Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M409889200 on October 7, 2004

J. Biol. Chem., Vol. 279, Issue 51, 53683-53690, December 17, 2004
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
279/51/53683    most recent
M409889200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Xu, L.
Right arrow Articles by Deng, X.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Xu, L.
Right arrow Articles by Deng, X.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Tobacco-specific Nitrosamine 4-(Methylnitrosamino)-1-(3-pyridyl)-1-butanone Induces Phosphorylation of µ- and m-Calpain in Association with Increased Secretion, Cell Migration, and Invasion*

Lijun Xu and Xingming Deng{ddagger}

From the University of Florida Shands Cancer Center, Department of Medicine and Department of Anatomy & Cell Biology, University of Florida, Gainesville, Florida 32610-0232

Received for publication, August 27, 2004


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Mounting evidence indicates that cigarette smoking not only promotes tumorigenesis but also may increase the spread of cancer cells in the body. However, the intracellular mechanism(s) by which cigarette smoking promotes metastasis of human lung cancer remains enigmatic. Nitrosamine 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK) is an important component in cigarette smoke and is formed by nitrosation of nicotine. µ- and m-calpain (calpain I and calpain II) are major members of the calpain family, which are ubiquitously expressed in both small cell lung cancer and non-small cell lung cancer cells. Our findings indicated that NNK potently induces phosphorylation of both µ- and m-calpain in association with their activation and increased migration as well as invasion of lung cancer cells. Treatment of cells with PD98059 blocked phosphorylation of m- and µ-calpain and resulted in suppression of NNK-induced cell migration and invasion. p44 MAPK/extracellular signal-regulated kinase 1 (ERK1) and p42 MAPK/ERK2 were activated by NNK, co-localized with µ- and m-calpain in cytoplasm, and directly phosphorylated µ- and m-calpain in vitro. These findings suggest a role for the ERK1/2 kinases as NNK-activated physiological calpain kinases. Specific knock-down of µ- and/or m-calpain expression by RNA interference blocked NNK-stimulated migration and invasion, suggesting that µ- and m-calpain may act as required targets in a NNK-induced metastatic signaling pathway. Furthermore, NNK promotes secretion of active µ- and m-calpain from lung cancer cells through vesicles, which may have the potential to cleave substrates in the extracellular matrix. Thus, NNK-induced cell migration and invasion may occur, at least in part, through a novel mechanism involving phosphorylation of calpains that leads to their activation and secretion, which may contribute to metastasis and/or progression of lung cancer.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Lung carcinoma metastasizes with a great frequency and often at an early stage, whereas primary growth is still small and asymptomatic (1). Several clinical studies in human present an association between smoking and an increase in metastasis of lung, breast and bladder cancers (1). Nitrosamine 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK)1 is formed by nitrosation of nicotine and has been identified as the most potent carcinogen in cigarette smoke (2). However, there have been no studies to determine whether cigarette smoke constituents, for example, NNK, can directly enhance migration and invasion of human lung cancer cells by influencing signal transduction mechanisms.

Migration and invasion of cells appear to be a result of a complex interplay between the numerous protein families participating in this process (3). Mechanisms of cell movement are important not only in the basic cellular and developmental process but also in the pathogenesis of various diseases (3). Tumor invasion is a complex process that involves cellular migration and interaction with the microenvironment at an ectopic site (4). Cell migration is a rate-limiting step in this process (5). Extravasating and metastatic cells have been observed to display active motility during these actions (6–8). Cancer cells initiate invasion by adhering along the blood vessel wall. Proteolytic enzymes, such as metalloproteases or cysteine proteases (i.e. calpains), dissolve tiny holes in the sheath-like covering (basement membrane) surrounding the blood vessels to allow cancer cells to invade (9, 10). Once the tumor cells enter the stroma, they can easily gain access to lymphatic and blood vessels for further dissemination (11).

Calpains are a family of 13 known intracellular cysteine proteases that share a similar catalytic structure (12). The major caplain species are µ-calpain (calpain I) and m-calpain (calpain II), which are ubiquitously and constitutively expressed in mammalian cells. A distinguishing feature of calpain activity is its ability to confer limited cleavage of protein substrates into stable fragments rather than complete proteolytic digestion (13). Thus, calpain-mediated proteolysis represents a major pathway of post-translational modification that influences various aspects of cell physiology including apoptosis, cell migration, and proliferation (13, 14). Calpain-regulated rear detachment enabling forward locomotion is required for cell migration (13). The rear detachment step appears to be regulated by convergent signaling from growth factors and integrin (15). Integrin-linked focal adhesion complexes provide the main adhesive links between the cellular actin cytoskeleton and the surrounding extracellular matrix (ECM). Several studies indicate that calpains localize to integrin-associated complexes. Furthermore, many of the protein components of focal adhesions are known substrates of calpains. Calpain cleavage of focal adhesion components, focal adhesion kinase, paxillin, talin, and possibly others promotes the disassembly of these complexes, contributing to reduced cell adhesion and increased motility (16, 17). Calpain inhibitor studies indicate that calpain activity is required specifically to release integrin contacts at the rear of cell to permit organized cell migration (18). Recent reports indicate that epidermal growth factor (EGF)-induced MAPK/ERK signaling activates calpains which contribute to detachment and increased motility (19, 20). Because NNK can potently activate ERK1/2 in human lung cancer cells (2), NNK may mimic growth factors (i.e. EGF) to enhance calpain activity through the MAPK/ERK signaling pathway leading to increased cell migration and/or invasion.

Several studies point to the importance of calpain activity during tumor development and invasion (13). It seems that calpain activity in cells is regulated by altering the Ca2+ concentration required for its proteolytic activity (21). µ- and m-calpain are named for their relative requirement for calcium, with µ-calpain requiring micromolar and m-calpain requiring near millimolar concentrations of calcium (21, 22). However, the Ca2+ concentrations required for proteolytic and other activities of the calpains are much higher than the 50–300 nM Ca2+ concentrations that exist in living cells (21). Thus, other mechanism(s) must be involved in activating calpains. Recent studies show that ERK directly phosphorylates and activates m-calpain both in vitro and in vivo, and phosphorylation of m-calpain at serine 50 is required for EGF-induced calpain activation (20, 22). Thus, phosphorylation, in addition to Ca2+ binding, may be another important mechanism for activation of calpains. Because ERK1 and ERK2 function as physiologic calpain kinases (22) and NNK potently activates these two protein kinases in human lung cancer cells (2, 23), NNK may promote lung cancer cell migration and invasion in a mechanism involving phosphorylation of calpains. Here we tested this hypothesis.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Materials—Anti-µ-calpain, m-calpain, ERK1, ERK2, fluorescein isothiocyanate-conjugated anti-goat IgG, and rhodamine-conjugated anti-rabbit IgG antibodies were obtained from Santa Cruz Biotechnology (Santa Cruz, CA). NNK was purchased from Toronto Research Chemicals (Toronto, Canada). PD98059, {alpha}-bungarotoxin ({alpha}-BTX), and calpeptin were purchased from Calbiochem (La Jolla, CA). Synthetic calpain substrate t-butoxy carbonyl-Leu-Met-chloromethylaminocoumarin (t-Boc-LM-CMAC) was obtained from Molecular Probes (Eugene, OR). The QCMTM chemotaxis 96-well cell migration assay kit and cell invasion assay kit were purchased from Chemicon International, Inc. (Temecula, CA). The µ-calpain ELISA kit was purchased from Oncogene (San Diego, CA). NCI-H69 cells were obtained from ATCC (Manassas, VA). m-Calpain antibody for the ELISA was purchased from ARB Affinity Bioreagents (Golden, CO). All reagents used were purchased from commercial sources unless otherwise stated.

Metabolic Labeling, Immunoprecipitation, and Western blot Analysis—NCI-H69 cells were washed with phosphate-free RPMI 1640 medium and incubated with [32P]orthophosphoric acid for 120 min. After treatment with agonist or inhibitor, cells were washed with ice-cold 1x PBS and lysed in detergent buffer. µ- or m-calpain was immunoprecipitated using µ- or m-calpain antibody, respectively. The samples were subjected to 10% SDS-PAGE, transferred to a nitrocellulose membrane, and exposed to Kodak X-Omat film at -80 °C for the time indicated. Phosphorylation of µ- or m-calpain was determined by autoradiography. The same filter was then probed by Western blot analysis with µ- or m-calpain antibody, respectively, and developed by using an ECL kit from Amersham Biosciences as described previously (24).

Analysis of µ- or m-Calpain Phosphorylation in Vitro—µ- or m-calpain was immunoprecipitated from lysates of NCI-H69 cells using µ- or m-calpain antibody, respectively. The immunoprecipitated µ- or m-calpain was resuspended in a kinase assay buffer containing 10 mM Hepes, pH 8.0, 100 µM ATP, 10 mM MgCl2, 1 mM dithiothreitol, 0.5 mM benzamidine, and 2 µCi of [{gamma}-32P]ATP. Purified, activated ERK1 or ERK2 enzyme (0.5 µg) was added and incubated for 30 min at 30 °C. The reaction was stopped by the addition of 2x SDS sample buffer and boiling the sample for 5 min. The samples were analyzed by SDS-PAGE, and phosphorylation of µ- or m-calpain was determined by autoradiography as described above.

Immunofluorescent Staining—5 x 106 cells were washed with 1x PBS, plated on a glass slide, fixed with ice-cold methanol, and blocked with 10% donkey serum. Then, cells were incubated with a goat µ- or m-calpain and a rabbit ERK1 or ERK2 primary antibody for 90 min. After washing, samples were incubated with rhodamine-conjugated anti-rabbit and fluorescein isothiocyanate-conjugated anti-goat secondary antibodies for 60 min. Cells were washed with PBS and observed under a fluorescent microscope (Zeiss). Pictures were taken and colored with the same exposure setting for each experiment. To determine subcellular regions of protein co-localization, individual red- and green-stained images derived from the same field were merged using Openlab 3.1.5 software from Improvision, Inc. (Lexington, MA). Areas of protein co-localization appear yellow.

Detection of Calpain Activity in Living Cells—NCI-H69 cells were plated at 50–80% confluence in a glass chamber. The cells were treated with agonist or inhibitor in the presence of t-Boc-LM-CMAC (20 µM) for 30 min. Samples were then observed under a fluorescent microscope (excitation 329 nm, emission 409 nm) as described (19, 20).

Quantitative µ- or m-Calpain ELISA—The µ-calpain production in culture medium was measured using a µ-Calpain ELISA Assay Kit from Oncogene. This kit is designed to detect µ-calpain in tissue extracts, plasma, and serum. It uses a rabbit polyclonal antibody to the human µ-calpain large subunit immobilized on a microtiter plate to bind human µ-calpain. A highly purified native human µ-calpain was used as a standard. The m-calpain in culture medium was also analyzed by ELISA using m-calpain antibody from ARB Affinity Bioreagents. Cells were cultured in RPMI 1640 medium with 0.1% fetal bovine serum (FBS) and treated with agonist or inhibitor as indicated. After centrifugation (1200 rpm), the resulting supernatant (culture medium) was collected. µ-Calpain or m-calpain in the medium was assessed by ELISA. The absorbance of the samples was analyzed using a microplate (ELISA) reader. Each experiment was repeated three times, and data represent the mean ± S.D. of three determinations.

Cell Migration and Invasion Assay—Cells were treated with agonist or inhibitor as indicated. Cell migration was assessed using QCMTM chemotaxis 96-well cell migration assay kit (Chemicon) following the manufacturer's instructions. This new technique does not require cell labeling, scraping, washing, or counting. The 96-well insert and homogenous fluorescence detection format allows for large scale screening and quantitative comparison of multiple samples. Migratory cells on the bottom of the insert membrane are dissociated from the membrane when incubated with cell detachment buffer. These cells are subsequently lysed and detected by the patented CyQuant GR dye. This green fluorescent dye exhibits strong enhancement of fluorescence when bound to cellular nucleic acids. Samples were read with a fluorescent plate reader (Spectra Fluor, Tecan, Inc.) using a 480/520-nm filter set. Cell invasion was assessed using the Chemicon cell invasion assay kit according to the manufacturer's instructions. This assay was performed in an invasion chamber, which is a 24-well tissue plate with 12 cell culture inserts. The inserts contain an 8-µm pore size polycarbonate membrane over which a thin layer of ECMatrixTM is dried. The ECM layer occludes the membrane pores, blocking non-invasive cells from migrating through. Invasion cells migrate through the ECM layer and cling to the bottom of the polycarbonate membrane. The insert membrane with invaded cells on the bottom was placed in the wells with cell stain/dissociation solution after incubation and reincubated for 30 min at 37 °C. Absorbance was measured by microplate reader at 560 nm. Each experiment was repeated three times, and data represent the mean ± S.D. of three determinations.

Measurement of Calpain Activity in Culture Medium—Cells were incubated in low serum culture medium (0.1% FBS) in the presence or absence of NNK (100 pM) for 24 h. After centrifugation (1200 rpm), the resulting supernatant (culture medium) was collected and incubated with t-Boc-LM-CMAC (20 µM) at 37 °C for 30 min. Calpain activity was measured by fluospectrometry (Tecan Spectra Fluor) at excitation 329 nm and emission 409 nm.

Vector-based Gene Silencing of µ- or m-Calpain by RNA Interference—The µ- or m-calpain DNA target sequence for siRNA design is AAACTATAACCACTAGCTCGA or AAGATGGAGAATTCTGGATGT, respectively. This was determined by using an Ambion siRNA Target Finder according to the human µ- or m-calpain cDNA sequence. The µ- or m-calpain-specific hairpin siRNA insert (sense-loop-antisense) was determined using a computerized insert design tool based on a target sequence following instructions from the Ambion web site. Then, the oligonucleotide encoding the µ- or m-calpain-specific hairpin siRNA insert was synthesized and ligated into the pSilencerTM 2.1-U6 hygro vector (Ambion, Austin, TX). The pSilencerTM 2.1-U6 hygro plasmids bearing the µ- or m-calpain hairpin siRNA insert were transfected into NCI-H69 cells using LipofectamineTM 2000 according to the manufacturer's instructions. The stable clones persistently producing µ- or m-calpain siRNA were selected using hygromycin (0.8 mg/ml). The levels of µ- or m-calpain expression were analyzed by Western blot using µ- or m-calpain antibody, respectively.

Collection of Vesicles from Culture Medium—Media vesicles were collected according to the method of Nishihara et al. (25). 1 x 108 NCI-H69 cells were cultured in RPMI 1640 medium with 0.1% FBS in the presence or absence of various concentrations of NNK (0.1 or 100 nM) for 24 h. After treatment, samples were centrifuged at 500 x g for 10 min to pellet the cells. The supernatant was further centrifuged at 21,000 x g for 10 min to pellet the cell debris. To pellet the media vesicles, the resulting supernatant was centrifuged at 100,000 x g for 60 min in an ultracentrifuge (Beckman-Coulter, Optima XL-80K Ultracentrifuge with an SW 28 rotor). The pellets were washed with ice-cold PBS and then resuspended in 100 µl of buffer A (50 mM Tris-HCl, pH 7.5, 50 mM NaCl, 1 mM EDTA, 1 mM EGTA, and 5 mM 2-mercaptoethanol). Samples were mixed with 2x SDS sample buffer, boiled for 5 min, and then subjected to a 10% gradient SDS-PAGE. Levels of µ- or m-calpain in the media vesicle sample were analyzed by Western blotting using µ- or m-calpain antibody, respectively.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
NNK Induces Phosphorylation of Both µ- and m-Calpain in Association with Increased activity—The two calpains, µ- and m-calpain, are ubiquitously distributed in most tissues and are composed of a large 80-kDa subunit (i.e. µ- or m-calpain) bound to a common small 28-kDa subunit (calpain 4) (18, 26). Our results show that µ-calpain and m-calpain are expressed in both SCLC and NSCLC cells (Fig. 1A). This suggests that calpains may play an important role in regulating the development of human lung cancer. To test whether NNK can induce phosphorylation of µ-calpain or m-calpain, NCI-H69 cells were metabolically labeled with [32P]orthophosphoric acid and treated with NNK (100 pM) for various times. The results indicate that NNK potently stimulates phosphorylation of both endogenous µ- and m-calpain with a peak at 30 min in human SCLC NCI-H69 cells (Fig. 1B). Recent reports suggest that EGF-mediated calpain phosphorylation can activate calpain both in vitro and in vivo (20, 22). To determine the role of NNK-induced calpain phosphorylation in human lung cancer cells, calpain activity in living cells was performed using t-Boc-LM-CMAC, a synthetic calpain substrate, as described (19–20, 22). Cleavage of t-Boc-LM-CMAC by active calpains can induce retention of the chloromethylaminocoumarin portion of the molecule in the cells and can result in increased fluorescence (19). NCI-H69 cells were treated with NNK (100 pM) in the presence of t-Boc-LM-CMAC for 30 min. Calpain activity was assessed by fluorescent microscopy. Results indicate that NNK potently stimulates calpain activation (Fig. 1C). Because phosphorylation is sufficient for activation of calpain (20, 22), NNK-induced calpain activation may occur in a mechanism involving phosphorylation.



View larger version (41K):
[in this window]
[in a new window]
  		FIG. 1.
NNK induces phosphorylation of µ- and m-calpain in association with increased calpain activity. A, expression levels of µ- and m-calpain in various lung cancer cell lines were analyzed by Western blotting using µ- or m-calpain antibody, respectively. B, NCI-H69 cells expressing high levels of endogenous Bcl2 were metabolically labeled with [32P]orthophosphoric acid and treated with NNK (100 pM) for various times as indicated. µ- or m-calpain was immunoprecipitated using µ- or m-calpain antibody, respectively. Phosphorylation of µ- or m-calpain was determined by autoradiography (top). Western blot analysis using µ- or m-calpain antibody was performed to confirm and quantify µ- or m-calpain protein (bottom). C, NCI-H69 cells were incubated with t-Boc-LM-CMAC (20 µM) in the absence or presence of NNK (100 pM) for 30 min. Calpain activity was analyzed by fluorescent microscopy.

 
ERK1 and ERK2 Co-localize with µ- and m-Calpain in Cytoplasm, NNK Activates ERK1 and -2, and Active ERK1 and ERK2 Directly Phosphorylate µ- and m-Calpain in Vitro—To assess a potential direct role for ERK1 and -2 as physiological calpain kinases, subcellular distribution of ERK1/2 and calpains was examined by immunofluorescent staining. A goat polyclonal antibody against human µ- or m-calpain, rabbit polyclonal ERK1 or ERK2 antibody, and fluorescein isothiocyanate-conjugated anti-goat (green) or rhodamine-conjugated anti-rabbit (red) secondary antibodies were used so that cells could be simultaneously stained without cross-reaction. As shown in Fig. 2A, µ- or m-calpain is primarily co-localized with ERK1 or ERK2 in the cytoplasm of NCI-H69 cells. It is known that MAPK/ERK signaling is required for EGF-induced m-calpain activity (19–20). Our findings reveal that NNK potently induces phosphorylation of ERK1 and ERK2 in SCLC NCI-H69 cells (Fig. 2B), indicating that ERK1 and -2 may be physiological calpain kinases. The consensus phosphorylation site for the ERK substrates is characterized by a target serine/threonine residue located immediately amino-terminal to a proline residue in a putative proline-directed phosphorylation site (27). Interestingly, both µ- and m-calpain possess similarities to the phosphorylation consensus sequence Pro-X-Ser/Thr-Pro (12, 14). For example, m-calpain contains: Pro-Ser-50*-Phe-Pro, Pro-Asn-Thr-381*-Phe-Trp-Met-Asn-Pro, and Pro-Ser-490*-Thr-491*-Phe-Glu-Pro (22). To assess whether activated ERK1 and ERK2 can directly phosphorylate the endogenous calpains, µ-calpain or m-calpain was immunoprecipitated from lysates of NCI-H69 cells and incubated with purified and active ERK1 or ERK2 in a kinase assay buffer containing [{gamma}-32P]ATP as described under "Experimental Procedures." The results show that ERK1 and ERK2 directly phosphorylate both µ-calpain and m-calpain in vitro (Fig. 2C). These findings indicate that ERK1 and ERK2 may be physiological kinases for both µ- and m-calpain.



View larger version (41K):
[in this window]
[in a new window]
  		FIG. 2.
NNK induces activation of ERK1/2 and active ERK1/2 can directly phosphorylate µ- and m-calpain in vitro. A, NCI-H69 cells were fixed with methanol and incubated with goat µ- or m-calpain polyclonal antibodies and rabbit ERK1 or -2 antibodies. Fluorescence-conjugated secondary antibodies were used to visualize µ- or m-calpain (green) and ERK1 or -2 (red) localization patterns under a fluorescent microscope. Image analysis was performed as described under "Experimental Procedures." Red- and green-stained images were merged using Openlab 3.1.5 software. Areas of co-localization appear yellow. B, NCI-H69 cells were treated with various concentrations of NNK for 30 min. The cells were harvested, washed, and lysed in detergent buffer. Western blot analysis was performed to detect phosphorylated ERK1/2 (p-ERK1/2) or total ERK1/2 using a phospho-specific ERK antibody or a mixture of ERK1 and ERK2 antibodies. C, µ- or m-calpain was immunoprecipitated from cell lysates of NCI-H69 cells and incubated with purified activated ERK1 or ERK2 in an in vitro kinase assay as described under "Experimental Procedures." Phosphorylation of µ- and m-calpain was determined by autoradiography.

 
MEK Inhibitor PD98059 Blocks NNK-induced Phosphorylation of µ- and m-Calpain in Association with Decreased Calpain Activity—PD98059 has been shown to specifically inhibit MEK-mediated activation of MAPK ERK1/2 (28). To pharmacologically test whether ERK1 and ERK2 are involved in NNK-induced calpain phosphorylation and activation in vivo, NCI-H69 cells were metabolically labeled with [32P]orthophosphoric acid and treated with NNK (100 pM) in the absence or presence of various concentrations of PD98059 as indicated. The results show that PD98059 inhibits NNK-induced phosphorylation of µ- and m-calpain in a dose-dependent manner (Fig. 3A). Importantly, PD98059 significantly blocks NNK-induced calpain activation (Fig. 3B). This suggests that NNK-stimulated calpain phosphorylation may be necessary for calpain activity.



View larger version (40K):
[in this window]
[in a new window]
  		FIG. 3.
The MEK-specific inhibitor PD98059 suppresses NNK-induced phosphorylation of µ- and m-calpain in association with decreased calpain activity. A, NCI-H69 cells were metabolically labeled with [32P]orthophosphoric acid and treated with NNK (100 pM) in the absence or presence of various concentrations of PD98059. Phosphorylation of µ- or m-calpain was analyzed as described in the legend for Fig. 1B. B, NCI-H69 cells were incubated with t-Boc-LM-CMAC (20 µM) and treated with NNK (100 pM) in the absence or presence of PD98059 (10 µM) for 30 min. Calpain activity was analyzed by fluorescent microscopy.

 
The {alpha}7 Nicotinic Acetylcholine Receptor ({alpha}7 nAChR)-specific Inhibitor {alpha}-Bungarotoxin Blocks NNK-induced Phosphorylation in Association with Decreased Calpain Activity—{alpha}-BTX has been identified as a site-selective antagonist for {alpha}7 nAChR (29). Because {alpha}7 nAChR plays an important role in lung cancer cell signaling (29) and NNK is a site-selective high affinity agonist for the {alpha}7nAChR (23, 29), we tested whether {alpha}-BTX affects NNK-induced calpain phosphorylation in human SCLC cells. NCI-H69 cells were metabolically labeled with [32P]orthophosphoric acid and treated with NNK (100 pM) in the absence or presence of various concentrations of {alpha}-BTX. The results reveal that {alpha}-BTX potently inhibits NNK-induced phosphorylation of µ- and m-calpain in a dose-dependent manner (Fig. 4, A and B). A calpain activity assay using t-Boc-LM-CMA shows that {alpha}-BTX significantly blocks NNK-induced calpain activation (Fig. 4C). These findings suggest that NNK-induced phosphorylation and activation of calpain may occur through a signal transduction pathway involving {alpha}7 nAChR.



View larger version (47K):
[in this window]
[in a new window]
  		FIG. 4.
The {alpha}7 nAChR-specific inhibitor {alpha}-BTX inhibits NNK-induced phosphorylation of µ- and m-calpain and reduces calpain activity. A and B, NCI-H69 cells were metabolically labeled with [32P]orthophosphoric acid and treated with NNK (100 pM) in the absence or presence of various concentrations of {alpha}-BTX for 30 min. Phosphorylation of µ-calpain (A) or m-calpain (B) was analyzed as described for Fig. 1B. C, NCI-H69 cells were incubated with t-Boc-LM-CMAC (20 µM) and treated with NNK (100 pM) in the absence or presence of {alpha}-BTX (20 nM) for 30 min. Calpain activity was analyzed by fluorescent microscopy.

 
NNK Enhances Both Migration and Invasion of Human Lung Cancer Cells, Which Can Be Inhibited by PD98059 and {alpha}-BTX—Tumor cells possess a broad spectrum of migration and invasion mechanisms that are associated with enhanced tumor metastasis (30). Because calpains are involved in regulating cell migration and invasion (18, 22), NNK-induced phosphorylation and activation of calpains may promote migration and invasion of human lung cancer cells. To test this, NCI-H69 cells were treated with NNK (100 pM) in the absence or presence of various concentrations of PD98059 or {alpha}-BTX for 24 h. Cell migration was assessed using the Chemicon QCMTM 96-well migration assay kit as described under "Experimental Procedures." This new migration assay provides a quick and efficient system for quantitative determination of various factors on cell migration. Results reveal that NNK significantly enhances migration of human lung cancer cells (i.e. about 4-fold; Fig. 5A). Both PD98059 and {alpha}-BTX inhibit NNK-stimulated cell migration in a dose-dependent manner (Fig. 5A). Because our data indicate that NNK can induce phosphorylation and activation of calpains (Fig. 1), NNK-enhanced cell migration may occur, at least in part, through increased calpain activity.



View larger version (35K):
[in this window]
[in a new window]
  		FIG. 5.
NNK enhances the migration and invasion of NCI-H69 cells, which are inhibited by PD98059 or {alpha}-BTX. NCI-H69 cells were incubated with RPMI 1640 medium with 0.1% FBS and treated with NNK (100 pM) in the absence or presence of various concentrations of PD98059 or {alpha}-BTX for 24 h. Cell migration or invasion was assessed using a Chemicon QCMTM 96-well migration assay kit (A) or cell invasion assay kit (B), respectively. Each experiment was repeated three times; data represent the mean ± S.D. of three determinations.

 
The process of tumor cell invasion and metastasis is conventionally understood as the migration of individual cells that detach from the primary tumor, enter lymphatic vessels or the bloodstream, and seed in distant organs (30). Thus, cellular migration is a basic step in the cell invasion process (30, 31), and invasion through the ECM is a pivotal step in tumor metastasis. To assess whether NNK affects the invasion of human lung cancer cells, NCI-H69 cells were treated with NNK (100 pM) in the absence or presence of various concentrations of PD98059 or {alpha}-BTX for 24 h. Cell invasion was assessed using a cell invasion assay kit (Chemicon) as described under "Experimental Procedures." The results indicate that NNK significantly enhances the invasion of human lung cancer cells and that both PD98059 and {alpha}-BTX can block NNK-stimulated cell invasion (Fig. 5B).

Calpeptin, a calpain-specific inhibitor, is designed to bind specifically to the critical cysteine residue in the active site of calpain and prevent the binding and subsequent proteolysis of calpain substrates (32). Treatment of NCI-H69 cells with various concentrations of calpeptin not only blocks NNK-enhanced calpain activity but also inhibits NNK-stimulated cell invasion (Fig. 6), suggesting that calpain activity may be essential for NNK-induced invasion of lung cancer cells.



View larger version (31K):
[in this window]
[in a new window]
  		FIG. 6.
Calpeptin blocks NNK-induced calpain activation as well as cell invasion. A, NCI-H69 cells were incubated with t-Boc-LM-CMAC (20 µM) and treated with NNK (100 pM) in the absence or presence of calpeptin (10 µM) for 30 min. Calpain activity was analyzed by fluorescence microscopy. B, NCI-H69 cells were incubated with RPMI 1640 medium with 0.1% FBS and treated with NNK (100 pM) in the absence or presence of various concentrations of calpeptin for 24 h. Cell invasion was assessed using a Chemicon cell invasion assay kit. Each experiment was repeated three times; data represent the mean ± S.D. of three determinations.

 
µ- and m-Calpain May Be Required Targets for NNK-induced Migration and Invasion of Human Lung Cancer Cells— Because both µ- and m-calpain are ubiquitously expressed in human lung cancer cells (Fig. 1A), this suggests that calpains may be potential targets for control of lung cancer metastasis. Plasmids with RNA polymerase promoters driving the expression of hairpin siRNAs are used extensively to study gene function in mammalian cells (33). To genetically test whether µ- and m-calpain are required targets for NNK-induced cell migration and invasion, a vector-based stable gene silencing approach was employed for specific depletion of µ- or m-calpain or both from human lung cancer cells. The pSilencerTM 2.1-U6 hygro plasmids bearing the µ- or m-calpain hairpin siRNA insert were transfected into NCI-H69 cells using LipofectamineTM 2000. The stable clones persistently producing µ- or m-calpain siRNA were selected using hygromycin. For double silence of µ- and m-calpain, the pSilencerTM 2.1-U6 plasmids bearing µ- or m-calpain hairpin siRNA were co-transfected into NCI-H69 cells. Results indicate that cells expressing µ- or m-calpain siRNA display more than a 95% reduction of µ- or m-calpain protein expression (Fig. 7A). Importantly, disruption of individual µ- or m-calpain by RNA interference reduces NNK-induced migration and invasion of NCI-H69 cells by 40–50%, whereas the combination of both µ- and m-calpain siR-NAs blocks NNK-induced migration and invasion by more than 80% (Fig. 7, B and C), indicating a cumulative advantage for double silencing. These findings suggest that µ- and m-calpain are required targets in NNK-induced cell migration and invasion signaling.



View larger version (34K):
[in this window]
[in a new window]
  		FIG. 7.
Depletion of µ- and/or m-calpain by RNA interference blocks NNK-induced migration and invasion of NCI-H69 cells. A, The pSilencerTM 2.1-U6 hygro plasmids bearing the µ- or m-calpain hairpin siRNA insert were transfected into NCI-H69 cells using LipofectamineTM 2000. The levels of µ- or m-calpain expression were analyzed by Western blot using µ- or m-calpain antibody, respectively. B, and C, NCI-H69 cells expressing of µ- and/or m-calpain siRNA were treated with NNK (100 pM) for 24 h. Cell migration or invasion was measured using a QCMTM chemotaxis 96-well cell migration assay kit (B) or cell invasion kit (C), respectively. Each experiment was repeated three times; data represent the mean ± S.D. of three determinations.

 
NNK Stimulates Secretion of Calpains from Human Lung Cancer Cells—Interaction of cancer cells with ECM is essential for cancer cells to invade tissues and develop metastases. Because NNK potently promotes cell invasion, it is possible that NNK may facilitate calpain release from intracellular compartments into ECM, leading to cleavage of the ECM substrates. To test this potential mechanism, NCI-H69 cells were incubated with fresh culture medium and treated with NNK (100 pM) for various times. The µ- or m-calpain production in culture medium was measured using a µ- or m-calpain ELISA. Time course experiments show that NNK potently stimulates secretion of both µ- and m-calpain with a peak at 24 h (i.e. more than 3-fold increase; Fig. 8A). To test whether the released calpains in cell culture medium still remain activity, calpain activity in culture medium was assessed using t-Boc-LM-CMA as a substrate and analyzed with fluospectrometry. Interestingly, calpains in culture medium still have the ability to cleave t-Boc-LM-CMA (Fig. 8B), indicating that NNK-induced calpain release is a process of active secretion rather than cell destruction. Thus, NNK-induced calpain release may result in cleavage of ECM substrates (i.e. proteoglycan, fibronectin, etc.) (25) to facilitate invasion of tumor cells. To test whether phosphorylation of calpains is required for secretion from intracellular compartments into culture medium, NCI-H69 cells were treated with NNK in the absence or presence of various concentrations of PD98059 or {alpha}-BTX for 24 h. µ- or m-calpain in culture medium was assessed by ELISA using µ- or m-calpain antibody, respectively. Because either PD98059 or {alpha}-BTX potently blocks NNK-stimulated calpain secretion (Fig. 8, C and D), this indicates that inhibition of calpain phosphorylation by PD98059 or {alpha}-BTX (Figs. 3 and 4) is associated with decreased calpain secretion. These findings suggest that phosphorylation and activation of calpains may be required for their secretion. However, calpains have no signal peptide (25). NNK-induced secretion of calpains may occur through a nonclassical pathway. To test this, NCI-H69 cells were incubated with RPMI 1640 medium with 0.1% FBS in the presence or absence of NNK for 24 h. The media vesicles were collected as described under "Experimental Procedures." Western blotting analysis indicates that NNK significantly enhances both µ- and m-calpain in media vesicles (Fig. 9). Thus, NNK-stimulated calpain secretion may occur through a nonclassical pathway involving vesicles.



View larger version (38K):
[in this window]
[in a new window]
  		FIG. 8.
NNK promotes secretion of active µ- and m-calpain from SCLC cells, which is blocked by PD98059 or {alpha}-BTX. A, NCI-H69 cells were incubated with RPMI 1640 medium with 0.1% FBS and treated with NNK (100 pM) for various times as indicated. The µ-or m-calpain production in culture medium was measured by ELISA Assay using µ- or m-calpain antibodies as described under "Experimental Procedures." B, NCI-H69 cells were incubated with 0.1% FBS RPMI 1640 medium in the absence or presence of NNK (100 pM) for 24 h. After centrifugation (1200 rpm), the resulting supernatant (culture medium) was collected and incubated with t-Boc-LM-CMAC (20 µM) at 37 °C for 30 min. Calpain activity was measured by fluospectrometry (Tecan Spectra Fluor) at excitation 329 nm and emission 409 nm. C and D, NCI-H69 cells were incubated with 0.1% FBS RPMI 1640 medium and treated with NNK (100 pM) in the absence or presence of various concentrations of PD98059 (C) or {alpha}-BTX (D) for 24 h. The µ- or m-calpain production in culture medium was measured by ELISA using µ- or m-calpain antibodies. Each experiment was repeated three times; data represent the mean ± S.D. of three determinations.

 



View larger version (52K):
[in this window]
[in a new window]
  		FIG. 9.
NNK promotes secretion of µ- or m-calpain via vesicles. 1x108 NCI-H69 cells/sample were cultured in RPMI 1640 medium with 0.1% FBS in the presence or absence of various concentrations of NNK (0.1 or 100 nM) for 24 h. Media vesicles were collected as described under "Experimental Procedures." Protein from media vesicle fraction was subjected to 10% gradient SDS-PAGE. Levels of µ-calpain (top) or m-calpain (bottom) in the media vesicle sample were analyzed by Western blotting using µ- or m-calpain antibody, respectively. Total cell lysate (50 µg) was used as a control.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
Cigarette smoking not only initiates carcinogenesis but also promotes the spread of cancer in the body in various types of cancer including human lung and breast cancers (1, 34). For example, small cell lung cancer is a refractory tumor because of its earlier dissemination, easier relapse, and distant metastases, which is found in almost all smokers (35, 36). However, the intracellular signal mechanism by which cigarette smoking promotes metastasis and/or development of lung cancer remains elusive. The process of tumor cell invasion and metastasis is conventionally understood as the migration of individual cells that detach from the primary tumor, enter lymphatic vessels or the bloodstream and seed in distant organs (30). Cancer cells disseminate from the primary tumor either as individual cells, using amoeboid or mesenchymal type movement, or as cell sheets, stands, and clusters, using collective migration. Cancer cell migration is typically regulated by integrins, matrix-degrading enzymes (i.e. metalloproteases, calpains, etc.), cell-cell adhesion molecules, and cell-cell communication (30). Because the extracellular matrix forms a dense molecular meshwork so that cells cannot penetrate without proteolytic degradation of the matrix molecules (3), the proteolytic ability of the cell is a key factor in the processes of cell migration and invasion.

Calpain has been reported to be a positive regulator of cell migration and invasion because it localizes to focal adhesions and cleaves many focal adhesion-related proteins including integrin receptors, focal adhesion kinase, and talin (37). Recent studies reveal that epidermal growth factor-induced phosphorylation of m-calpain enhances its activity, which is required for fibroblast motility (19, 22). Our findings show that NNK, a cigarette smoke constituent, mimics growth factors to potently stimulate phosphorylation and activation of µ- and m-calpain in association with increased migration and invasion of SCLC NCI-H69 cells (Figs. 1 and 5). Similar results were obtained using NCI-H82 cells, another human lung cancer cell line (data not shown), indicating that NNK can stimulate migration and invasion of various lung cancer cells in a mechanism involving calpain phosphorylation.

NNK binds to and activates the {alpha}7 nAChR resulting in the opening of voltage-gated ion channels, the influx of Ca2+, and the activation of protein kinase C, which can trigger the Raf/MEK/ERK1/2 protein kinase cascade in SCLC (23, 29). Evidence reported here suggests that MAPKs ERK1 and -2 are physiological calpain kinases because NNK can potently activate ERK1 and -2 (Fig. 2) and the specific MEK/MAPK inhibitor PD98059 can inhibit NNK-induced calpain phosphorylation (Fig. 3). Furthermore, ERK1 and ERK2 co-localize with µ- or m-calpain in cytoplasm and can directly phosphorylate these two calpains in vitro (Fig. 2), indicating their potential direct role as physiological calpain kinases.

Nicotinic acetylcholine receptors are cationic channels in which the opening is controlled by acetylcholine and nicotinic receptor agonists. The {alpha}7 nAChR subunit has the property of functioning as a signal transduction molecule (38). The {alpha}7 nAChR is expressed in normal human small airway epithelial and SCLC cells (23, 29). The {alpha}7 nAChR-specific inhibitor {alpha}-BTX or the MEK/MAPK inhibitor PD98059 potently blocks NNK-induced phosphorylation of µ- and m-calpain in association with decreased calpain activity as well as decreased cell migration and invasion (Figs. 4 and 5). Thus, NNK-induced cell migration and invasion may occur through activation of the {alpha}7 nAChR signal transduction pathway involving {alpha}7 nAChR/ERK/calpain. These findings suggest that {alpha}-BTX or PD98059 may reduce calpain activity in a mechanism involving inhibition of their phosphorylation that dampens NNK-induced migration and invasion of human lung cancer cells. Metastatic tumor spreading is the primary cause of death in patients with cancer, and the ability to block the invasive and migratory capacity of tumor cells offers new drug design possibilities for the treatment of patients with malignant diseases. Therefore, {alpha}-BTX and PD98059 may have potential clinical relevance in strategies designed to restrain tumor invasion and/or metastasis through this novel mechanism in the treatment of patients with lung cancer.

Both µ- and m-calpain are calcium-dependent proteases (18). Because NNK not only stimulates phosphorylation of calpain but also binds to {alpha}7 nAChR and causes the opening of voltagegated ion channels leading to the influx of Ca2+ (23, 29), NNK-induced activation of calpains may occur in two mechanisms, which include phosphorylation and the influx of Ca2+. The functional relationship between these two mechanisms is currently unclear. It is well known that µ-calpain requires micromolar concentrations of Ca2+, whereas m-calpain requires millimolar concentrations for activation (18, 25). Thus, the Ca2+ concentrations required for proteolytic and other activities of the calpains are much higher than the Ca2+ concentrations that exist in living cells (i.e. 50–300 nM) (21), which would be expected to make calpain activation difficult in vivo (25). This helps to explain our findings that phosphorylation of calpain may be a required mechanism for its activation. It is possible that phosphorylation may enhance the sensitivity of calpains to Ca2+, effectively reducing the Ca2+ concentration required for their activation in vivo. Further study is required to demonstrate this hypothesis.

Because µ- and m-calpain may be potential promoters of cell migration and invasion and are ubiquitously expressed in both SCLC and NSCLC cells (Fig. 1A), targeting calpains may represent a novel therapeutic approach toward restraining metastasis and/or the development of lung cancer. Calpeptin can bind specifically to the critical cysteine residue in the active site of calpain to disrupt its activity (32). Interestingly, pretreatment of NCI-H69 cells with this calpain-specific inhibitor, calpeptin, completely blocks NNK-stimulated cell invasion (Fig. 6), suggesting that calpain may be a specific target in the NNK-induced cell invasion signaling pathway. Genetically, specific knock-down of µ- and/or m-calpain expression by RNA interference significantly reduces NNK-stimulated migration and invasion of SCLC NCI-H69 cells (Fig. 7), indicating that µ- and m-calpain may be required targets for NNK-induced metastasis of human lung cancer.

Calpain was generally believed to exist and function only in the cytoplasm. Recent studies indicate that m-calpain has also been detected in the extracellular space of tissue, which results from active secretion rather than cell destruction (25). For example, MC3T3-E1 cells (i.e. an osteoblast-like cell line) have been reported to secrete m-calpain, and zymography confirms that the secreted m-calpain is active (25). Here we provide the evidence that treatment of SCLC NCI-H69 cells with NNK potently promotes secretion of µ- and m-calpain from cells into the culture medium (Fig. 8A). Because the secreted calpains remain active (Fig. 8B), these active extracellular calpains may have the potential to cleave ECM leading to increased lung cancer cell invasion and/or metastasis.

In general, proteins that are secreted from cells have signal peptides (39). They enter the endoplasmic reticulum together with their signal peptides and are transferred via the Golgi apparatus to the plasma membrane. It has generally been thought that proteins lacking signal peptides could not be secreted. Because calpains do not have a signal peptide, which is an essential requisite for entering the endoplasmic reticulum and secretion via the classical pathway, a nonclassical pathway involving vesicles has been proposed in the process of calpain release (25). Because both µ- and m-calpain were detected in media vesicles, which could be enhanced by NNK (Fig. 9), NNK-stimulated secretion of calpain may occur by a mechanism involving vesicles. Importantly, PD98059 and {alpha}-BTX not only inhibit NNK-induced calpain phosphorylation but also block NNK-stimulated calpain secretion (Figs. 3, 4, and 8), indicating that phosphorylation of calpains may be essential for their secretion.

In summary, our studies identify a novel NNK-induced cell migration and invasion signal transduction pathway that depends on phosphorylation of calpains through activation of MAPKs ERK1 and -2 (Fig. 10). NNK-induced phosphorylation of µ- and m-calpain not only enhances their activities but also promotes their secretion, which leads to increased migration and invasion of human lung cancer cells (Fig. 10). Because calpains function as required targets of NNK-induced invasion and/or metastatic potential of human lung cancer cells, this may help to develop novel therapeutic strategies for the prevention and treatment of metastatic tumors from lung cancer by blocking the NNK-activated calpain upstream signaling pathways.



View larger version (27K):
[in this window]
[in a new window]
  		FIG. 10.
Proposed model of NNK-induced calpain phosphorylation and activation in regulating migration and invasion of human lung cancer cells. NNK not only induces the influx of Ca2+ but also potently activates a protein kinase C/Raf/MEK/ERK1/2 protein kinase cascade through the {alpha}7nAChR, which induces phosphorylation of both µ- and m-calpain leading to calpain activation and secretion, which may in turn promote migration and invasion of human lung cancer cells.

 

   FOOTNOTES
 
* This work was supported by a Flight Attendant Medical Research Institute Clinical Innovator Award and a start-up fund from the University of Florida Shands Cancer Center (to X. D.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

{ddagger} To whom correspondence should be addressed: University of Florida Shands Cancer Center, 1600 S.W. Archer Rd., Academic Research Bldg., R4-216, P. O. Box 100232, Gainesville, FL 32610-0232. Tel.: 352-392-9232; Fax: 352-392-5802; E-mail: xdeng{at}ufscc.ufl.edu.

1 The abbreviations used are: NNK, nitrosamine 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone; SCLC, small cell lung cancer; NSCLC, non-small cell lung cancer; nAChR, nicotinic acetylcholine receptor; MAPK, mitogen-activated protein kinase; ERK, extracellular signal-regulated kinase; MEK, MAPK/ERK kinase; {alpha}-BTX, {alpha}-bungarotoxin; ECM, extracellular matrix; t-Boc-LM-CMAC, t-butoxy carbonyl-Leu-Met-chloromethylaminocoumarin; EGF, epidermal growth factor; PBS, phosphate-buffered saline; siRNA, small interfering RNA. Back



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Gopalakrishna, R., Chen, Z. H., and Gundimeda, U. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 12233-12237[Abstract/Free Full Text]
  2. Schuller, H. M. (2002) Nat. Rev. Cancer 2, 455-463[CrossRef][Medline] [Order article via Infotrieve]
  3. Heino, J., and Kahari, V. M. (2002) Cell Invasion. Medical Intelligence Unit 33 (Heino, J., and Kahari, V. M., eds) pp. 1-117, Landes Bioscience, Eurekah, Austin, TX
  4. Mamoune, A., Luo, J., Lauffenburger, D. A., and Wells, A. (2003) Cancer Res. 63, 4632-4640[Abstract/Free Full Text]
  5. Wells, A. (2000) Adv. Cancer Res. 78, 31-101[Medline] [Order article via Infotrieve]
  6. Wyckoff, J. B., Jones, J. G., Condeelis, J. S., and Segall, J. E. (2000) Cancer Res. 60, 2504-2511[Abstract/Free Full Text]
  7. Condeelis, J. S., Wyckoff, J., and Segall, J. E. (2000) Eur. J. Cancer 36, 1671-1680[CrossRef][Medline] [Order article via Infotrieve]
  8. Farina, K. L., Wyckoff, J. B., Rivera, J., Lee, H., Segall, J. E., Condeelis, J. S., and Jones, J. G. (1998) Cancer Res. 58, 2528-2532[Abstract/Free Full Text]
  9. Albini, A., Iwamoto, Y., Kleinman, H. K., Martin, G. R., Aaronson, G. R., Kozlowski, J. M., and McEwan, R. N. (1987) Cancer Res. 47, 3239-3245[Abstract/Free Full Text]
  10. Repesh, L. A. (1989) Invasion Metastasis 9, 192-208[Medline] [Order article via Infotrieve]
  11. Gomez, D. E., Skilton, G., Alonso, D. F., and Kazanietz, M. (1999) Oncol. Rep. 6, 1363-1370[Medline] [Order article via Infotrieve]
  12. Sorimachi, H., and Suzuki, K. (2001) J. Biochem. 129, 653-664[Abstract/Free Full Text]
  13. Carragher, N. O., and Frame, M. C. (2002) Int. J. Biochem. Cell Biol. 34, 1539-1543[CrossRef][Medline] [Order article via Infotrieve]
  14. Sorimachi, H., Ishiura, S., and Suzuki, K. (1997) Biochem. J. 328, 721-732
  15. Glading, A., Lauffenburger, D. A., and Wells, A. (2002) Trends Cell Biol. 12, 46-54[CrossRef][Medline] [Order article via Infotrieve]
  16. Carragher, N. O., Levkau, B., Ross, R., and Raines, E.W. (1999) J. Cell Biol. 7, 619-630
  17. Carragher, N. O., Fincham, V. J., Riley, D., and Frame, M. C. (2001) J. Biol. Chem. 276, 4270-4275[Abstract/Free Full Text]
  18. Huttenlocher, A., Palecek, S. P., Lu, Q., Zhang, W., Mellgren, R. L., Lauffenburger, D. A., Ginsberg, M. H., and Horwitz, A. F. (1997) J. Biol. Chem. 272, 32719-32722[Abstract/Free Full Text]
  19. Glading, A., Chang, P., Lauffenburger, D. A., and Wells, A. (2000) J. Biol. Chem. 275, 2390-2398[Abstract/Free Full Text]
  20. Glading, A., Uberall., F., Keyse, S. M., Lauffenburger, D. A., and Wells, A. (2001) J. Biol. Chem. 276, 23341-23348[Abstract/Free Full Text]
  21. Goll, D. E., Thompson, V. F., Li, H., Wei, W., and Cong, J. (2003) Physiol. Rev. 83, 731-801[Abstract/Free Full Text]
  22. Glading, A., Bodnar, R. J., Reynolds, I. J., Shiraha, H., Satish, L., Potter, D. A., Blair, H. C., and Wells, A. (2004) Mol. Cell. Biol. 24, 2499-2512[Abstract/Free Full Text]
  23. Schuller, H. M., Plummer, H. K., III, and Jull, B. A. (2003). Anat. Rec. 270, 51-58[CrossRef]
  24. Ito, T., Deng, X., Carr, B., and May, W. S. (1997) J. Biol. Chem. 272, 11671-11673[Abstract/Free Full Text]
  25. Nishihara, H., Nakagawa, Y., Ishikawa, H., Ohba, M., Shimizu, K., and Nakamura, T. (2001) Biochem. Biophys. Res. Commun. 285, 845-853[CrossRef][Medline] [Order article via Infotrieve]
  26. Smith, S. D., Jia, Z., Huynh, K. K., Wells, A., and Elce, J. S. (2003) FEBS Lett. 542, 115-118[CrossRef][Medline] [Order article via Infotrieve]
  27. Gonzalez, F. A., Raden, D. L., and Davis, R. J. (1991) J. Biol. Chem. 266, 22159-22163[Abstract/Free Full Text]
  28. Dudley, D. T., Pang, L., Decker, S. J., and Saltiel, A. R. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 7686-7689[Abstract/Free Full Text]
  29. Jull, B. A., Plummer, H. K., III, and Schuller, H. M. (2001). J. Cancer Res. Clin. Oncol. 127, 707-717[Medline] [Order article via Infotrieve]
  30. Friedl, P., and Wolf, K. (2003) Nat. Rev. Cancer 3, 362-374[CrossRef][Medline] [Order article via Infotrieve]
  31. Lauffenburger, D. A., and Horwitz, A. F. (1996) Cell 84, 359-369[CrossRef][Medline] [Order article via Infotrieve]
  32. Schoenwaelder, S. M., and Burridge, K. (1999) J. Biol. Chem. 274, 14359-14367[Abstract/Free Full Text]
  33. Brummelkamp, T., Bernards, R., and Agami, R. (2002) Science 296, 550-553[Abstract/Free Full Text]
  34. Murin, S., and Inciardi, J. (2001) Chest 119, 1635-1640[Abstract/Free Full Text]
  35. Samet, J. M. (1994) Epidemiology of Lung Cancer, pp. 437-493, Marcel Dekker, Inc., New York
  36. Schuller, H. M., and Orloff, M. (1998) Biochem. Pharmacol. 55, 1377-1384[CrossRef][Medline] [Order article via Infotrieve]
  37. Palecek, S. P., Huttenlocher, A., Horwitz, A. F., and Lauffenburger, D. A. (1998) J. Cell Sci. 111, 929-940[Abstract]
  38. Sharma, G., and Vijayaraghavan, S. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 4148-4153[Abstract/Free Full Text]
  39. Blobel, G., and Dobberstein, B. (1975) J. Cell Biol. 67, 835-851[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 J. Appl. Physiol.Home page
M. Lehti, R. Kivela, P. Komi, J. Komulainen, H. Kainulainen, and H. Kyrolainen
Effects of fatiguing jumping exercise on mRNA expression of titin-complex proteins and calpains
J Appl Physiol, April 1, 2009; 106(4): 1419 - 1424.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Biol. CellHome page
W.-T. Chiu, M.-J. Tang, H.-C. Jao, and M.-R. Shen
Soft Substrate Up-regulates the Interaction of STIM1 with Store-operated Ca2+ Channels That Lead to Normal Epithelial Cell Apoptosis
Mol. Biol. Cell, May 1, 2008; 19(5): 2220 - 2230.
[Abstract] [Full Text] [PDF]

Home page
 J. Physiol.Home page
P. Gailly, F. De Backer, M. Van Schoor, and J. M. Gillis
In situ measurements of calpain activity in isolated muscle fibres from normal and dystrophin-lacking mdx mice
J. Physiol., August 1, 2007; 582(3): 1261 - 1275.
[Abstract] [Full Text] [PDF]

Home page
 JCBHome page
F. Demarchi, C. Bertoli, T. Copetti, I. Tanida, C. Brancolini, E.-L. Eskelinen, and C. Schneider
Calpain is required for macroautophagy in mammalian cells
J. Cell Biol., November 20, 2006; 175(4): 595 - 605.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
L. Xu and X. Deng
Suppression of Cancer Cell Migration and Invasion by Protein Phosphatase 2A through Dephosphorylation of {micro}- and m-Calpains
J. Biol. Chem., November 17, 2006; 281(46): 35567 - 35575.
[Abstract] [Full Text] [PDF]

Home page
 Toxicol SciHome page
T. L. Thirkill, H. Vedagiri, and G. C. Douglas
Macaque Trophoblast Migration toward RANTES Is Inhibited by Cigarette Smoke-Conditioned Medium
Toxicol. Sci., June 1, 2006; 91(2): 557 - 567.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
L. Xu and X. Deng
Protein Kinase C{iota} Promotes Nicotine-induced Migration and Invasion of Cancer Cells via Phosphorylation of {micro}- and m-Calpains
J. Biol. Chem., February 17, 2006; 281(7): 4457 - 4466.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
S. J. Libertini, B. S. Robinson, N. K. Dhillon, D. Glick, M. George, S. Dandekar, J. P. Gregg, E. Sawai, and M. Mudryj
Cyclin E Both Regulates and Is Regulated by Calpain 2, a Protease Associated with Metastatic Breast Cancer Phenotype
Cancer Res., December 1, 2005; 65(23): 10700 - 10708.
[Abstract] [Full Text] [PDF]

Home page
 J. Cell Sci.Home page
S. J. Franco and A. Huttenlocher
Regulating cell migration: calpains make the cut
J. Cell Sci., September 1, 2005; 118(17): 3829 - 3838.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
279/51/53683    most recent
M409889200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Xu, L.
Right arrow Articles by Deng, X.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Xu, L.
Right arrow Articles by Deng, X.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2004 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement