Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M310405200 on November 3, 2003

J. Biol. Chem., Vol. 279, Issue 6, 4782-4793, February 6, 2004
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
279/6/4782    most recent
M310405200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by McMullen, J. R.
Right arrow Articles by Izumo, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by McMullen, J. R.
Right arrow Articles by Izumo, S.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

The Insulin-like Growth Factor 1 Receptor Induces Physiological Heart Growth via the Phosphoinositide 3-Kinase(p110{alpha}) Pathway*

Julie R. McMullen{ddagger}§, Tetsuo Shioi{ddagger}§||, Weei-Yuarn Huang{ddagger}, Li Zhang{ddagger}, Oleg Tarnavski{ddagger}, Egbert Bisping{ddagger}, Martina Schinke{ddagger}, Sekwon Kong{ddagger}, Megan C. Sherwood**, Jeffrey Brown{ddagger}, Lauren Riggi{ddagger}, Peter M. Kang{ddagger}, and Seigo Izumo{ddagger}

From the {ddagger}Beth Israel Deaconess Medical Center, Harvard Medical School, and the **Department of Cardiology, Boston Children's Hospital, Boston, Massachusetts 02215

Received for publication, September 22, 2003 , and in revised form, October 27, 2003.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Insulin-like growth factor 1 (IGF1) was considered a potential candidate for the treatment of heart failure. However, some animal studies and clinical trials have questioned whether elevating IGF1 chronically is beneficial. Secondary effects of increased serum IGF1 levels on other tissues may explain these unfavorable results. The aim of the current study was to examine the role of IGF1 in cardiac myocytes in the absence of secondary effects, and to elucidate downstream signaling pathways and transcriptional regulatory effects of the IGF1 receptor (IGF1R). Transgenic mice overexpressing IGF1R in the heart displayed cardiac hypertrophy, which was the result of an increase in myocyte size, and there was no evidence of histopathology. IGF1R transgenics also displayed enhanced systolic function at 3 months of age, and this was maintained at 12-16 months of age. The phosphoinositide 3-kinase (PI3K)-Akt-p70S6K1 pathway was significantly activated in hearts from IGF1R transgenics. Cardiac hypertrophy induced by overexpression of IGF1R was completely blocked by a dominant negative PI3K(p110{alpha}) mutant, suggesting IGF1R promotes compensated cardiac hypertrophy in a PI3K(p110{alpha})-dependent manner. This study suggests that targeting the cardiac IGF1R-PI3K(p110{alpha}) pathway could be a potential therapeutic strategy for the treatment of heart failure.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Heart failure has become a major "epidemic" in Western society, and the majority of new therapies have failed to fulfill their original promise (1). The identification of signaling molecules and cascades that could be utilized to improve cardiac function will be critical for the development of new drugs for the treatment of heart failure. Growth hormone and insulin-like growth factor 1 (IGF1)1 have been considered potential candidates for the treatment of heart failure (2, 3). IGFs are produced by many tissues, particularly by the liver in response to growth hormone stimulation. The importance of IGF1 in the regulation of post-natal growth and development has been well established (4-7). IGF1 and IGF1 receptors (IGF1R) are present in the adult heart (2), and it has been shown that normal activation of the growth hormone-IGF1 axis is essential for myocardial performance (8, 9). Further, it appears that short term administration of IGF1 is beneficial in improving cardiac function in the setting of heart failure (10), and IGF1 transgene expression has been reported to counteract the occurrence of apoptosis in a murine heart failure model (11). However, conflicting results obtained from clinical trials in which IGF1 was chronically administered to humans have questioned the therapeutic value of IGF1 (2, 3).

Two independent groups have studied the role of IGF1 in the murine heart in vivo using a transgenic approach. Reiss et al. (12) generated transgenic mice in which the human cDNA for human IGF1B was placed under the control of the {alpha}-myosin heavy chain (MHC) promoter. Transgenic expression was associated with increased IGF1 secretion from cardiac myocytes and resulted in a substantial rise in systemic plasma levels of IGF1 (~80%). IGF1 transgenic mice had larger hearts and normal cardiac function. The authors also reported significant increases in the size of other organs including the brain and kidney. Thus, the large rise in systemic plasma levels of IGF1 most likely had affects on non-myocytes and other tissues. Delaughter et al. (13) generated transgenic mice expressing the human IGF1 cDNA under the control of the {alpha}-skeletal actin promoter (transgenic expression reported in heart and skeletal muscle). In contrast to the results reported by Reiss et al. (12), serum IGF1 levels were not elevated. Transgenic mice displayed cardiac hypertrophy, which was associated with enhanced cardiac systolic performance up to 10 weeks of age, but function was significantly depressed by 52 weeks. Despite the localized expression of IGF1 in skeletal and cardiac muscle, the effects of IGF1 were not confined to these tissues. There were also increases in gut, liver, and spleen, and changes in body composition of the animals as a whole (14).

The aim of the current study was to define the role of IGF1 specifically in the heart by generating transgenic mice overexpressing the IGF1R in cardiac myocytes. The advantage of this model is that there would be no effect of IGF1 on non-myocytes or other tissues. Furthermore, we wanted to elucidate the signaling pathways that are critical for mediating the growth response of the IGF1R pathway, as well as examining the transcriptional regulatory effects of the IGF1R. Activation of a number of signal transduction pathways in response to IGF1 stimulation has been described (15), but the biological significance of these pathways in vivo is less clear. We previously reported that transgene expression of a constitutively active (ca) phosphoinositide (PI3K, p110{alpha} isoform) mutant resulted in "physiological" cardiac hypertrophy (16). Because the PI3K pathway is one of the major signaling cascades downstream of IGF1, we hypothesized that PI3K(p110{alpha}) would be a critical downstream effector of IGF1R regulating heart size.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Generation of Transgenic Mice—The cDNA insert for human IGF1R was cloned into a SalI-digested {alpha}MHC promoter construct (clone 26; a gift from J. Robbins; Ref. 17), and transgenic mice were generated as previously described (16). Animal care and experimentation were approved by the Institutional Animal Care and Use Committee of the Beth Israel Deaconess Medical Center. Unless otherwise shown, experiments were performed on 3-month-old heterozygous IGF1R transgenic mice and non-transgenic (NTg) littermate controls (FVB/N background).

Receptor Binding Assays—The density of IGF1R in hearts from NTg and IGF1R transgenics was measured by incubating125I-IGF1 (2000 Ci/mmol) with cardiac membrane fractions for 2 h at room temperature as described (18). Competition assays were also performed to confirm the specificity of the assay.125I-IGF1 was incubated with cardiac membrane fractions (100 µg) from transgenic or NTg in the presence of various concentrations of unlabeled IGF1 (0-50 ng). In the presence of 10 ng of non-radioactive IGF1, the IGF1 binding activity of membrane fractions from transgenic mice was reduced to base-line levels, demonstrating the specificity of the assays.

Histological Analysis—Histological analysis of hearts was performed as previously described (16). Masson's trichrome stain was used to quantify fibrosis in the left ventricle (collagen fibers stain blue). Hearts were cut at the horizontal short axis plane and fixed as described (19). Images of the left ventricle were obtained with three to four fields per section (magnification, x50). Analysis was performed using IPLab software (Scanalytics Inc.). Areas of fibrosis were divided by the total area of the left ventricle.

Morphometric Analysis of Isolated Cardiac Myocytes—Cardiac myocytes were enzymatically dissociated from hearts of NTg and IGF1R transgenics. The long axis, short axis, cell area, and cell volume of myocytes were measured as described (16).

Echocardiography—Echocardiography was performed at 3 months of age and 12-16 months as previously described (20), except that 2,2,2-tribromoethanol (Aldrich, 0.4-0.6 mg/kg) was used for anesthesia.

Biochemical Analysis—Heart lysates were prepared, and immunoprecipitation was performed as described (20) using 2 mg of protein, protein A-Sepharose, and an anti-insulin receptor substrate 1 (IRS1) antibody (2 µl, 0.73 µg; Upstate Biotechnology). The immunoprecipitates were subjected to SDS-PAGE and transferred to polyvinylidene difluoride membranes (Immobilon-P, Millipore), and blots were probed with an anti-phosphotyrosine clone 4G10 antibody (100 µg/µl, 1:1000; Upstate Biotechnology) and the anti-IRS1 antibody (1:1000; Upstate Biotechnology). IGF1R transgene expression was surveyed in a variety of tissues by Western blotting using an IGF1R{beta} antibody (C-20, Santa Cruz Biotechnology, 1:200). PI3K activity, phosphorylation of Akt, p70S6K1 activity, phosphorylation of ERK1/2, and phosphorylation of p38 were measured as described (19-21). To measure the phosphorylation of phospho-Jnk, blots were probed with an anti-phospho-Jnk antibody (Cell Signaling, 1:100) followed by an anti-Jnk1 antibody (Santa Cruz Biotechnology, 1:200). Activation of calcineurin was assessed as previously described (22, 23).

Cross-breeding of IGF1R Transgenic Mice with Dominant Negative (dn) PI3K Transgenic Mice—PI3K(p110{alpha}) is an important downstream effector of IGF1R. To genetically examine the relationship of PI3K(p110{alpha}) and IGF1R in determining heart size, we crossed IGF1R transgenic mice with transgenic mice expressing a dnPI3K(p110{alpha}) mutant (16).

Response of IGF1R Transgenics to a Pathological Hypertrophic Stimulus (Aortic Banding) or a Physiological Hypertrophic Stimulus (Chronic Swimming Training)—Ascending aortic constriction was performed in 3-month-old IGF1R and NTg mice as previously described (19). One week after the operation, mice were sacrificed. For swimming training, 8-10-week-old NTg or IGF1R transgenic mice in groups of 14-16 were swum in water tanks for 4 weeks as described (21).

Microarray Hybridization and Analysis—Total RNA from ventricles was isolated from 3-month-old NTg or transgenic mice (IGF1R, caPI3K, dnPI3K) and double transgenic mice (IGF1RxcaPI3K, IGF1Rx dnPI3K) using TRIzol reagent (Invitrogen) following the instructions from the manufacturer. Expression profiles were generated using the murine Affymetrix GeneChip® MGU74Av2. Generation of biotinylated cRNA hybridization and processing of Affymetrix arrays was performed according to Affymetrix standard protocol. Three independent biological replicates were processed and analyzed (data were analyzed using Affymetrix Microarray Suite version 5.01 to assess the quality of RNA and hybridization). Data analysis was performed using the Affy R package (www.bioconductor.org) and Spotfire DecisionSite 7.1.1 (Spotfire, Cambridge, MA). Invariant set-based normalization (24) on the probe level was performed using the Affy R package (25). After normalization, signal values were calculated as an expression index as described in the Affymetrix technical manual (Microarray Suite User Guide, Version 5). Expression index and detection calls were exported to Spotfire DecisionSite software where further clustering analysis was performed. 5172 probe sets, which were identified as "absent" in all 18 arrays, were excluded. The remaining 7250 genes were statistically filtered to detect significantly differently expressed genes across the experimental groups. One-way analysis of variance was performed to detect differences across the six groups. 822 probe sets of 12,422 (6.62%) were selected for cluster analysis with a significance level of p < 0.001. Hierarchical and k-means clustering analysis were done interactively within Spotfire DecisionSite software, and k = 9 for k-means clustering was used for further interpretation.

Northern Blot Analysis—Northern blot analysis was performed as previously described (16). Total RNA (7.5 µg) was electrophoresed in 1.3% denaturing formaldehyde-agarose gels and blotted onto Hybond N membranes (Amersham Biosciences). Membranes were probed with atrial natriuretic peptide (ANP), brain natriuretic peptide (BNP), {beta}-MHC, {alpha}-MHC, {alpha}-skeletal actin, phenylalanine hydroxylase (PAH), phosphatidylserine synthase 1 (Ptdss1), heparin-binding epidermal growth factor-like growth factor (HB-EGF), and GAPDH-radiolabeled probes. The probes for mouse ANP (16), {alpha}-skeletal actin (21), PAH, Ptdss1, and HB-EGF were cloned by RT-PCR using mouse heart cDNAs as a template with the following primers: PAH (forward, TGTTGTCCTGGAGAACGGAGTC; reverse, TCCTGAATGGTCCTTGGGAACC), Ptdss1 (forward, ATCAACGAGCAGCAAGTGGAGG; reverse, CCAAAAACCATTCGCCATAAGG), HB-EGF (forward, CCCCAAGCAAAGAAAGGAATG; reverse, GATGACAAGAAGACAGACGGACG). Mouse BNP and rat GAPDH probes were prepared as previously described (26, 27). Rat {beta}-MHC 3'-untranslated region cDNA and mouse {alpha}-MHC 3'-untranslated region cDNA were kind gifts from M. Buckingham.

Statistical Analysis—Results are presented as mean ± S.E. Differences between groups were compared using one-way analysis of variance, followed by Fisher's protected least significant difference post hoc test. A value of p < 0.05 was considered significant.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
Overexpression of IGF1R Induced Compensated Physiological Cardiac Hypertrophy—From 17 potential founders, 2 lines (lines 7 and 17) by Southern analysis were identified. IGF1R transgenic mice are fertile and display no signs of heart failure at an age of 12-16 months. The IGF1R transgene was expressed specifically in the heart (Fig. 1A). IGF1R ligand binding assays were performed to confirm and quantitate transgenic expression of IGF1R. In lines 7 and 17, there were 20- and 16-fold increases, respectively, in the expression of the IGF1R in cardiac membrane fractions compared with that of NTg littermates. Both lines (i.e. 7 and 17) displayed a similar phenotype with significant increases in the heart weight/body weight ratio (HW/BW). Detailed analysis was subsequently performed on line 7.



View larger version (51K):
[in this window]
[in a new window]
  		FIG. 1.
Overexpression of IGF1R induced physiological cardiac hypertrophy. A, tissue specificity of IGF1R transgene expression. Western blot analysis of protein (100 µg) from brain (Br), lung (Lu), heart (H), liver (Li), kidney (K), and skeletal muscle (Sk) using an anti-IGF1R{beta} antibody. Faint signals represent endogenous IGF1R. B, morphological analysis of hearts from IGF1R transgenic mice at 3 months of age. C, histopathological analysis of heart sections from NTg and IGF1R transgenics stained with hematoxylin and eosin (HE) and Masson's trichrome stain (MT). D, dissociated cardiac myocytes isolated from NTg and IGF1R transgenics.

 
The HW/BW and HW/tibial length ratios of female IGF1R transgenics at 3 months of age were increased by ~38 and 34%, respectively, compared with NTg littermate controls (Fig. 1B, Table I). There were no significant differences in the body, lung, or liver weights (Table I). Male IGF1R transgenics displayed a degree of cardiac hypertrophy similar to that of female transgenics (data not shown). Body and organ weights were also examined in mice up to 16 months of age. There were no significant differences in body, liver, kidney, or spleen weights (data not shown). This is consistent with the idea that IGF1 plasma levels are not elevated in IGF1R transgenic mice. On histological analysis, there was a proportional increase in the size of all chambers and ventricular wall thickness of hearts from IGF1R transgenics (Fig. 1B). Furthermore, there was no evidence of cardiomyopathic changes, such as necrosis, fibrosis, or myocyte disarray, in hearts from mice at 3 months of age (Fig. 1C) or mice at 6-12 months of age (data not shown).


View this table:
[in this window]
[in a new window]
  		TABLE I
Postmortem analysis of female IGFIR and dnPI3K transgenic mice at 3 months of age

Table shows heart weight (HW), body weight (BW), lung weight (LW), liver weight (LiW), and tibial length (TL). *, p < 0.05 us. NTg; #, p < 0.05 vs. IGF1R.

 
Effect of IGF1R Transgene Expression on Myocyte Cell Size—In cultured neonatal ventricular myocytes, IGF1 was reported to result in hypertrophy and/or hyperplasia (28, 29), whereas in adult cultured cardiac myocytes, IGF1 resulted in hypertrophy alone (30). Duerr et al. (10) suggested that the increase in the heart weight of rats administered IGF1 for 2 weeks was caused mainly by myocyte hypertrophy. However, in transgenic mice expressing IGF1 specifically in the heart, an increase in myocyte number was reported (12). To examine whether the increase in heart size in the current study was the result of myocyte hypertrophy, we measured cell size in isolated adult cardiac myocyte preparations. The short axis and cell area of myocytes from IGF1R transgenics were significantly greater compared with myocytes from NTg mice (Fig. 1D, Table II). Based on the assumption that cardiac myocytes are cylindrical, the cell volume was calculated and found to be ~46% greater in hearts of IGF1R transgenic mice (Table II). Thus, the increase in HW/BW ratio (~40%) of IGF1R transgenics appears to be accounted for by the increase in cardiac myocyte volume.


View this table:
[in this window]
[in a new window]
  		TABLE II
Morphometric analysis of isolated cardiac myocytes from female mice at 3 months of age

*, p < 0.05 compared to NTg.

 
Overexpression of IGF1R Was Associated with Enhanced Systolic Function—-Cardiac function was examined by echocardiography in mice at 3 and 12-16 months of age. At 3 months of age, IGF1R mice had a significantly greater diastolic posterior wall thickness and a significantly smaller left ventricle systolic diameter (Table III). Left ventricular systolic function, assessed by fractional shortening was significantly greater (~16%) in IGF1R transgenics. Fractional shortening was maintained in mice at 12-16 months of age. Thus, mice overexpressing IGF1R display cardiac hypertrophy, which is characteristic of physiological hypertrophy, in that there is no evidence of histopathology and systolic function is enhanced.


View this table:
[in this window]
[in a new window]
  		TABLE III
Echocardiographic analysis of heart size and function of IGF1R transgenic mice

LV, left ventricular; bpm, beats per minute; IVS, interventricular septum thickness; LVPW, left ventricular posterior wall thickness. *,p < 0.05 compared to NTg.

 
Recruitment of IRS Proteins and Activation of the PI3K Signaling Pathway—The IGF1R is a receptor tyrosine kinase that becomes activated upon IGF1 binding. The multisite tyrosine autophosphorylation of the IGF1R subsequently recruits the IRS adaptor proteins. The tyrosine phosphorylation of IRS1 expressed relative to IRS1 protein was increased ~3.5-fold in IGF1R transgenic mice (Fig. 2A). The two major pathways of IGF1R signaling in cardiac myocytes are the PI3K pathway and the mitogen-activated protein kinase (MAPK) pathway (2, 31). IGF1R activates the PI3K pathway via the interaction of the p85 PI3K subunit with phosphorylated IRS1/IRS2, which then activates the p110 catalytic subunit. In contrast, the Ras-MAPK pathway is activated by recruitment of the Grb2 adaptor that binds to a single unique tyrosine-phosphorylated consensus motif in the IRS proteins through its Src homology 2 domain (32). In the current study, the p85 PI3K adaptor was significantly greater in hearts from IGF1R transgenic mice (Fig. 2B). The p85 PI3K adaptor binds to the class 1A p110 PI3K catalytic subunit, is recruited to the plasma membrane, and catalyzes the conversion of phosphatidylinositol 4,5-biphosphate into phosphatidylinositol 3,4,5-triphosphate, which ultimately results in activation of downstream molecules of PI3K including Akt and p70S6K1 (32). PI3K activity, phosphorylation of Akt, and p70S6K1 activity were significantly elevated in hearts of IGF1R transgenics (Fig. 3, A-C). By contrast, the activities of ERK1/2, phospho-Jnk, phospho-p38, and calcineurin were not different between IGF1R and NTg mice (Fig. 3, D-G).



View larger version (32K):
[in this window]
[in a new window]
  		FIG. 2.
Recruitment of IRS proteins and activation of the PI3K signaling pathway. A, tyrosine phosphorylation of IRS1 in heart lysates from NTg and IGF1R transgenic mice. B, protein expression of the p85 PI3K subunit. n = 4 for each group; *, p < 0.05 compared with NTg (normalized to 1 unit).

 



View larger version (48K):
[in this window]
[in a new window]
  		FIG. 3.
IGF1R activates the PI3K-Akt-p70S6K1 pathway. A, PI3K activity in heart lysates from NTg and IGF1R mice (upper panel). PIP, PtdIns 3-phosphate. A portion of the immunoprecipitated enzyme was subjected to Western blotting and probed with an anti-IRS1 antibody (middle panel). Quantitative analysis (lower panel). B, phosphorylation of Akt (upper panel), total Akt protein (middle panel), and quantitative analysis of Akt phosphorylation normalized to total Akt protein (lower panel). C, p70S6K1 (S6K1) activity was measured by an immune complex kinase assay using glutathione S-transferase-S6 as a substrate (upper panel), the amount of immunoprecipitated S6K1 was analyzed by Western blotting (middle panel), and quantitative analysis of S6K1 activity normalized to total S6K1 protein (lower panel). D, phosphorylation of ERK1/2 (upper panel), total ERK2 protein (middle panel), and quantitative analysis of ERK1/2 phosphorylation normalized to total ERK2 protein (lower panel). E, quantitative analysis of phospho-Jnk normalized to Jnk1 protein. F, quantitative analysis of phospho-p38 normalized to p38. G, activated calcineurin protein levels (calcineurin complexed with calmodulin, upper panel) were normalized to unprecipitated GAPDH (middle panel). Quantitative analysis (lower panel). A heart homogenate from a sham-operated mouse (Sh) and aortic banded mouse (B) was included to verify the assay was working. As reported (22), calcineurin activity was elevated in a lysate from a banded mouse. n = 3 or 4 in each group; *, p < 0.05 compared with NTg (normalized to 1 unit).

 
Cross-breeding of IGF1R Transgenic Mice with dnPI3K(p110{alpha}) Transgenic Mice—Because the activities of signaling molecules on the PI3K pathway were elevated in hearts of IGF1R transgenics, we investigated the genetic relationship of IGF1R and PI3K(p110{alpha}) in vivo. We previously generated and characterized transgenic mice expressing a caPI3K(p110{alpha}) mutant or a dnPI3K(p110{alpha}) mutant specifically in the heart (16). The HW/BW ratio of caPI3K transgenics was ~20% larger than NTg, whereas the HW/BW ratio of dnPI3K was ~20% smaller, and these changes reflected changes in PI3K(p110{alpha}) activity. To examine the contribution of the PI3K(p110{alpha}) pathway in determining IGF1R-induced cardiac growth, we crossed dnPI3K transgenic mice with IGF1R transgenic mice. The HW/BW ratio of double transgenic mice expressing both the dnPI3K and IGF1R transgenes was significantly lower than IGF1R transgenics and not different from dnPI3K transgenic hearts alone (Fig. 4A; Table I). This experiment suggests that PI3K(p110{alpha}) is the critical effector downstream of IGF1R that regulates heart size. A group of caPI3K transgenic mice were also crossed with IGF1R transgenics to exclude the possibility that expression of two transgenes could attenuate the hypertrophic response induced by overexpression of IGF1R. Double transgenic mice expressing the caPI3K and IGF1R mutants displayed a significant increase in heart size, which was similar to that observed in IGF1R transgenics (caPI3KxIGF1R: HW/BW = 6.00 ± 0.14, n = 3).



View larger version (30K):
[in this window]
[in a new window]
  		FIG. 4.
IGF1R induced cardiac hypertrophy in a PI3K(p110{alpha})-dependent manner. A, representative picture of hearts from mice expressing IGF1R, dnPI3K, and both IGF1R and dnPI3K mutants. Mean HW/BW ratios are shown below. B, response of NTg and IGF1R transgenics to aortic banding for 1 week (NTg, n = 5; IGF1R, n = 5) or 4 weeks of swimming training (NTg, n = 9; IGF1R, n = 8). HW/BW ratios of banded mice were normalized to NTg sham; HW/BW ratios of swimming mice were normalized to NTg non-swimming mice. HW/BW ratios from sham-operated mice were similar to those from non-swim mice (control; NTg, n = 8; IGF1R, n = 7). *, p < 0.05; #, p < 0.05 compared with the same genotype from the control group. C, representative sections from the left ventricle wall of NTg and IGF1R transgenics subjected to aortic banding (left panel). Interstitial fibrosis appears blue/purple on Masson's trichrome stain. Original magnification, x50. Figure shows quantitation of the area of fibrosis/area of left ventricle (right panel). n = 4 in each group. *, p < 0.05 compared with NTg.

 
Overexpression of IGF1R Results in a Greater Augmentation of the Hypertrophic Response to a Physiological Stimulus than a Pathological Stimulus—In this set of experiments, IGF1R transgenics were subjected to a pathological stimulus (aortic banding for 1 week) or a physiological stimulus (chronic swimming training for 4 weeks). The degree of aortic stenosis, measured by the aortic pressure gradients across the bands of NTg and IGF1R transgenic mice, was similar (25.7 ± 2.9 and 26.8 ± 3.4 mmHg, respectively, determined by echocardiography). In response to aortic banding or swimming training, the HW/BW ratio of NTg and IGF1R increased significantly compared with control (non-swim or sham) (Fig. 4B). However, compared with the percent increases attained in NTg mice (aortic banding {approx} 60%, exercise {approx} 40%), IGF1R transgenics displayed a decreased response to aortic banding ({approx}30% increase) and an increased response to swimming training ({approx}50% increase, Fig. 4B). These results are consistent with the working hypothesis that IGF1 plays an important role in the development of physiological cardiac hypertrophy.

We have previously reported that aortic constriction for 1 week results in interstitial fibrosis in the left ventricle (21). The area of fibrosis in left ventricles from aortic banded NTg mice was significantly greater than that observed in the left ventricles of IGF1R transgenics (Fig. 4C).

Transcriptional Effects Induced by the IGF1R-PI3K(p110{alpha}) Pathway in the Heart—There is growing evidence to suggest that pathological and physiological cardiac hypertrophy are mediated by distinct signaling pathways (10, 16, 21, 33-40). It is therefore likely that the transcriptional regulation of pathological and physiological hypertrophy will also be different. To identify genes that may be important for the physiological hypertrophic response induced by the IGF1R-PI3K(p110{alpha}) pathway, we measured gene expression in hearts from NTg, IGF1R, caPI3K, dnPI3K, dnPI3KxIGF1R, and caPI3KxIGF1R transgenic mice using microarray analysis. Such analysis was considered a valuable tool because we had three groups of mice with significantly larger hearts than NTg mice (i.e. IGF1R, caPI3K, and caPI3KxIGF1R) and two groups of mice with significantly smaller hearts (dnPI3K, dnPI3KxIGF1R). Fig. 5 shows the results of k-means clustering analysis (k = 9) after choosing median values from three independent and biological replicates for visualization purpose (genes in each cluster are presented in Supplemental Data, available in the on-line version of this article). Genes in cluster 3 showed a positive relationship with HW/BW, and genes in cluster 8 displayed an inverse relationship (Fig. 5). Next, we regressed gene expression levels from NTg, IGF1R, caPI3K, dnPI3K, IGF1RxcaPI3K, and IGF1RxdnPI3K transgenic mice with the HW/BW ratio of these mice. A list of genes that best correlated (positive relationship) with HW/BW ratio is shown in Table IV, and a list of genes that were inversely related to HW/BW is shown in Table V.



View larger version (45K):
[in this window]
[in a new window]
  		FIG. 5.
Microarray analysis of IGF1R and PI3K transgenics. Figure gives hierarchical and k-means clustering analysis, showing nine distinct patterns of gene expression. The vertical scale indicates the log2 of relative differential gene expression. Groups of transgenic and NTg are shown on the horizontal axis.

 


View this table:
[in this window]
[in a new window]
  		TABLE IV
Microarray analysis: genes positively correlated with HW/BW ratio of IGF1R and PI3K transgenic mice (3 months)

Normalized HW/BW ratio of NTg and transgenic mice appears at the top of each column. r2 refers to the correlation between gene expression levels and HW/BW. Procollagen-proline, 2-oxoglutarate (P4ha2); heat shock protein (Hsp); epithelial membrane protein 1 (EMP-1), RNA-binding protein regulatory subunit (Dj1). *, p < 0.05 compared to NTg; #, p < 0.05 compared to IGF1R and IGF1R x caPI3K.

 


View this table:
[in this window]
[in a new window]
  		TABLE V
Microarray analysis: genes inversely correlated with HW/BW ratio of IGF1R and PI3K transgenic mice (3 months)

Normalized HW/BW ratio of NTg and transgenic mice appears at the top of each column. r2 refers to the correlation between gene expression levels and HW/BW. Table shows binding protein (bp), ribosomal protein (Rp), protein kinase, AMP-activated, {beta}1 non-catalytic subunit (Prkab1), actin, {alpha}2, smooth muscle, aorta (Acta 2), phenylalanine hydroxylase (Pah), and thioether S-methyltransferase (Temt).*, p <0.05 compared to NTg; #, p <0.05 compared to IGF1R and IGF1R x caPI3K.

 
The differential expression levels of a number of genes identified by microarray analysis were validated by Northern blots. Expression levels of genes that changed dramatically between groups (e.g. {alpha}-skeletal actin) as well as those that displayed more subtle but highly significant changes (e.g. Ptdss1, HB-EGF, and PAH) could be verified by Northern analysis. Regression analysis between gene expression levels obtained by Northern and microarray analysis were significantly correlated ({alpha}-skeletal actin: r2 = 0.93, p < 0.0001; Ptdss1: r2 = 0.70, p < 0.0001; HB-EGF: r2 = 0.61, p = 0.0001; PAH: r2 = 0.82, p < 0.0001).

The genetic crossing experiments clearly show that IGF1R regulates heart size in a PI3K(p110{alpha})-dependent manner. Interestingly, IGF1R also regulated the expression of some genes in a PI3K(p110{alpha})-independent manner (Fig. 5, cluster 2).

Fetal Gene Expression—In IGF1R transgenics, {alpha}-skeletal actin, BNP, and {beta}-MHC were elevated 3.2-, 2.7-, and 2.4-fold, respectively, compared with NTg (Fig. 6A). Interestingly, {alpha}-skeletal actin and {beta}-MHC were also elevated in caPI3K and IGF1R-caPI3K double transgenics, but BNP was not elevated in caPI3K transgenics alone. The dnPI3K mutant appeared to reverse the changes in {alpha}-skeletal actin, BNP, and {beta}-MHC expression induced by IGF1R. As previously reported (16), ANP was elevated in dnPI3K transgenics but not significantly different in other groups. Pathological cardiac hypertrophy, rather than physiological hypertrophy, is most commonly associated with re-expression of the fetal gene program (41). However, it is noteworthy that the changes observed in IGF1R transgenics were considerably less than those observed in response to a pathological stress (aortic banding, BNP: 6-fold, {alpha}-skeletal actin: 9-fold, {beta}-MHC: 15-fold, ANP: 6-fold (Ref. 21)) and not too dissimilar to what we observed in mice subjected to swimming training for 4 weeks (physiological model) (21) (Fig. 6B).



View larger version (25K):
[in this window]
[in a new window]
  		FIG. 6.
Fetal gene expression of IGF1R transgenics. A, quantitative analysis of fetal gene expression: {alpha}-skeletal actin ({alpha}-sk actin), ANP, BNP, and {beta}-MHC. Expression of GAPDH was determined to verify equal loading of RNA. Mean values for NTg were normalized to 1 (n = 3 for each group). *, p < 0.05 compared with NTg; #, p < 0.05 compared with IGF1R; +, p < 0.05 compared with caPI3K; ^, p < 0.05 compared with IGF1R-caPI3K. B, representative Northern blot showing total RNA from ventricles of non-swim (ns), swim (sw), NTg (NT), IGF1R (IGF), sham (Sh), and aortic banded (B) mice.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
Cardiac hypertrophy is induced by pathological stimuli (e.g. pressure or volume overload) or physiological stimuli (e.g. developmental growth, exercise training) (21, 41-43). Physiological hypertrophy is characterized by a normal organization of cardiac structure, and normal or enhanced cardiac function, whereas pathological hypertrophy is associated with an altered pattern of cardiac gene expression, fibrosis, cardiac dysfunction, and increased morbidity and mortality (44-47). Early reports suggested that IGF1 mediated beneficial "physiological" effects on the heart, and it was considered a possible candidate for the treatment of heart failure. However, clinical trials in which IGF1 was chronically administered to humans were disappointing (2, 3) and results from two transgenic mouse models in which IGF1 was overexpressed in the heart were conflicting (12, 13). In both studies transgene expression was associated with cardiac hypertrophy. However, secondary effects of IGF1 on other organs were also apparent. In the study by Delaughter and colleagues (13), systolic performance was enhanced in mice at 10 weeks but was severely depressed by 52 weeks and fibrosis was evident in the left ventricle. The authors suggested that IGF1 initially causes "physiological" hypertrophy but this progresses to "pathological" hypertrophy. By contrast, Reiss et al. (12) reported that ventricular hemodynamics in IGF1 transgenic mice were essentially identical to that of non-transgenic mice up to 300 days of age, although no data were shown and histological analysis was not reported. These conflicting results may be explained, in part, by the use of different promoters to express the transgene. Further, IGF1 serum levels were elevated in the study by Reiss et al. (12) but not that of Delaughter et al. (13).

Overexpression of IGF1R in Cardiac Myocytes Induced Physiological Cardiac Hypertrophy—In the current study, IGF1R transgenics displayed cardiac hypertrophy, which was not associated with changes in the weights of other organs. The increase in heart size was the result of an increase in myocyte size, was not associated with a pathological phenotype, and is reminiscent of the "physiological" phenotype displayed in transgenic mice expressing a caPI3K mutant (16). To examine whether chronic overexpression of IGF1R eventually leads to cardiac dysfunction, we examined cardiac function in mice at 3 months of age as well as at 12-16 months of age. In IGF1R transgenics ventricular function was enhanced at 3 months of age, and this was maintained in mice at 12-16 months age. Thus, our transgenic model clearly did not progress from a physiological phenotype to a pathological phenotype.

We believe the most likely explanation for differences between our study and those by Reiss et al. (12) and Delaughter et al. (13) is the secondary effect of IGF1 on other cell types and tissues in their studies. Alternatively, because we generated transgenic mice expressing the IGF1 receptor, whereas the other groups generated mice expressing the ligand, another explanation is that, in addition to binding to IGF1 receptors, IGF1 also bound to IGF2 receptors and to insulin receptors in their studies.

IGF1R Induced Cardiac Hypertrophy in a PI3K(p110{alpha})-dependent Manner—In the current study, the PI3K-Akt-p70S6K1 pathway was significantly activated in hearts from IGF1R transgenics compared with NTg mice. By contrast, we detected no activation of the MAPK pathways or calcineurin in IGF1R transgenics. To examine whether PI3K(p110{alpha}) is necessary for IGF1R-mediated hypertrophy, we crossed IGF1R transgenics with mice expressing a dnPI3K(p110{alpha}) mutant. A novel finding of the current study was that cardiac hypertrophy induced by overexpression of IGF1R was completely blocked by the dnPI3K mutant. This suggests that IGF1R promotes compensated cardiac hypertrophy in a PI3K(p110{alpha})-dependent manner. PI3K has also been implicated for inducing the inotropic effects of IGF1. Preincubation of human ventricular muscle with a selective PI3K inhibitor, wortmannin, prevented the IGF1-dependent inotropic effect and the increase in Ca2+ transients (48). However, this inhibitor cannot distinguish between the function of the different PI3K isoforms.

IGF1R Overexpression Reduced the Amount of Fibrosis Normally Associated with Pressure Overload-induced Hypertrophy—Another interesting finding to come from the current study was that hearts of aortic banded IGF1R transgenics had significantly less interstitial fibrosis than aortic banded NTg, suggesting that IGF1R may be protective in a setting of heart disease. In support of this, utilizing the IGF1 transgenic mice generated by Reiss et al. (12), the same group demonstrated that expression of IGF1 attenuated dilated cardiomyopathy in tropomodulin-overexpressing mice (11) and was protective against myocyte death after myocardial infarction (49). Furthermore, IGF1 transgene expression was reported to significantly reduce the amount of fibrosis in diaphragms from aged mdx mice (50).

Transcriptional Regulatory Effects of the IGF1R—Pathological and physiological cardiac hypertrophy appear to be mediated by distinct signaling pathways (10, 16, 21, 33-40). The current study supports the idea that the IGF1-PI3K(p110{alpha}) pathway plays an important role for the induction of physiological hypertrophy, whereas the Gq pathway appears to mediate pathological hypertrophy (34-36). It is therefore likely that the transcriptional regulation of pathological and physiological hypertrophy will be different.

Transcriptional changes induced by IGF1 in cardiomyocytes have been studied in vitro (29, 31). In neonatal rat cardiomyocytes, IGF1 increased mRNA levels for myosin light chain 2, troponin I, and skeletal {alpha}-actin (29). A more extensive study utilizing DNA microarray identified 68 genes that were modulated by IGF1 in isolated neonatal rat cardiomyocytes (31). However, to our knowledge the current study is the first to extensively examine the transcriptional profile of IGF1R in the adult heart in vivo. The goal of the microarray experiments was to identify genes that are induced by the IGF1R-PI3K(p110{alpha}) pathway and are tightly associated with the hypertrophic phenotype.

Transcriptional Changes Implicated in Regulating Cell Growth—A number of the identified genes that were positively correlated with HW/BW have been implicated in regulating cell growth or proliferation. These include IGF-binding protein 5 (IGFBP-5; Ref. 51), epithelial membrane protein 1 (EMP-1, Ref. 52), RNA-binding protein regulatory subunit (53), HB-EGF, and phosphatidylserine synthase 1 (54-57). Expression of IGFBP-5 was significantly greater in hearts from IGF1R, caPI3K, and IGF1RxcaPI3K compared with NTg, dnPI3K, and IGF1RxdnPI3K transgenic mice. This is consistent with a previous report in which IGF1 was shown to regulate IGFBP-5 gene expression via the PI3K-Akt pathway (58). IGFBP-5 was also elevated in hearts from transgenic mice with cardiac-specific expression of activated Akt (59). IGF-binding proteins regulate the amount of IGF that is able to bind to cell surface receptors (51). It has been suggested that up-regulation of IGFBP-5 potentiates the growth response to IGF1 (51) and may have a cardioprotective effect via modulation of anti-apoptotic activity (60, 61). The correlation between HW/BW and HB-EGF was very high (r2 = 0.889). HB-EGF is a member of the EGF family of growth factors that activates the EGF receptor and related receptor tyrosine kinase, ErbB4. HB-EGF null mice have dilated cardiac chambers and depressed cardiac function (62). Cross-talk between IGF1R and EGF receptors was demonstrated in COS-7 cells (63).

Transcriptional Changes Implicated in Affecting Cardiac Contractile Function—Up-regulated genes that may affect cardiac contractile function include {alpha}-skeletal actin, myosin light chain alkali (fast skeletal muscle), tropomyosin 3{gamma}, capping protein {alpha}1, and calsequestrin. Tropomyosin (TPM) is an actin-binding protein and a major component of the sarcomeric thin filament. The tropomyosin family is composed of 4 genes (TPM1 ({alpha}-TM), TPM2 ({beta}-TM), TPM3 ({gamma}-TM), and TPM4 ({delta}-TM)). In the current study, TPM3 was positively correlated with HW/BW ratio whereas TPM2 was inversely related to the hypertrophic phenotype. The striated muscle form of TPM3 is expressed in the adult human heart (64), and cardiac overexpression of TPM3 in transgenic mice leads to hypercontractility (65). By contrast, TPM2 is usually expressed at low levels during postnatal life (66), and transgenic mice with low overexpression of TPM2 displayed impairment of diastolic function, which was linked to impaired myocyte relaxation and decreased maximal tension in isolated preparations (67, 68). Higher overexpression resulted in severe cardiac pathology including dilatation, myolysis, fibrosis, decreased contractility, formation of thrombi, and lethality in early postnatal life (69). Together, the positive correlation of HW/BW with TPM3 and the inverse relationship with TPM2 fit with the idea that IGF1 promotes physiological hypertrophy with preserved contractile function.

Actin capping proteins are heterodimers composed of an {alpha}- and {beta}-subunit, and are important for thin filament length regulation, sarcomere organization, and muscle function (70-72). In cardiac myocytes the {beta}1 and {beta}2 subunit are localized to the Z-line, and intercalated disc and cell periphery, respectively (73). The subcellular distribution of the {alpha}-subunit is unknown. In the current study, capping protein {alpha}1 was highly correlated with HW/BW (Table IV). Capping protein {beta}1 was reported to be a critical element in protein kinase C signaling to cardiac myofilaments (74). The current study suggests that capping protein {alpha}1 may play an important role in IGF1R-PI3K(p110{alpha}) signaling to cardiac myocytes. Phosphoinositides have been implicated as mediators of actin assembly (75, 76).

Transcriptional Changes Implicated in Cell Survival—A group of genes associated with protecting cells against injury and increasing cell survival were also closely correlated with HW/BW (e.g. clusterin (77), serpins (78), hsp70 (79, 80)). This is consistent with the idea that the IGF1-PI3K(p110{alpha}) pathway is involved with promoting cell survival. In response to a model of myocarditis, clusterin-deficient mice exhibited cardiac dysfunction and more severe myocardial scarring than wild-type mice. The authors concluded that clusterin limits the progression of autoimmune myocarditis and protects the heart from postinflammatory tissue destruction (77). Hearts of transgenic mice overexpressing an inducible hsp70 displayed increased resistance to ischemic injury (79), and gene transfer of hsp70 reduced infarct size in the rabbit heart after ischemia/reperfusion (80).

Unexpectedly, the expression of three collagen genes (procollagen, type 1; procollagen, type 8; procollagen-proline, 2-oxoglutarate) was also correlated with HW/BW. Increases in collagen metabolism and associated fibrosis are usually associated with pathological cardiac hypertrophy. However, it has become apparent that elucidating key factors that regulate both the quantity and quality of collagen laid down in the extracellular matrix is difficult. Procollagen mRNA was reported to increase in two "physiological" models (exercise, thyroxin) without resulting in disproportionate collagen accumulation, interstitial fibrosis, and cardiac dysfunction (81).

Transcriptional Changes Inversely Correlated with the HW/BW—A number of genes were inversely correlated with HW/BW in our transgenic models and may represent genes that negatively regulate IGF1R-PI3K(p110{alpha}) signaling. Interestingly, some of the best correlations were with genes that are not typically associated with the heart, including PAH and a kidney disease mutant (Table V). Gene expression of preproenkephalin was also lower in each of the hypertrophic models compared with NTg, dnPI3K, and IGF1RxdnPI3K transgenics. Proenkephalin is one of the major precursors of endogenous opioids, and the heart contains the largest amount of preproenkephalin mRNA (82). Local enkephalin synthesis from proenkephalin has been reported in the rat heart, and opiate receptors have been localized in cardiac myocytes (83). Increased expression of preproenkephalin mRNA was reported in a model of cardiac hypertrophy induced by hypertension, myocardial infarction, and cardiomyopathy (82).

Expression of Fetal Genes in IGF1R Transgenics—Cardiac hypertrophy is often associated with re-expression of the fetal gene program (41). In the current study, gene expression of BNP, {alpha}-skeletal actin, and {beta}-MHC was moderately elevated in hearts of IGF1R transgenics. Re-expression of these genes are classically considered hallmarks of pathological hypertrophy rather than physiological hypertrophy. However, there is a growing body of evidence to suggest that fetal gene expression alone is probably not an accurate marker of pathological hypertrophy. There are a number of examples in the literature of transgenic mice that do not display a pathological phenotype but are associated with changes in fetal gene expression. Bueno et al. (84) reported that transgenic mice expressing an activated form of MEK1 develop physiologic hypertrophy, which was associated with augmented cardiac function and partial resistance to apoptosis. In this model, hypertrophy was associated with increased expression of ANP, BNP, skeletal {alpha}-actin, and {beta}-MHC. Furthermore, transgenic expression of glycogen synhtase-3{beta} or dnPI3K in hearts of mice had no apparent affect on cardiac function or lifespan but was also associated with increased expression of some fetal genes (16, 85). We believe the most accurate markers for determining whether cardiac hypertrophy is "physiological" or "pathological" in nature are functional parameters and histological analysis, both of which suggest that IGF1R transgenics display physiological cardiac hypertrophy.

To our knowledge this is the first study to analyze the role of IGF1 specifically in cardiac myocytes in vivo. We have demonstrated that overexpression of IGF1R induces physiological cardiac hypertrophy and that PI3K(p110{alpha}) is the critical downstream signaling molecule of the IGF1R pathway for the regulation of heart size, and we have identified genes that may be important for the transcriptional control of physiological cardiac hypertrophy. An effective way to treat heart failure may include the use of agents that block pathological hypertrophy in conjunction with agents that induce physiological hypertrophy. This study suggests that targeting the cardiac IGF1R-PI3K(p110{alpha}) pathway could be a potential therapeutic strategy for promoting physiological cardiac growth and improving contractile function.


   FOOTNOTES
 
* This work was supported by National Institutes of Health Grant RO1 HL65742 and by Grant UO1-HL66582 (to S. I.) from the CardioGenomics Program for Genomic Applications, NHLBI, National Institutes of Health. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

The on-line version of this article (available at http://www.jbc.org) contains additional microarray data. Back

§ Both authors contributed equally to this work. Back

|| Present address: Dept. of Internal Medicine and Cardiology, Kitasato University, School of Medicine, Sagamihara 228-8555, Japan. Back

To whom correspondence should be addressed: Cardiovascular Division, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, MA 02215. Tel.: 617-667-4863; Fax: 617-975-5268; E-mail: jmcmulle{at}bidmc.harvard.edu.

1 The abbreviations used are: IGF, insulin-like growth factor; IGF1R, insulin-like growth factor 1 receptor; MHC, myosin heavy chain; ca, constitutively active; dn, dominant negative; HW, heart weight; BW, body weight; TPM, tropomyosin; PI3K, phosphoinositide 3-kinase; NTg, non-transgenic; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; IRS, insulin receptor substrate; HB-EGF, heparin-binding epidermal growth factor-like growth factor; EGF, epidermal growth factor; MAPK, mitogen-activated protein kinase; PAH, phenylalanine hydroxylase; Ptdss1, phosphatidylserine synthase 1; ANP, atrial natriuretic peptide; BNP, brain natriuretic peptide. Back


   ACKNOWLEDGMENTS
 
We thank J. Lawitts (Transgenic Facility, Beth Israel Deaconess Medical Center, Boston, MA) for generation of transgenic mice, Maria Rivera for assistance swimming the mice, P. Jay and O. Rozhitskaya for Northern probes, and J. Blenis for the glutathione S-transferase-S6 plasmid.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Packer, M. (2002) J. Card. Fail. 8, 193-196[CrossRef][Medline] [Order article via Infotrieve]
  2. Ren, J., Samson, W. K., and Sowers, J. R. (1999) J. Mol. Cell Cardiol. 31, 2049-2061[CrossRef][Medline] [Order article via Infotrieve]
  3. Colao, A., Marzullo, P., Di Somma, C., and Lombardi, G. (2001) Clin. Endocrinol. (Oxf.) 54, 137-154[CrossRef][Medline] [Order article via Infotrieve]
  4. DeChiara, T. M., Efstratiadis, A., and Robertson, E. J. (1990) Nature 345, 78-80[CrossRef][Medline] [Order article via Infotrieve]
  5. Baker, J., Liu, J. P., Robertson, E. J., and Efstratiadis, A. (1993) Cell 75, 73-82[CrossRef][Medline] [Order article via Infotrieve]
  6. Liu, J. P., Baker, J., Perkins, A. S., Robertson, E. J., and Efstratiadis, A. (1993) Cell 75, 59-72[Medline] [Order article via Infotrieve]
  7. Lupu, F., Terwilliger, J. D., Lee, K., Segre, G. V., and Efstratiadis, A. (2001) Dev. Biol. 229, 141-162[CrossRef][Medline] [Order article via Infotrieve]
  8. Cittadini, A., Cuocolo, A., Merola, B., Fazio, S., Sabatini, D., Nicolai, E., Colao, A., Longobardi, S., Lombardi, G., and Sacca, L. (1994) Am. J. Physiol. 267, E219-E225[Medline] [Order article via Infotrieve]
  9. Merola, B., Cittadini, A., Colao, A., Longobardi, S., Fazio, S., Sabatini, D., Sacca, L., and Lombardi, G. (1993) J. Clin. Endocrinol. Metab. 77, 1658-1661[Abstract]
  10. Duerr, R. L., Huang, S., Miraliakbar, H. R., Clark, R., Chien, K. R., and Ross, J., Jr. (1995) J. Clin. Invest. 95, 619-627[Medline] [Order article via Infotrieve]
  11. Welch, S., Plank, D., Witt, S., Glascock, B., Schaefer, E., Chimenti, S., Andreoli, A. M., Limana, F., Leri, A., Kajstura, J., Anversa, P., and Sussman, M. A. (2002) Circ. Res. 90, 641-648[Abstract/Free Full Text]
  12. Reiss, K., Cheng, W., Ferber, A., Kajstura, J., Li, P., Li, B., Olivetti, G., Homcy, C. J., Baserga, R., and Anversa, P. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 8630-8635[Abstract/Free Full Text]
  13. Delaughter, M. C., Taffet, G. E., Fiorotto, M. L., Entman, M. L., and Schwartz, R. J. (1999) FASEB J. 13, 1923-1929[Abstract/Free Full Text]
  14. Fiorotto, M. L., Schwartz, R. J., and Delaughter, M. C. (2003) FASEB J. 17, 59-60[Abstract/Free Full Text]
  15. Foncea, R., Andersson, M., Ketterman, A., Blakesley, V., Sapag-Hagar, M., Sugden, P. H., LeRoith, D., and Lavandero, S. (1997) J. Biol. Chem. 272, 19115-19124[Abstract/Free Full Text]
  16. Shioi, T., Kang, P. M., Douglas, P. S., Hampe, J., Yballe, C. M., Lawitts, J., Cantley, L. C., and Izumo, S. (2000) EMBO J. 19, 2537-2548[CrossRef][Medline] [Order article via Infotrieve]
  17. Gulick, J., Subramaniam, A., Neumann, J., and Robbins, J. (1991) J. Biol. Chem. 266, 9180-9185[Abstract/Free Full Text]
  18. Guse, A. H., Kiess, W., Funk, B., Kessler, U., Berg, I., and Gercken, G. (1992) Endocrinology 130, 145-151[Abstract/Free Full Text]
  19. Shioi, T., McMullen, J. R., Tarnavski, O., Converso, K., Sherwood, M. C., Manning, W. J., and Izumo, S. (2003) Circulation 107, 1664-1670[Abstract/Free Full Text]
  20. Shioi, T., McMullen, J. R., Kang, P. M., Douglas, P. S., Obata, T., Franke, T. F., Cantley, L. C., and Izumo, S. (2002) Mol. Cell. Biol. 22, 2799-2809[Abstract/Free Full Text]
  21. McMullen, J. R., Shioi, T., Zhang, L., Tarnavski, O., Sherwood, M. C., Kang, P. M., and Izumo, S. (2003) Proc. Natl. Acad. Sci. U. S. A. 100, 12355-12360[Abstract/Free Full Text]
  22. Lim, H. W., De Windt, L. J., Steinberg, L., Taigen, T., Witt, S. A., Kimball, T. R., and Molkentin, J. D. (2000) Circulation 101, 2431-2437[Abstract/Free Full Text]
  23. Lim, H. W., and Molkentin, J. D. (1999) Nat. Med. 5, 246-247[CrossRef][Medline] [Order article via Infotrieve]
  24. Schadt, E. E., Li, C., Ellis, B., and Wong, W. H. (2001) J. Cell. Biochem. Suppl. 37, 120-125[Medline] [Order article via Infotrieve]
  25. Irizarry, R. A., Bolstad, B. M., Collin, F., Cope, L. M., Hobbs, B., and Speed, T. P. (2003) Nucleic Acids Res. 31, e15[Abstract/Free Full Text]
  26. Tanaka, M., Chen, Z., Bartunkova, S., Yamasaki, N., and Izumo, S. (1999) Development 126, 1269-1280[Abstract]
  27. Kasahara, H., Bartunkova, S., Schinke, M., Tanaka, M., and Izumo, S. (1998) Circ. Res. 82, 936-946[Abstract/Free Full Text]
  28. Kajstura, J., Cheng, W., Reiss, K., and Anversa, P. (1994) Exp. Cell Res. 215, 273-283[CrossRef][Medline] [Order article via Infotrieve]
  29. Ito, H., Hiroe, M., Hirata, Y., Tsujino, M., Adachi, S., Shichiri, M., Koike, A., Nogami, A., and Marumo, F. (1993) Circulation 87, 1715-1721[Abstract/Free Full Text]
  30. Donath, M. Y., Zapf, J., Eppenberger-Eberhardt, M., Froesch, E. R., and Eppenberger, H. M. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 1686-1690[Abstract/Free Full Text]
  31. Liu, T., Lai, H., Wu, W., Chinn, S., and Wang, P. H. (2001) Circ. Res. 88, 1231-1238[Abstract/Free Full Text]
  32. Oldham, S., and Hafen, E. (2003) Trends Cell Biol. 13, 79-85[CrossRef][Medline] [Order article via Infotrieve]
  33. Tanaka, N., Ryoke, T., Hongo, M., Mao, L., Rockman, H. A., Clark, R. G., and Ross, J., Jr. (1998) Am. J. Physiol. 275, H393-H399[Medline] [Order article via Infotrieve]
  34. D'Angelo, D. D., Sakata, Y., Lorenz, J. N., Boivin, G. P., Walsh, R. A., Liggett, S. B., and Dorn, G. W., II (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 8121-8126[Abstract/Free Full Text]
  35. Wettschureck, N., Rutten, H., Zywietz, A., Gehring, D., Wilkie, T. M., Chen, J., Chien, K. R., and Offermanns, S. (2001) Nat. Med. 7, 1236-1240[CrossRef][Medline] [Order article via Infotrieve]
  36. Akhter, S. A., Luttrell, L. M., Rockman, H. A., Iaccarino, G., Lefkowitz, R. J., and Koch, W. J. (1998) Science 280, 574-577[Abstract/Free Full Text]
  37. Geenen, D. L., Malhotra, A., and Buttrick, P. M. (1996) J. Appl. Physiol. 81, 816-821[Abstract/Free Full Text]
  38. Neri Serneri, G. G., Boddi, M., Modesti, P. A., Cecioni, I., Coppo, M., Padeletti, L., Michelucci, A., Colella, A., and Galanti, G. (2001) Circ. Res. 89, 977-982[Abstract/Free Full Text]
  39. Lembo, G., Rockman, H. A., Hunter, J. J., Steinmetz, H., Koch, W. J., Ma, L., Prinz, M. P., Ross, J., Jr., Chien, K. R., and Powell-Braxton, L. (1996) J. Clin. Invest. 98, 2648-2655[Medline] [Order article via Infotrieve]
  40. Neri Serneri, G. G., Boddi, M., Poggesi, L., Simonetti, I., Coppo, M., Papa, M. L., Lisi, G. F., Maccherini, M., Becherini, R., Boncompagni, A., Toscano, T., and Modesti, P. A. (2001) J. Am. Coll. Cardiol. 38, 49-55[Abstract/Free Full Text]
  41. Izumo, S., Nadal-Ginard, B., and Mahdavi, V. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 339-343[Abstract/Free Full Text]
  42. Scheuer, J., and Buttrick, P. (1987) Circulation 75, I63-68[Medline] [Order article via Infotrieve]
  43. Iemitsu, M., Miyauchi, T., Maeda, S., Sakai, S., Kobayashi, T., Fujii, N., Miyazaki, H., Matsuda, M., and Yamaguchi, I. (2001) Am. J. Physiol. 281, R2029-R2036
  44. Kaplan, M. L., Cheslow, Y., Vikstrom, K., Malhotra, A., Geenen, D. L., Nakouzi, A., Leinwand, L. A., and Buttrick, P. M. (1994) Am. J. Physiol. 267, H1167-H1173[Medline] [Order article via Infotrieve]
  45. Fagard, R. H. (1997) Cardiol. Clin. 15, 397-412[CrossRef][Medline] [Order article via Infotrieve]
  46. Cohn, J. N., Bristow, M. R., Chien, K. R., Colucci, W. S., Frazier, O. H., Leinwand, L. A., Lorell, B. H., Moss, A. J., Sonnenblick, E. H., Walsh, R. A., Mockrin, S. C., and Reinlib, L. (1997) Circulation 95, 766-770[Free Full Text]
  47. Levy, D., Garrison, R. J., Savage, D. D., Kannel, W. B., and Castelli, W. P. (1990) N. Engl. J. Med. 322, 1561-1566[Abstract]
  48. von Lewinski, D., Voss, K., Hulsmann, S., Kogler, H., and Pieske, B. (2003) Circ. Res. 92, 169-176[Abstract/Free Full Text]
  49. Li, B., Setoguchi, M., Wang, X., Andreoli, A. M., Leri, A., Malhotra, A., Kajstura, J., and Anversa, P. (1999) Circ. Res. 84, 1007-1019[Abstract/Free Full Text]
  50. Barton, E. R., Morris, L., Musaro, A., Rosenthal, N., and Sweeney, H. L. (2002) J. Cell Biol. 157, 137-148[Abstract/Free Full Text]
  51. Clemmons, D. R. (1998) Mol. Cell. Endocrinol. 140, 19-24[CrossRef][Medline] [Order article via Infotrieve]
  52. Taylor, V., Welcher, A. A., Program, A. E., and Suter, U. (1995) J. Biol. Chem. 270, 28824-28833[Abstract/Free Full Text]
  53. Nagakubo, D., Taira, T., Kitaura, H., Ikeda, M., Tamai, K., Iguchi-Ariga, S. M., and Ariga, H. (1997) Biochem. Biophys. Res. Commun. 231, 509-513[CrossRef][Medline] [Order article via Infotrieve]
  54. Kuge, O., Nishijima, M., and Akamatsu, Y. (1986) J. Biol. Chem. 261, 5795-5798[Abstract/Free Full Text]
  55. Voelker, D. R., and Frazier, J. L. (1986) J. Biol. Chem. 261, 1002-1008[Abstract/Free Full Text]
  56. Sturbois-Balcerzak, B., Stone, S. J., Sreenivas, A., and Vance, J. E. (2001) J. Biol. Chem. 276, 8205-8212[Abstract/Free Full Text]
  57. Bergo, M. O., Gavino, B. J., Steenbergen, R., Sturbois, B., Parlow, A. F., Sanan, D. A., Skarnes, W. C., Vance, J. E., and Young, S. G. (2002) J. Biol. Chem. 277, 47701-47708[Abstract/Free Full Text]
  58. Duan, C., Liimatta, M. B., and Bottum, O. L. (1999) J. Biol. Chem. 274, 37147-37153[Abstract/Free Full Text]
  59. Cook, S. A., Matsui, T., Li, L., and Rosenzweig, A. (2002) J. Biol. Chem. 277, 22528-22533[Abstract/Free Full Text]
  60. Roschier, M., Kuusisto, E., Suuronen, T., Korhonen, P., Kyrylenko, S., and Salminen, A. (2001) J. Neurochem. 76, 11-20[CrossRef][Medline] [Order article via Infotrieve]
  61. McCaig, C., Perks, C. M., and Holly, J. M. (2002) J. Cell. Biochem. 84, 784-794[CrossRef][Medline] [Order article via Infotrieve]
  62. Iwamoto, R., Yamazaki, S., Asakura, M., Takashima, S., Hasuwa, H., Miyado, K., Adachi, S., Kitakaze, M., Hashimoto, K., Raab, G., Nanba, D., Higashiyama, S., Hori, M., Klagsbrun, M., and Mekada, E. (2003) Proc. Natl. Acad. Sci. U. S. A. 100, 3221-3226[Abstract/Free Full Text]
  63. Roudabush, F. L., Pierce, K. L., Maudsley, S., Khan, K. D., and Luttrell, L. M. (2000) J. Biol. Chem. 275, 22583-22589[Abstract/Free Full Text]
  64. Reinach, F. C., and MacLeod, A. R. (1986) Nature 322, 648-650[CrossRef][Medline] [Order article via Infotrieve]
  65. Pieples, K., Arteaga, G., Solaro, R. J., Grupp, I., Lorenz, J. N., Boivin, G. P., Jagatheesan, G., Labitzke, E., DeTombe, P. P., Konhilas, J. P., Irving, T. C., and Wieczorek, D. F. (2002) Am. J. Physiol. 283, H1344-H1353
  66. Wolska, B. M., and Wieczorek, D. M. (2003) Pflugers Arch. 446, 1-8[CrossRef][Medline] [Order article via Infotrieve]
  67. Muthuchamy, M., Grupp, I. L., Grupp, G., O'Toole, B. A., Kier, A. B., Boivin, G. P., Neumann, J., and Wieczorek, D. F. (1995) J. Biol. Chem. 270, 30593-30603[Abstract/Free Full Text]
  68. Wolska, B. M., Keller, R. S., Evans, C. C., Palmiter, K. A., Phillips, R. M., Muthuchamy, M., Oehlenschlager, J., Wieczorek, D. F., de Tombe, P. P., and Solaro, R. J. (1999) Circ. Res. 84, 745-751[Abstract/Free Full Text]
  69. Muthuchamy, M., Boivin, G. P., Grupp, I. L., and Wieczorek, D. F. (1998) J. Mol. Cell Cardiol. 30, 1545-1557[CrossRef][Medline] [Order article via Infotrieve]
  70. Hart, M. C., Korshunova, Y. O., and Cooper, J. A. (1997) Genomics 39, 264-270[CrossRef][Medline] [Order article via Infotrieve]
  71. Hart, M. C., Korshunova, Y. O., and Cooper, J. A. (1997) Cell Motil. Cytoskeleton 38, 120-132[CrossRef][Medline] [Order article via Infotrieve]
  72. Littlefield, R., Almenar-Queralt, A., and Fowler, V. M. (2001) Nat. Cell Biol. 3, 544-551[CrossRef][Medline] [Order article via Infotrieve]
  73. Schafer, D. A., Korshunova, Y. O., Schroer, T. A., and Cooper, J. A. (1994) J. Cell Biol. 127, 453-465[Abstract/Free Full Text]
  74. Pyle, W. G., Hart, M. C., Cooper, J. A., Sumandea, M. P., de Tombe, P. P., and Solaro, R. J. (2002) Circ. Res. 90, 1299-1306[Abstract/Free Full Text]
  75. Janmey, P. A. (1994) Annu. Rev. Physiol. 56, 169-191[Medline] [Order article via Infotrieve]
  76. Schafer, D. A., Jennings, P. B., and Cooper, J. A. (1996) J. Cell Biol. 135, 169-179[Abstract/Free Full Text]
  77. McLaughlin, L., Zhu, G., Mistry, M., Ley-Ebert, C., Stuart, W. D., Florio, C. J., Groen, P. A., Witt, S. A., Kimball, T. R., Witte, D. P., Harmony, J. A., and Aronow, B. J. (2000) J. Clin. Invest. 106, 1105-1113[Medline] [Order article via Infotrieve]
  78. Silverman, G. A., Bird, P. I., Carrell, R. W., Church, F. C., Coughlin, P. B., Gettins, P. G., Irving, J. A., Lomas, D. A., Luke, C. J., Moyer, R. W., Pemberton, P. A., Remold-O'Donnell, E., Salvesen, G. S., Travis, J., and Whisstock, J. C. (2001) J. Biol. Chem. 276, 33293-33296[Free Full Text]
  79. Marber, M. S., Mestril, R., Chi, S. H., Sayen, M. R., Yellon, D. M., and Dillmann, W. H. (1995) J. Clin. Invest. 95, 1446-1456[Medline] [Order article via Infotrieve]
  80. Okubo, S., Wildner, O., Shah, M. R., Chelliah, J. C., Hess, M. L., and Kukreja, R. C. (2001) Circulation 103, 877-881[Abstract/Free Full Text]
  81. Thomas, D. P., Zimmerman, S. D., Hansen, T. R., Martin, D. T., and McCormick, R. J. (2000) J. Appl. Physiol. 89, 1462-1468[Abstract/Free Full Text]
  82. Hao, J. M., and Rabkin, S. W. (1997) Am. J. Physiol. 272, H2885-H2894[Medline] [Order article via Infotrieve]
  83. Younes, A., Pepe, S., Barron, B. A., Spurgeon, H. A., Lakatta, E. G., and Caffrey, J. L. (2000) Am. J. Physiol. 279, H1989-H1998
  84. Bueno, O. F., De Windt, L. J., Tymitz, K. M., Witt, S. A., Kimball, T. R., Klevitsky, R., Hewett, T. E., Jones, S. P., Lefer, D. J., Peng, C. F., Kitsis, R. N., and Molkentin, J. D. (2000) EMBO J. 19, 6341-6350[CrossRef][Medline] [Order article via Infotrieve]
  85. Antos, C. L., McKinsey, T. A., Frey, N., Kutschke, W., McAnally, J., Shelton, J. M., Richardson, J. A., Hill, J. A., and Olson, E. N. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, 907-912[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 EndocrinologyHome page
C.-H. Chu, B.-S. Tzang, L.-M. Chen, C.-J. Liu, F.-J. Tsai, C.-H. Tsai, J. A. Lin, W.-W. Kuo, D.-T. Bau, C.-H. Yao, et al.
Activation of Insulin-Like Growth Factor II Receptor Induces Mitochondrial-Dependent Apoptosis through G{alpha}q and Downstream Calcineurin Signaling in Myocardial Cells
Endocrinology, June 1, 2009; 150(6): 2723 - 2731.
[Abstract] [Full Text] [PDF]

Home page
 Circ. Res.Home page
L. A. DiMichele, Z. S. Hakim, R. L. Sayers, M. Rojas, R. J. Schwartz, C. P. Mack, and J. M. Taylor
Transient Expression of FRNK Reveals Stage-Specific Requirement for Focal Adhesion Kinase Activity in Cardiac Growth
Circ. Res., May 22, 2009; 104(10): 1201 - 1208.
[Abstract] [Full Text] [PDF]

Home page
 Cardiovasc ResHome page
S. Miyamoto, M. Rubio, and M. A. Sussman
Nuclear and mitochondrial signalling Akts in cardiomyocytes
Cardiovasc Res, May 1, 2009; 82(2): 272 - 285.
[Abstract] [Full Text] [PDF]

Home page
 JCBHome page
D. Catalucci, D.-H. Zhang, J. DeSantiago, F. Aimond, G. Barbara, J. Chemin, D. Bonci, E. Picht, F. Rusconi, N. D. Dalton, et al.
Akt regulates L-type Ca2+ channel activity by modulating Cav{alpha}1 protein stability
J. Cell Biol., March 23, 2009; 184(6): 923 - 933.
[Abstract] [Full Text] [PDF]

Home page
 Journal of Renin-Angiotensin-Aldosterone SystemHome page
E. M. Oliveira, M. S. Sasaki, M. Cerencio, V. G. Barauna, and J. E. Krieger
Local renin-angiotensin system regulates left ventricular hypertrophy induced by swimming training independent of circulating renin: a pharmacological study
Journal of Renin-Angiotensin-Aldosterone System, March 1, 2009; 10(1): 15 - 23.
[Abstract] [PDF]

Home page
 Am. J. Physiol. Heart Circ. Physiol.Home page
D. L. Rigor, N. Bodyak, S. Bae, J. H. Choi, L. Zhang, D. Ter-Ovanesyan, Z. He, J. R. McMullen, T. Shioi, S. Izumo, et al.
Phosphoinositide 3-kinase Akt signaling pathway interacts with protein kinase C{beta}2 in the regulation of physiologic developmental hypertrophy and heart function
Am J Physiol Heart Circ Physiol, March 1, 2009; 296(3): H566 - H572.
[Abstract] [Full Text] [PDF]

Home page
 Circ. Res.Home page
E. Chung and L. A. Leinwand
Rescuing Cardiac Malfunction: The Roles of the Chaperone-Like Small Heat Shock Proteins
Circ. Res., December 5, 2008; 103(12): 1351 - 1353.
[Full Text] [PDF]

Home page
 Mol. Endocrinol.Home page
J. Kim, A. R. Wende, S. Sena, H. A. Theobald, J. Soto, C. Sloan, B. E. Wayment, S. E. Litwin, M. Holzenberger, D. LeRoith, et al.
Insulin-Like Growth Factor I Receptor Signaling Is Required for Exercise-Induced Cardiac Hypertrophy
Mol. Endocrinol., November 1, 2008; 22(11): 2531 - 2543.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Heart Circ. Physiol.Home page
L. Y. Teos, A. Zhao, Z. Alvin, G. G. Laurence, C. Li, and G. E. Haddad
Basal and IGF-I-dependent regulation of potassium channels by MAP kinases and PI3-kinase during eccentric cardiac hypertrophy
Am J Physiol Heart Circ Physiol, November 1, 2008; 295(5): H1834 - H1845.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
W.-Q. Tan, K. Wang, D.-Y. Lv, and P.-F. Li
Foxo3a Inhibits Cardiomyocyte Hypertrophy through Transactivating Catalase
J. Biol. Chem., October 31, 2008; 283(44): 29730 - 29739.
[Abstract] [Full Text] [PDF]

Home page
 Exp PhysiolHome page
R. Stones, A. Natali, R. Billeter, S. Harrison, and E. White
Voluntary exercise-induced changes in {beta}2-adrenoceptor signalling in rat ventricular myocytes
Exp Physiol, September 1, 2008; 93(9): 1065 - 1075.
[Abstract] [Full Text] [PDF]

Home page
 J EndocrinolHome page
C.-H. Chu, B.-S. Tzang, L.-M. Chen, C.-H. Kuo, Y.-C. Cheng, L.-Y. Chen, F.-J. Tsai, C.-H. Tsai, W.-W. Kuo, and C.-Y. Huang
IGF-II/mannose-6-phosphate receptor signaling induced cell hypertrophy and atrial natriuretic peptide/BNP expression via G{alpha}q interaction and protein kinase C-{alpha}/CaMKII activation in H9c2 cardiomyoblast cells
J. Endocrinol., May 1, 2008; 197(2): 381 - 390.
[Abstract] [Full Text] [PDF]

Home page
 Eur J Heart FailHome page
C. Jacobshagen, M. Gruber, N. Teucher, A. G. Schmidt, B. W. Unsold, K. Toischer, P. Nguyen Van, L. S. Maier, H. Kogler, and G. Hasenfuss
Celecoxib modulates hypertrophic signalling and prevents load-induced cardiac dysfunction
Eur J Heart Fail, April 1, 2008; 10(4): 334 - 342.
[Abstract] [Full Text] [PDF]

Home page
 Circ. Res.Home page
H. J. Evans-Anderson, C. M. Alfieri, and K. E. Yutzey
Regulation of Cardiomyocyte Proliferation and Myocardial Growth During Development by FOXO Transcription Factors
Circ. Res., March 28, 2008; 102(6): 686 - 694.
[Abstract] [Full Text] [PDF]

Home page
 CirculationHome page
M. Taniike, O. Yamaguchi, I. Tsujimoto, S. Hikoso, T. Takeda, A. Nakai, S. Omiya, I. Mizote, Y. Nakano, Y. Higuchi, et al.
Apoptosis Signal-Regulating Kinase 1/p38 Signaling Pathway Negatively Regulates Physiological Hypertrophy
Circulation, January 29, 2008; 117(4): 545 - 552.
[Abstract] [Full Text] [PDF]

Home page
 The OncologistHome page
P. D. Ryan and P. E. Goss
The Emerging Role of the Insulin-Like Growth Factor Pathway as a Therapeutic Target in Cancer
Oncologist, January 1, 2008; 13(1): 16 - 24.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
S. Sena, I. R. Rasmussen, A. R. Wende, A. P. McQueen, H. A. Theobald, N. Wilde, R. O. Pereira, S. E. Litwin, J. P. Berger, and E. D. Abel
Cardiac Hypertrophy Caused by Peroxisome Proliferator- Activated Receptor-{gamma} Agonist Treatment Occurs Independently of Changes in Myocardial Insulin Signaling
Endocrinology, December 1, 2007; 148(12): 6047 - 6053.
[Abstract] [Full Text] [PDF]

Home page
 Cardiovasc ResHome page
A. Bruel, T. E.H. Christoffersen, and J. R. Nyengaard
Growth hormone increases the proliferation of existing cardiac myocytes and the total number of cardiac myocytes in the rat heart
Cardiovasc Res, December 1, 2007; 76(3): 400 - 408.
[Abstract] [Full Text] [PDF]

Home page
 J. Thorac. Cardiovasc. Surg.Home page
S. Arab, I. E. Konstantinov, C. Boscarino, E. Cukerman, A. Mori, J. Li, P. P. Liu, A. N. Redington, and J. G. Coles
Early gene expression profiles during intraoperative myocardial ischemia-reperfusion in cardiac surgery
J. Thorac. Cardiovasc. Surg., July 1, 2007; 134(1): 74 - 81.
[Abstract] [Full Text] [PDF]

Home page
 Circ. Res.Home page
G. E. Hannigan, J. G. Coles, and S. Dedhar
Integrin-Linked Kinase at the Heart of Cardiac Contractility, Repair, and Disease
Circ. Res., May 25, 2007; 100(10): 1408 - 1414.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
P. G. Laustsen, S. J. Russell, L. Cui, A. Entingh-Pearsall, M. Holzenberger, R. Liao, and C. R. Kahn
Essential Role of Insulin and Insulin-Like Growth Factor 1 Receptor Signaling in Cardiac Development and Function
Mol. Cell. Biol., March 1, 2007; 27(5): 1649 - 1664.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
J. R. McMullen, F. Amirahmadi, E. A. Woodcock, M. Schinke-Braun, R. D. Bouwman, K. A. Hewitt, J. P. Mollica, L. Zhang, Y. Zhang, T. Shioi, et al.
Protective effects of exercise and phosphoinositide 3-kinase(p110{alpha}) signaling in dilated and hypertrophic cardiomyopathy
PNAS, January 9, 2007; 104(2): 612 - 617.
[Abstract] [Full Text] [PDF]

Home page
 Cardiovasc ResHome page
R. M. Bell, J. E. Clark, D. J. Hearse, and M. J. Shattock
Reperfusion kinase phosphorylation is essential but not sufficient in the mediation of pharmacological preconditioning: Characterisation in the bi-phasic profile of early and late protection
Cardiovasc Res, January 1, 2007; 73(1): 153 - 163.
[Abstract] [Full Text] [PDF]

Home page
 Genes Dev.Home page
I. Shiojima and K. Walsh
Regulation of cardiac growth and coronary angiogenesis by the Akt/PKB signaling pathway
Genes & Dev., December 15, 2006; 20(24): 3347 - 3365.
[Abstract] [Full Text] [PDF]

Home page
 J Am Coll CardiolHome page
N. J. Freedman and G. S. Ginsburg
Novel--and "Neu"--Therapeutic Possibilities for Heart Failure
J. Am. Coll. Cardiol., October 3, 2006; 48(7): 1448 - 1450.
[Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
E. Bisping, S. Ikeda, S. W. Kong, O. Tarnavski, N. Bodyak, J. R. McMullen, S. Rajagopal, J. K. Son, Q. Ma, Z. Springer, et al.
Gata4 is required for maintenance of postnatal cardiac function and protection from pressure overload-induced heart failure
PNAS, September 26, 2006; 103(39): 14471 - 14476.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
H. Chen, W. Yong, S. Ren, W. Shen, Y. He, K. A. Cox, W. Zhu, W. Li, M. Soonpaa, R. M. Payne, et al.
Overexpression of Bone Morphogenetic Protein 10 in Myocardium Disrupts Cardiac Postnatal Hypertrophic Growth
J. Biol. Chem., September 15, 2006; 281(37): 27481 - 27491.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
A. Kenessey and K. Ojamaa
Thyroid Hormone Stimulates Protein Synthesis in the Cardiomyocyte by Activating the Akt-mTOR and p70S6K Pathways
J. Biol. Chem., July 28, 2006; 281(30): 20666 - 20672.
[Abstract] [Full Text] [PDF]

Home page
 Circ. Res.Home page
T. J. Kamp and N. Chiamvimonvat
Mission Impossible: IGF-1 and PTEN Specifically "Akt"ing on Cardiac L-Type Ca2+ Channels
Circ. Res., June 9, 2006; 98(11): 1349 - 1351.
[Full Text] [PDF]

Home page
 Circ. Res.Home page
H. Sun, B.-G. Kerfant, D. Zhao, M. G. Trivieri, G. Y. Oudit, J. M. Penninger, and P. H. Backx
Insulin-Like Growth Factor-1 and PTEN Deletion Enhance Cardiac L-Type Ca2+ Currents via Increased PI3K{alpha}/PKB Signaling
Circ. Res., June 9, 2006; 98(11): 1390 - 1397.
[Abstract] [Full Text] [PDF]

Home page
 CirculationHome page
A. M. Katz and M. R. Zile
New Molecular Mechanism in Diastolic Heart Failure
Circulation, April 25, 2006; 113(16): 1922 - 1925.
[Full Text] [PDF]

Home page
 Cancer Res.Home page
B. S. Miller and D. Yee
Type I Insulin-like Growth Factor Receptor as a Therapeutic Target in Cancer
Cancer Res., November 15, 2005; 65(22): 10123 - 10127.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
J. Luo, J. R. McMullen, C. L. Sobkiw, L. Zhang, A. L. Dorfman, M. C. Sherwood, M. N. Logsdon, J. W. Horner, R. A. DePinho, S. Izumo, et al.
Class IA Phosphoinositide 3-Kinase Regulates Heart Size and Physiological Cardiac Hypertrophy
Mol. Cell. Biol., November 1, 2005; 25(21): 9491 - 9502.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
C. Skurk, Y. Izumiya, H. Maatz, P. Razeghi, I. Shiojima, M. Sandri, K. Sato, L. Zeng, S. Schiekofer, D. Pimentel, et al.
The FOXO3a Transcription Factor Regulates Cardiac Myocyte Size Downstream of AKT Signaling
J. Biol. Chem., May 27, 2005; 280(21): 20814 - 20823.
[Abstract] [Full Text] [PDF]

Home page
 Physiol. GenomicsHome page
S. W. Kong, N. Bodyak, P. Yue, Z. Liu, J. Brown, S. Izumo, and P. M. Kang
Genetic expression profiles during physiological and pathological cardiac hypertrophy and heart failure in rats
Physiol Genomics, March 21, 2005; 21(1): 34 - 42.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
B. Chandrasekar, S. Mummidi, W. C. Claycomb, R. Mestril, and M. Nemer
Interleukin-18 Is a Pro-hypertrophic Cytokine That Acts through a Phosphatidylinositol 3-Kinase-Phosphoinositide-dependent Kinase-1-Akt-GATA4 Signaling Pathway in Cardiomyocytes
J. Biol. Chem., February 11, 2005; 280(6): 4553 - 4567.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
B. C. Harrison, C. R. Roberts, D. B. Hood, M. Sweeney, J. M. Gould, E. W. Bush, and T. A. McKinsey
The CRM1 Nuclear Export Receptor Controls Pathological Cardiac Gene Expression
Mol. Cell. Biol., December 15, 2004; 24(24): 10636 - 10649.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
J. R. McMullen, T. Shioi, L. Zhang, O. Tarnavski, M. C. Sherwood, A. L. Dorfman, S. Longnus, M. Pende, K. A. Martin, J. Blenis, et al.
Deletion of Ribosomal S6 Kinases Does Not Attenuate Pathological, Physiological, or Insulin-Like Growth Factor 1 Receptor-Phosphoinositide 3-Kinase-Induced Cardiac Hypertrophy
Mol. Cell. Biol., July 15, 2004; 24(14): 6231 - 6240.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
279/6/4782    most recent
M310405200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by McMullen, J. R.
Right arrow Articles by Izumo, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by McMullen, J. R.
Right arrow Articles by Izumo, S.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2004 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement