosome is 1.0 µM-1 s-1 and about 30 times larger than the effective association rate constant for josamycin. The dissociation rate constant for the complex between erythromycin and the ribosome is about 0.01 s-1 and about 60 times faster than the corresponding parameter for josamycin. This very large difference in the dissociation rate constants for the two macrolides is in line with a suggestion, based on structural data, that carbomycin A, which is structurally similar to josamycin (Fig. 1A), forms a covalent bond with ribosomal RNA and that erythromycin does not (13).

Although the two drugs have very similar dissociation constants at about 10 nM, erythromycin associates to and dissociates from the ribosome much more rapidly than does josamycin (Table I). Slow-binding enzyme inhibitors have been extensively discussed by Morrison and Walsh (35), and it has been suggested that such reactions should occur in two steps (36). In line with this, it was found that a number of macrolides, including erythromycin, bind to ribosomes in two steps. First, the antibiotic forms a relatively weak complex that equilibrates rapidly with the free state. Second, the drug binds to a site with high affinity and a slow dissociation rate (23, 24, 37). In the present work we have not been able to detect such two-step mechanisms, but published erythromycin data obtained by Dinos and Kalpaxis (23) could still allow comparisons. We measure a KD value for erythromycin binding of 10 nM compared with 36 nM obtained from filter binding techniques or 4.2 nM obtained from bulk solution data (23). They report dissociation rate constants of 0.01 s-1 from filter binding and an order of magnitude slower dissociation for the reaction in bulk solution, and we obtain 0.01 s-1. We report an effective association rate constant of 1.0 x 106 M-1 s-1, and they observe 2.5 x 104 M-1 s-1 from filter binding or 2.5 x 105 M-1 s-1 from bulk solution experiments. Because our data were obtained from bulk solution, the appropriate comparison is with their bulk solution observations. The conclusion is that we have somewhat faster kinetics for binding and dissociation and somewhat lower affinity of the drug to ribosomes. These differences could all be explained as arising from different experimental conditions and, in particular, from the fact that our experiments were performed at 37 °C and theirs at 25 °C. Under the same conditions they observe a dissociation constant of 40 nM for a first binding step of the drug, whereas we fail to detect a two-step mechanism and estimate that such complexes must have a dissociation constant larger than about 1.0 µM. Our conclusion is in line with NMR data on erythromycin binding to ribosomes (38) but not with the conclusions drawn by Dinos and Kalpaxis (23). It is possible that also this difference can be accounted for by different experimental conditions, but a direct comparison between our experimental observations and those of Dinos and Kalpaxis (23) is difficult due to an inconsistency between their experimental observations and the exact version of their kinetic model. They have analyzed the data in their Fig. 5 (23) in terms of an approximation based on Equation A4 in their Appendix, and the same type of simplification has been used in later publications (24, 37). The approximation neglects the formation of stable ribosome-erythromycin complexes, and it is good up to about half a minute, but at longer incubation times there are large deviations between their approximation and their exact model (our Supplemental Material). In the long time range there are also large deviations between the exact model and the experimental data, whereas there is perfect correspondence between the approximate model and the experiments (23). However, because the approximation has meaning only when it agrees with the exact model, their experiments lack a consistent interpretation in terms of a kinetic model.

The main difference between josamycin and erythromycin is that the former has much slower binding and dissociation kinetics than the latter. The slow association rate constants for both josamycin and erythromycin imply that they are slow binding inhibitors according to the definition by Morrison and Walsh (35). The rate of binding of josamycin to the ribosome increases linearly with drug concentration from 0 to 6 µM (Fig. 3A). From this we infer that, if there is a first binding step for this antibiotic, it must have a dissociation constant larger than 50 µM, meaning that the affinity must be very low. This also means that the forward rate constant of a putative second step must be larger than 1.6 s-1.

We have found that the rate constants for drop-off of peptidyl-tRNAs increase with about an order of magnitude by the presence of josamycin (Table II), showing that these drop-off reactions are accelerated by the drug and not merely a side effect of inhibited PT reactions. Our kinetic analysis has revealed that the drop-off rate constants of peptidyl-tRNAs in the presence of josamycin (Table II) are more than 100-fold larger than the dissociation rate constant of the drug (Table I). At the same time, the drop-off rate constant of peptidyl-tRNA in the presence of erythromycin is comparable with the dissociation rate constant of the drug (Table II). From this, we predicted that synthesis of long peptides can be completely shut down by the presence of a saturating concentration of josamycin but not by a saturating concentration of erythromycin. These predictions were verified by experiments, where a dodecapeptide was synthesized at increasing concentrations of either josamycin or erythromycin (Fig. 6). This result is probably not specific for the particular nascent peptide sequence, because similar observations were made for an unrelated peptide (7).


   FOOTNOTES
 
* This work was supported by The Swedish Research Council, The Wellcome Trust International Senior Fellowship 070210/Z/03/Z, and Estonian Science Foundation Grant 5311. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

{boxs} The on-line version of this article (available at http://www.jbc.org) contains additional text. Back

To whom correspondence should be addressed: Dept. of Cell and Molecular Biology, Molecular Biology Program, BMC, Box 596, Uppsala University, S-75124 Uppsala, Sweden. Tel.: 46-18-471-42-13; Fax: 46-18-471-42-62; E-mail: ehrenberg{at}xray.bmc.uu.se.

1 The abbreviations used are: EF, elongation factor; RP-HPLC, reverse phase-high pressure liquid chromatography; PT, peptidyltransferase. Back



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Vázquez, D. (1979) Mol. Biol. Biochem. Biophys. 30, 169-175
  2. Walsh, C. (2003) Antibiotics: Actions, Origins, Resistance, pp. 57-63, American Society for Microbiology, Washington, D. C.
  3. Di Giambattista, M., Engelborghs, Y., Nyssen, E., and Cocito, C. (1987) J. Biol. Chem. 262, 8591-8597[Abstract/Free Full Text]
  4. Poulsen, S. M., Kofoed, C., and Vester, B. (2000) J. Mol. Biol. 304, 471-481[CrossRef][Medline] [Order article via Infotrieve]
  5. Mao, J. C., and Robishaw, E. E. (1971) Biochemistry 10, 2054-2061[CrossRef][Medline] [Order article via Infotrieve]
  6. Otaka, T., and Kaji, A. (1975) Proc. Natl. Acad. Sci. U. S. A. 72, 2649-2652[Abstract/Free Full Text]
  7. Tenson, T., Lovmar, M., and Ehrenberg, M. (2003) J. Mol. Biol. 330, 1005-1014, and references therein[CrossRef][Medline] [Order article via Infotrieve]
  8. Menninger, J. R., and Otto, D. P. (1982) Antimicrob. Agents Chemother. 21, 811-818[Abstract/Free Full Text]
  9. Heurgue-Hamard, V., Mora, L., Guarneros, G., and Buckingham, R. H. (1996) EMBO J. 15, 2826-2833[Medline] [Order article via Infotrieve]
  10. Tenson, T., Herrera, J. V., Kloss, P., Guarneros, G., and Mankin, A. S. (1999) J. Bacteriol. 181, 1617-1622[Abstract/Free Full Text]
  11. Heurgue-Hamard, V., Dincbas, V., Buckingham, R. H., and Ehrenberg, M. (2000) EMBO J. 19, 2701-2709[CrossRef][Medline] [Order article via Infotrieve]
  12. Schlunzen, F., Zarivach, R., Harms, J., Bashan, A., Tocilj, A., Albrecht, R., Yonath, A., and Franceschi, F. (2001) Nature 413, 814-821[CrossRef][Medline] [Order article via Infotrieve]
  13. Hansen, J. L., Ippolito, J. A., Ban, N., Nissen, P., Moore, P. B., and Steitz, T. A. (2002) Mol. Cell 10, 117-128[CrossRef][Medline] [Order article via Infotrieve]
  14. Schlunzen, F., Harms, J. M., Franceschi, F., Hansen, H. A., Bartels, H., Zarivach, R., and Yonath, A. (2003) Structure (Lond.) 11, 329-338[Medline] [Order article via Infotrieve]
  15. Berisio, R., Harms, J., Schluenzen, F., Zarivach, R., Hansen, H. A., Fucini, P., and Yonath, A. (2003) J. Bacteriol. 185, 4276-4279[Abstract/Free Full Text]
  16. Berisio, R., Schluenzen, F., Harms, J., Bashan, A., Auerbach, T., Baram, D., and Yonath, A. (2003) Nat. Struct. Biol. 10, 366-370[CrossRef][Medline] [Order article via Infotrieve]
  17. Freistroffer, D. V., Pavlov, M. Y., MacDougall, J., Buckingham, R. H., and Ehrenberg, M. (1997) EMBO J. 16, 4126-4133[CrossRef][Medline] [Order article via Infotrieve]
  18. Jelenc, P. C., and Kurland, C. G. (1979) Proc. Natl. Acad. Sci. U. S. A. 76, 3174-3178[Abstract/Free Full Text]
  19. Pavlov, M. Y., and Ehrenberg, M. (1996) Arch. Biochem. Biophys. 328, 9-16[CrossRef][Medline] [Order article via Infotrieve]
  20. Antoun, A., Pavlov, M. Y., Tenson, T., and Ehrenberg, M. M. (2004) Biol. Proced. Online http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=15103398
  21. Ehrenberg, M., Bilgin, N., and Kurland, C. G. (1990) in Ribosomes and Protein Synthesis: A Practical Approach (Spedding, G., ed) pp. 101-129, IRL Press at Oxford University Press, Oxford
  22. Marquardt, D. W. (1963) J. Soc. Indust. Appl. Math. 11, 431-441[CrossRef]
  23. Dinos, G. P., and Kalpaxis, D. L. (2000) Biochemistry 39, 11621-11628[CrossRef][Medline] [Order article via Infotrieve]
  24. Dinos, G. P., Connell, S. R., Nierhaus, K. H., and Kalpaxis, D. L. (2003) Mol. Pharmacol. 63, 617-623[Abstract/Free Full Text]
  25. Elf, J., and Ehrenberg, M. (2003) Genome Res. 13, 2475-2484[Abstract/Free Full Text]
  26. Dinos, G., Synetos, D., and Coutsogeorgopoulos, C. (1993) Biochemistry 32, 10638-10647[CrossRef][Medline] [Order article via Infotrieve]
  27. Andersson, S., and Kurland, C. G. (1987) Biochimie (Paris) 69, 901-904
  28. Contreras, A., and Vazquez, D. (1977) Eur. J. Biochem. 74, 539-547[Medline] [Order article via Infotrieve]
  29. Vester, B., and Garrett, R. A. (1987) Biochimie (Paris) 69, 891-900
  30. Chinali, G., Nyssen, E., Di Giambattista, M., and Cocito, C. (1988) Biochim. Biophys. Acta 951, 42-52[Medline] [Order article via Infotrieve]
  31. Chinali, G., Nyssen, E., Di Giambattista, M., and Cocito, C. (1988) Biochim. Biophys. Acta 949, 71-78[Medline] [Order article via Infotrieve]
  32. Mao, J. C., and Putterman, M. (1968) J. Bacteriol. 95, 1111-1117[Abstract/Free Full Text]
  33. Weisblum, B. (1995) Antimicrob. Agents Chemother. 39, 797-805[Medline] [Order article via Infotrieve]
  34. Tenson, T., and Ehrenberg, M. (2002) Cell 108, 591-594[CrossRef][Medline] [Order article via Infotrieve]
  35. Morrison, J. F., and Walsh, C. T. (1988) Adv. Enzymol. Relat. Areas Mol. Biol. 61, 201-301[Medline] [Order article via Infotrieve]
  36. Petropoulos, A. D., Xaplanteri, M. A., Dinos, G. P., Wilson, D. N., and Kalpaxis, D. L. (2004) J. Biol. Chem. 279, 26518-26525[Abstract/Free Full Text]
  37. Dinos, G. P., Michelinaki, M., and Kalpaxis, D. L. (2001) Mol. Pharmacol. 59, 1441-1445[Abstract/Free Full Text]
  38. Brennan, R. J., Awan, A., Barber, J., Hunt, E., Kennedy, K. L., and Sadegholnejat, S. (1994) J. Chem. Soc. Chem. Commun. 13, 1615-1617
  39. Schmeing, T. M., Seila, A. C., Hansen, J. L., Freeborn, B., Soukup, J. K., Scaringe, S. A., Strobel, S. A., Moore, P. B., and Steitz, T. A. (2002) Nat. Struct. Biol. 9, 225-230[Medline] [Order article via Infotrieve]
  40. Moore, P. B., and Steitz, T. A. (2002) Nature 418, 229-235[CrossRef][Medline] [Order article via Infotrieve]
  41. Nissen, P., Hansen, J., Ban, N., Moore, P. B., and Steitz, T. A. (2000) Science 289, 920-930[Abstract/Free Full Text]
  42. Ramakrishnan, V. (2002) Cell 108, 557-572[CrossRef][Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 Antimicrob. Agents Chemother.Home page
E. C. Kouvela, D. L. Kalpaxis, D. N. Wilson, and G. P. Dinos
Distinct Mode of Interaction of a Novel Ketolide Antibiotic That Displays Enhanced Antimicrobial Activity
Antimicrob. Agents Chemother., April 1, 2009; 53(4): 1411 - 1419.
[Abstract] [Full Text] [PDF]

Home page
 Antimicrob. Agents Chemother.Home page
T. Siibak, L. Peil, L. Xiong, A. Mankin, J. Remme, and T. Tenson
Erythromycin- and Chloramphenicol-Induced Ribosomal Assembly Defects Are Secondary Effects of Protein Synthesis Inhibition
Antimicrob. Agents Chemother., February 1, 2009; 53(2): 563 - 571.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
S. D. Moore and R. T. Sauer
Revisiting the mechanism of macrolide-antibiotic resistance mediated by ribosomal protein L22
PNAS, November 25, 2008; 105(47): 18261 - 18266.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
A. D. Petropoulos, E. C. Kouvela, G. P. Dinos, and D. L. Kalpaxis
Stepwise Binding of Tylosin and Erythromycin to Escherichia coli Ribosomes, Characterized by Kinetic and Footprinting Analysis
J. Biol. Chem., February 22, 2008; 283(8): 4756 - 4765.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Pharmacol.Home page
P. Karahalios, D. L. Kalpaxis, H. Fu, L. Katz, D. N. Wilson, and G. P. Dinos
On the Mechanism of Action of 9-O-Arylalkyloxime Derivatives of 6-O-Mycaminosyltylonolide, a New Class of 16-Membered Macrolide Antibiotics
Mol. Pharmacol., October 1, 2006; 70(4): 1271 - 1280.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
A. Raine, M. Lovmar, J. Wikberg, and M. Ehrenberg
Trigger Factor Binding to Ribosomes with Nascent Peptide Chains of Varying Lengths and Sequences
J. Biol. Chem., September 22, 2006; 281(38): 28033 - 28038.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
M. Lovmar, K. Nilsson, V. Vimberg, T. Tenson, M. Nervall, and M. Ehrenberg
The Molecular Mechanism of Peptide-mediated Erythromycin Resistance
J. Biol. Chem., March 10, 2006; 281(10): 6742 - 6750.
[Abstract] [Full Text] [PDF]

Home page
 RNAHome page
A. TSAGKALIA, F. LEONTIADOU, M. A. XAPLANTERI, G. PAPADOPOULOS, D. L. KALPAXIS, and T. CHOLI-PAPADOPOULOU
Ribosomes containing mutants of L4 ribosomal protein from Thermus thermophilus display multiple defects in ribosomal functions and sensitivity against erythromycin
RNA, November 1, 2005; 11(11): 1633 - 1639.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
279/51/53506    most recent
M401625200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lovmar, M.
Right arrow Articles by Ehrenberg, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lovmar, M.
Right arrow Articles by Ehrenberg, M.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2004 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement