HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 279, Issue 52, 53988-53993, December 24, 2004

This Article Abstract Full Text (PDF) All Versions of this Article: 279/52/53988    most recent M404809200v2 M404809200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Tran, P. O. T. Articles by Robertson, R. P. Search for Related Content PubMed PubMed Citation Articles by Tran, P. O. T. Articles by Robertson, R. P. Social Bookmarking                      What's this?

Adenoviral Overexpression of the Glutamylcysteine Ligase Catalytic Subunit Protects Pancreatic Islets against Oxidative Stress^*

Phuong Oanh T. Tran, Sarah M. Parker, Eric LeRoy, Christopher C. Franklin, Terrance J. Kavanagh¶, Tao Zhang, Huarong Zhou, Portia Vliet¶, Elizabeth Oseid, Jamie S. Harmon, and R. Paul Robertson||**

From the Pacific Northwest Research Institute, Seattle, Washington 98122 and Department of Pathology, ^¶NIEHS Center of Ecogenetics and Environmental Health, National Institutes of Health, Department of Environmental Health, ^||Departments of Medicine and Pharmacology, University of Washington, Seattle, Washington 98195, and Department of Pharmaceutical Sciences, University of Colorado Health Sciences Center, Denver, Co 80262

Received for publication, April 30, 2004 , and in revised form, September 22, 2004.

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
The catalytic subunit of glutamylcysteine ligase (GCLC) primarily regulates de novo synthesis of glutathione (GSH) in mammalian cells and is central to the antioxidant capacity of the cell. However, GCLC expression in pancreatic islets has not been previously examined. We designed experiments to ascertain whether GCLC is normally expressed in islets and whether it is up-regulated by interleukin-1 (IL-1). GCLC expression levels were intermediate compared with other metabolic tissues (kidney, liver, muscle, fat, and lung). IL-1 up-regulated GCLC expression (10 ng/ml IL-1, 3.76 ± 0.86; 100 ng/ml IL-1, 4.22 ± 0.68-fold control) via the p38 form of mitogen-activated protein kinase and NFB and also increased reactive oxygen species levels (10 ng/ml IL-1, 5.41 ± 1.8-fold control). This was accompanied by an increase in intraislet GSH/GSSG ratio (control, 7.1 ± 0.1; 10 ng/ml IL-1, 8.0 ± 0.5; 100 ng/ml IL-1, 8.2 ± 0.5-fold control; p < 0.05). To determine whether overexpression of GCLC increases the antioxidant capacity of the islet and prevents the adverse effects of IL-1 on glucose-induced insulin secretion, islets were infected with an adenovirus encoding GCLC. IL-1 significantly decreased glucose-stimulated insulin secretion (control, 123.8 ± 17.7; IL-1, 40.2 ± 3.9 microunits/ml insulin/islet). GCLC overexpression increased intraislet GSH levels and partially prevented the decrease in glucose-stimulated insulin secretion caused by IL-1. These data provide the first report of GCLC expression in the islet and demonstrate that adenoviral overexpression of GCLC increases intracellular GSH levels and protects the beta cell from the adverse effects of IL-1.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
Glutamylcysteine ligase (GCL)¹ is the primary and rate-limiting enzyme responsible for de novo synthesis of intracellular glutathione (GSH). This enzyme catalyzes ATP-dependent ligation of L-glutamate and L-cysteine to form -glutamyl-L-cysteine, which undergoes another ATP-dependent ligation with glycine catalyzed by glutathione synthetase to form the final GSH product (1, 2). GCL is a heterodimer, composed of a light regulatory subunit as well as a heavy catalytic subunit. Although both are required for optimal enzyme activity, overexpression of the catalytic subunit GCLC alone is sufficient to increase enzyme activity significantly over control levels (1). The regulation of GCL expression and activity has been studied in many other cell types, including mesangial and endothelial cells, but not the pancreatic islet. Long term exposure to high glucose levels decreases GCL expression in mesangial, retinal Muller, and endothelial cells, which results in a decrease in GSH levels (3–5). Long term exposure to high glucose conditions inhibits endothelial cells from responding to cytokine exposure with an increase in GCL expression and activity (3). That the pathogenesis of diabetes mellitus involves interactions with IL-1 and oxidative stress secondary to chronic hyperglycemia (6, 7) raises the questions of whether GCL is normally expressed in the islet and whether overexpression of GCL protects the beta cell from oxidative stress.

We have reported that prolonged hyperglycemia or shorter exposure to ribose, a stronger reducing sugar, stimulates the formation of reactive oxygen species (ROS) in pancreatic islets (6) and causes beta cell dysfunction. These excessive increases in intraislet ROS levels cause decreases in insulin mRNA levels, insulin content, and glucose-stimulated insulin secretion. GSH plays a central role in the endogenous cellular response against oxidative stress by acting directly as an antioxidant to reduce reactive oxygen species and as a substrate for the antioxidant enzyme, glutathione peroxidase (1, 8–10). We have reported that the adverse effects of excessive intraislet ROS can be prevented by treatment with the antioxidant N-acetylcysteine and by overexpression of glutathione peroxidase (6). We have also reported that decreasing intraislet GSH levels by the GCL inhibitor buthionine sulfoximine augments the adverse effects of ROS on beta cell function (6). These observations are clinically relevant because decreases in GSH levels or the ratio of reduced to oxidized glutathione (GSH/GSSG) measured in the red blood cells of type 2 diabetic patients correlate with worsening of the diabetic state (11–13).

The studies described here were designed to establish whether GCLC is normally expressed in the islet and to determine whether adenoviral overexpression of GCLC in pancreatic islets prevents beta cell dysfunction caused by oxidative stress. Using interleukin-1 as an inducer of oxidative stress, we examined 1) the level of GCLC expression in control islets and islets exposed to IL-1, as well as the consequences of IL-1-dependent changes in GCLC on ROS production, intraislet GSH levels, and insulin secretion; 2) whether IL-1 effects on GCLC gene expression depend on p38 MAPK and NFB activation; and 3) whether adenoviral overexpression of GCLC increases intraislet levels of GSH and mitigates the adverse effects of IL-1-induced oxidative stress on glucose-induced insulin secretion.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
Materials—Adenovirus and antibodies for GCLC were obtained from the Department of Pathology and the NIEHS (National Institutes of Health) Center of Ecogenetics and Environmental Health, Department of Environmental Health at the University of Washington, Seattle. RT-PCR probes, primers, and reagents were purchased from Applied Biosystems (Foster City, CA). IL-1 was obtained from R&D Systems (Minneapolis, MN). All other reagents were obtained from Sigma.

Isolation and Culture of Wistar Rat Islets—Islets from the pancreata of male Wistar rats were isolated and cultured as described previously (6, 14).

Measurements of Intracellular ROS Levels—Intracellular levels of ROS were detected by flow cytometric analysis using a fluoresceinlabeled dye, dichlorodihydrofluorescein diacetate (Molecular Probes, Eugene, OR), as described previously by our laboratory (6). The acetoxymethyl ester derivative readily permeates cell membranes and is trapped within the cell upon cleavage by esterases. Oxidation by reactive oxygen species converts the dye from its nonfluorescent to its fluorescent form. Briefly, islets were cultured with 4 µM dichlorodihydrofluorescein diacetate in phosphate-buffered saline for 1 h at 37 °C. After incubation with the dye, cells and islets were washed with phosphate-buffered saline to prevent measurement of any extracellular reaction between the dye and H₂O₂ released by the cells into the medium. Islets were then dispersed using trypsin, and intracellular peroxide levels were measured with the EPICS® XL-MCL flow cytometer controlled by the System II software (Beckman-Coulter). Results were calculated as -fold difference from control untreated islets.

GCLC Adenovirus Infection—Adenovirus encoding human GCLC was obtained from the Department of Pathology at the University of Washington. Propagation of the adenovirus was performed as described by Franklin et al. (15) and He et al. (16) by the Pacific Northwest Research Institute Adenoviral Core. Isolated rat islets were cultured in the presence of adenovirus (at a final concentration of 10⁷ plaque-forming units/islet) in RPMI media supplemented with 10% fetal bovine serum for 24 h at 37 °C. Ascertainment of adenoviral penetration into beta cells within the core of the islet was performed by infection with virus encoding green fluorescent protein, insulin immunostaining, and detection via confocal microscopy (6). Beta cell toxicity of the adenovirus encoding GCLC was assessed by determining glucose-induced insulin secretion after infection with various concentrations of virus.

Real Time Fluorescence-based RT-PCR Analysis of GCLC Expression Levels—Total RNA was extracted from rat islets, and one-step RT-PCR was carried out using the Gold RT-PCR kit from PerkinElmer Life Sciences and an ABI Prism 7700 Sequence detector equipped with a thermocycler (Taqman^TM technology) and a cooled charge-coupled device camera to detect fluorescence emission over a range of wavelengths (500–650 nm) as described previously by our laboratory (14). Probe and primers designed to detect GCLC expression levels were based on the sequence for rat GCLC (GenBank^TM accession number AF218362 [GenBank] (17)) and were designed to target the same region as probes used for Northern blot analyses as reported previously in the literature (18, 19). They are as follows: probe, 6FAM-TTCATTTCCCAGGCTAGGCTGCCC-TAMRA; forward primer, CATCAGGCTCTTTGCACGATAA; and reverse primer, TGCTCTGGCAGTGTGAATCC. As a control for RNA quantity between different samples, RT-PCR was also carried out using probes and primers designed to detect the control gene -actin as described previously (6).

Western Analysis of GCLC Protein Levels—Total protein was collected from islets following incubation under different experimental conditions using cell lysis buffer containing 1% Nonidet P-40, 140 mM NaCl, 10 mM Tris, 1 mM CaCl₂, 1 mM MgCl₂, and 10% glycerol along with protease inhibitors. A total of 30 µg of protein was run on SDSPAGE, and immunoblotting was performed according to the standard protocol. In addition to measuring the protein levels of GCLC, Western analysis was also performed to detect the protein levels of the p85 subunit of phosphoinositide-3 kinase or -tubulin to correct for protein loading. Protein levels were analyzed using the Optiquant analysis program (Packard Instrument Co.).

GSH/GSSG Measurements in Rat Islets—The levels of GSH and GSSG were measured in isolated rat islets using the GSH/GSSG 412 kit (Oxis Research, Portland, OR). After incubation under experimental conditions, islets were collected and washed once with potassium phosphate buffer. Islets were divided equally into samples for GSH and GSSG measurements in an assay kit buffer and analyzed per the manufacturer's instructions.

Insulin Secretion Studies—Following incubation under experimental conditions, islets were placed into static incubation wells containing Krebs-Ringer buffer with either 2.8 mM glucose or 16.7 mM glucose. Insulin levels in the Krebs-Ringer buffer samples collected from the 1-h static incubations were measured by using a sensitive rat insulin radioimmunoassay kit according to the manufacturer's instructions (Linco Research Inc., St. Louis, MO).

Expression of Data and Statistics—Data are reported as means ± S.E. Statistical comparisons were performed using analysis of variance and the Bonferroni post-hoc test when appropriate with p < 0.05 considered as significant.

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
GCLC Expression Level and IL- Regulation of GCLC Expression, GSH/GSSG Ratios, and Intraislet ROS Levels—The expression level of GCLC mRNA in pancreatic islets was less than that found in kidney and liver, and greater than that observed in lung, subcutaneous fat, and skeletal muscle (Fig. 1A). Western analysis for GCLC protein was generally in agreement except that lung content was greater than islet content (Fig. 1B).

View larger version (11K): [in this window] [in a new window]   FIG. 1. A, semiquantitative measurement of GCLC in total RNA extracted from islets and other tissues obtained from normal Wistar rats. GCLC expression was measured using fluorescence-based RT-PCR. GCLC expression in islets was less than that found in kidney and liver and greater than that observed in lung, subcutaneous fat, and muscle. Tissues were obtained from at least three different normal Wistar rats and measured on separate occasions. GCLC mRNA levels were normalized to -actin levels. B, Western analysis for GCLC on three separate occasions for the same tissues shown in A. DLU, density light unit; prot., protein.

View larger version (13K): [in this window] [in a new window]   FIG. 2. IL-1 up-regulation of GCLC expression involves activation of p38 MAPK and NFB. A, exposure to IL-1 (10 ng/ml) for 24 h significantly increased GCLC expression levels over control. Inhibition of p38 MAPK activation by 1 µM SB203580 (SB) prevented IL-1 from increasing GCLC expression. *, p < 0.01, n = 3. B, Western blot analysis was used to measure cytosolic levels of the p50 subunit of NFB. Treatment of islets with 10 ng/ml IL-1 for 24 h caused a decrease in the p50 subunit, indicating NFB dissociation from IB and translocation into the nucleus. *, p < 0.01, n = 3. Cytosolic levels of the p85 subunit of phosphoinositide-3 kinase did not change significantly from control (C).

View this table: [in this window] [in a new window]   TABLE I Effect of IL-1 on GSH/GSSG levels 24 h of exposure to IL-1 (10 or 100 ng/ml) increased GSH/GSSG levels significantly above control levels. All values expressed as average ± S.E., n = 5. GSH (µM), GSSG (µM).

View larger version (8K): [in this window] [in a new window]   FIG. 3. Effect of IL-1 on intracellular ROS levels. Islets were cultured overnight in the presence of either 10 ng/ml IL-1 or 10–4 M PGE2. IL-1 increased ROS levels significantly over those measured in untreated cells, but PGE2 did not. As a positive control, islets were also treated for 2 h with 100 µM H2O2. *, p < 0.05 compared with untreated control, n = 3.

View larger version (19K): [in this window] [in a new window]   FIG. 4. Adenoviral overexpression of GCLC in islets. Islets were infected with adenovirus encoding for GCLC for 16 h prior to experimentation. Glucose-induced insulin secretion was evaluated to determine optimal viral concentrations that would not interfere with normal islet function. After the 16-h infection period, islets were resuspended in fresh medium, and a 1-h static incubation (Cont) was begun. Western blot analysis of protein collected at the same time showed a substantial increase in GCLC protein levels in islets infected with the GCLC adenovirus but not the control (C) luciferase virus at a concentration 107 plaque-forming units (pfu)/islet.

View larger version (16K): [in this window] [in a new window]   FIG. 5. Effect of adenoviral overexpression of GCLC on inhibition of glucose-stimulated insulin secretion by IL-1 (10 ng/ml). The effect of IL-1 on glucose-stimulated insulin secretion was measured in uninfected islets or islets infected with either luciferase (AdV-Luc) or GCLC encoding adenovirus (AdV-GCLC). Infection with the luciferase control adenovirus alone did not affect control levels of glucose-stimulated insulin secretion and did not prevent the negative effects of IL-1. Infection with adenovirus encoding GCLC partially prevented the inhibitory effects of IL-1. *, p < 0.05, , p < 0.01, n = 6 separate experiments.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Regulation of GCLC expression and activity has been studied in other cell types including mesangial and endothelial cells. Exposure of endothelial cells to high glucose conditions decreases GCL activity significantly from that found in cells cultured under low glucose conditions (3). Cytokines increase GCLC expression and activity in endothelial cells, and this response is inhibited by prior long term exposure to high glucose conditions (3). The latter finding is similar to the effect of IL-1 up-regulation of GCLC expression that we observed. Long term exposure to high glucose conditions decreases GCLC expression in mesangial as well as retinal Muller cells resulting in a decrease in GSH levels (4, 5). Decreased GSH levels in erythrocytes from hyperglycemic type 2 diabetics are also accompanied by a decrease in GCLC activity (13).

IL-1 has a well established role as an inducer of chronic inflammation. Increases in islet IL-1 during the development of diabetes in an animal model have been reported (7). We reported that specific inhibitors of cyclooxygenase-2 and PGE₂ production prevent IL-1 from inhibiting glucose-induced insulin secretion in isolated islets (14). However, the effect of IL-1 that inhibits insulin secretion via ROS formation we identified in the current study appears to be independent from PGE₂ production because PGE₂ did not increase ROS levels. The effect of IL-1 that is mediated by PGE₂ to inhibit glucose-induced insulin secretion may be more potent than the corresponding ROS-mediated effect of IL-1 because GCLC overexpression only partially prevented the IL-1 inhibitory effect on insulin secretion, whereas treatment with specific cyclooxygenase-2 inhibitors completely prevented IL-1-induced inhibition of glucose-induced insulin secretion (14).

Our results suggest that ROS production caused by exposing islets to IL-1 modulates glucose-induced insulin secretion downward and that the level of endogenous GCLC serves to act as a brake on this modulation by virtue of its ability to increase GSH and decrease intraislet ROS levels (Fig. 6). The clinical implications of our findings relate to the potential participation of oxidants in the pathogenesis of diabetes mellitus. In type 1 diabetes IL-1 is generally regarded as playing an important role in beta cell destruction. In type 2 diabetes chronic exposure to high glucose levels is accompanied by oxidative stress and appears to contribute to the ongoing decline in beta cell function (21). That high glucose levels favor production of IL-1 within pancreatic islets (7) suggests the hypothesis that the cumulative effects of chronic hyperglycemia and local cytokine production may contribute to ongoing destruction of beta cells in both forms of diabetes. Our previous report of the protective effects of glutathione peroxidase overexpression (6) and the beneficial effects of GCLC overexpression that we now report suggest that enhancing endogenous islet antioxidant enzyme activity may offer a therapeutic strategy for protection against ongoing beta cell damage secondary to oxidative stress in diabetes mellitus.

View larger version (16K): [in this window] [in a new window]   FIG. 6. Theoretical schema wherein IL-1 has negative and positive modulatory effects on glucose-induced insulin secretion. IL-1 stimulates ROS production, which inhibits beta cell function. IL-1 (via p38 MAPK, NFB, and increased GCLC gene expression) also increases GCLC and GSH levels, which diminish ROS levels and augment beta cell function.

	FOOTNOTES

^** To whom correspondence should be addressed: Pacific Northwest Research Institute, 720 Broadway, Seattle, WA 98122. Tel.: 206-726-1210; Fax: 206-726-1217; E-mail: rpr{at}pnri.org.

¹ The abbreviations used are: GCL, glutamylcysteine ligase; GCLC, glutamylcysteine ligase catalytic subunit; ROS, reactive oxygen species; IL-1, interleukin-1; MAPK, mitogen-activated protein kinase; RT, reverse transcription; PGE₂, prostaglandin E₂; AdV, adenovirus.

	ACKNOWLEDGMENTS

 
We thank Alma Rivera for technical assistance.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 

1. Griffith, O.W., and Mulcahy, R. T. (1999) Adv. Enzymol. Relat. Areas Mol. Biol. 73, 209–267[Medline] [Order article via Infotrieve]
2. Richman, P.G., and Meister, A. (1975) J. Biol. Chem. 250, 1422–1426[Abstract/Free Full Text]
3. Urata, Y., Yamamoto, H., Goto, S., Tsushima, H., Akazawa, S., Yamashita, S., Nagataki, S., and Kondo, T. (1996) J. Biol. Chem. 271, 15146–15152[Abstract/Free Full Text]
4. Lu, S. C., Bao, Y., Huang, Z. Z., Sarthy, V. P., and Kannan, R. (1999) Investig. Ophthamol. Vis. Sci. 40, 1776–1782
5. Catherwood, M.A., Powell, L. A., Anderson, P., McMaster, D., Sharpe, P. C., and Trimble, E. R. (2002) Kidney Int. 61, 599–608[CrossRef][Medline] [Order article via Infotrieve]
6. Tanaka, Y., Tran, P.O.T., Harmon J., and Robertson, R. P. (2002) Proc. Natl. Acad. Sci. 99, 12363–12368[Abstract/Free Full Text]
7. Maedler, K., Sergeev, P., Ris, F., Oberholzer J., Joller-Jemelka, H. I., Spinas, G. A., Kaiser, N., Halban, P. A., and Donath, M.Y. J. Clin. Investig. 110, 851–860H. I.
8. Hayes, J. D., and McLellan, L. I. (1999) Free Radic. Res. 31, 273–300[Medline] [Order article via Infotrieve]
9. Adams, J. D., Lauterberg, B. H., and Mitchell, J. R. (1983) J. Pharmacol. Exp. Ther. 227, 749–754[Abstract/Free Full Text]
10. Reed, D. J. (2002) in Current Protocols in Toxicology (Morgan, K. S., ed) pp. 6.0.1–6.0.3, John Wiley & Sons, Inc., New York
11. Murakami, K., Kondo, T., Ohtsuka, Y., Fujiwara, Y., Shimada, M., and Kawakami, Y. (1989) Metabolism 38, 753–758[CrossRef][Medline] [Order article via Infotrieve]
12. Sharma A., Kharb, S., Chugh S. N., Kakkar, R., and Singh, G. P. (2000) Metabolism 49, 160–162[CrossRef][Medline] [Order article via Infotrieve]
13. Yoshida, K., Hirokawa, J., Tagami, S., Kawakami, Y., Urata, Y., and Kondo, T. (1995) Diabetologia 38, 201–210[Medline] [Order article via Infotrieve]
14. Tran, P. O. T, Gleason, C. E., Poitout, V., and Robertson, R. P. (1999) J. Biol. Chem. 274, 31245–31248[Abstract/Free Full Text]
15. Franklin, C. C., Krejsa, C. M., Pierce, R. H., White C. C., Fausto N., and Kavanagh, T. J. (2002) Am. J. Pathol. 160, 1887–1894[Abstract/Free Full Text]
16. He, T. C., Zhou, S., da Costa, L. T., Yu, J., Kinzler, K. W., and Vogelstein, B. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 2509–2514[Abstract/Free Full Text]
17. Yang, H., Wang, J., Huang, Z.Z., Ou, X., and Lu, S.C. (2001) Biochem. J. 357, 447–455[CrossRef][Medline] [Order article via Infotrieve]
18. Gipp, J. J., Bailey, H. H., and Mulcahy, R.T. (1995) Biochem. Biophys. Res. Commun. 206, 584–589[CrossRef][Medline] [Order article via Infotrieve]
19. Mulcahy, R. T., Wartman, M. A., Bailey, H. H., and Gipp, J. J. (1997) J. Biol. Chem. 272, 7445–7454[Abstract/Free Full Text]
20. Tiedge, M., Lortz, S., Drinkgern, J., and Lenzen, S. (1997) Diabetes 46, 1733–1742[Abstract]
21. Robertson, R. P. (2004) J. Biol. Chem. 279, 42351–42354[Free Full Text]

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				S. Numazawa, H. Sakaguchi, R. Aoki, T. Taira, and T. Yoshida Regulation of the susceptibility to oxidative stress by cysteine availability in pancreatic {beta}-cells Am J Physiol Cell Physiol, August 1, 2008; 295(2): C468 - C474. [Abstract] [Full Text] [PDF]

				V. Poitout and R. P. Robertson Glucolipotoxicity: Fuel Excess and {beta}-Cell Dysfunction Endocr. Rev., May 1, 2008; 29(3): 351 - 366. [Abstract] [Full Text] [PDF]

				C. Tang, P. Han, A. I. Oprescu, S. C. Lee, A. V. Gyulkhandanyan, G. N.Y. Chan, M. B. Wheeler, and A. Giacca Evidence for a Role of Superoxide Generation in Glucose-Induced {beta}-Cell Dysfunction In Vivo Diabetes, November 1, 2007; 56(11): 2722 - 2731. [Abstract] [Full Text] [PDF]

				R. Takahashi, H. Ishihara, K. Takahashi, A. Tamura, S. Yamaguchi, T. Yamada, H. Katagiri, and Y. Oka Efficient and controlled gene expression in mouse pancreatic islets by arterial delivery of tetracycline-inducible adenoviral vectors J. Mol. Endocrinol., January 1, 2007; 38(1): 127 - 136. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 279/52/53988    most recent M404809200v2 M404809200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Tran, P. O. T. Articles by Robertson, R. P. Search for Related Content PubMed PubMed Citation Articles by Tran, P. O. T. Articles by Robertson, R. P. Social Bookmarking                      What's this?