Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M311547200 on November 21, 2003

J. Biol. Chem., Vol. 279, Issue 7, 5329-5337, February 13, 2004
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
279/7/5329    most recent
M311547200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jiang, D.
Right arrow Articles by Xiao, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jiang, D.
Right arrow Articles by Xiao, G.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Parathyroid Hormone Induction of the Osteocalcin Gene

REQUIREMENT FOR AN OSTEOBLAST-SPECIFIC ELEMENT 1 SEQUENCE IN THE PROMOTER AND INVOLVEMENT OF MULTIPLE SIGNALING PATHWAYS*

Di Jiang{ddagger}, Renny T. Franceschi{ddagger}§, Heidi Boules{ddagger}, and Guozhi Xiao{ddagger}

From the {ddagger}Department of Periodontics, Prevention, and Geriatrics, School of Dentistry and §Department of Biological Chemistry, School of Medicine, University of Michigan, Ann Arbor, Michigan 48109-1078

Received for publication, October 21, 2003 , and in revised form, November 18, 2003.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Parathyroid hormone (PTH) is an important peptide hormone regulator of bone formation and osteoblast activity. However, its mechanism of action in bone cells is largely unknown. This study examined the effect of PTH on mouse osteocalcin gene expression in MC3T3-E1 preosteoblastic cells and primary cultures of bone marrow stromal cells. PTH increased the levels of osteocalcin mRNA 4–5-fold in both cell types. PTH also stimulated transcriptional activity of a 1.3-kb fragment of the mouse osteocalcin gene 2 (mOG2) promoter. Inhibitor studies revealed a requirement for protein kinase A, protein kinase C, and mitogen-activated protein kinase pathways in the PTH response. Deletion of the mOG2 promoter sequence from –1316 to –116 caused no loss in PTH responsiveness whereas deletion from –116 to –34 completely prevented PTH stimulation. Interestingly, this promoter region does not contain the RUNX2 binding site shown to be necessary for PTH responsiveness in other systems. Nuclear extracts from PTH-treated MC3T3-E1 cells exhibited increased binding to OSE1, a previously described osteoblast-specific enhancer in the mOG2 promoter. Furthermore, mutation of OSE1 in DNA transfection assays established the requirement for this element in the PTH response. Collectively, these studies establish that actions of PTH on the osteocalcin gene are mediated by multiple signaling pathways and require OSE1 and associated nuclear proteins.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Parathyroid hormone (PTH)1 is a major regulator of calcium homeostasis. PTH has catabolic and anabolic effects on osteoblasts and bone in vitro and in vivo, which depend on the temporal pattern of administration; continuous administration decreases bone mass whereas intermittent administration increases bone mass (1–4). PTH functions through the PTH-1 receptor, a G protein-coupled receptor that is expressed in osteoblasts (5–7). Binding of PTH to its receptor activates multiple intracellular signaling pathways that involve cyclic cAMP, inositol phosphates, intracellular Ca2+, protein kinases A and C (2), and the extracellular signal-regulated kinase/mitogen-activated protein kinase (MAPK) pathway (8, 9).

Osteocalcin (OCN), a 5700-dalton {gamma}-carboxyglutamic acid-containing noncollagenous protein, is a major component of the bone extracellular matrix. Although the functions of OCN are poorly understood, gene deletion studies suggest possible functions in bone remodeling (10). The expression of OCN is regulated by a number of calcitropic hormones and growth factors including 1,25-dihydroxy vitamin D3 (11–13), glucocorticoids (14, 15), PTH (16), bone morphogenetic proteins (17), basic fibroblast growth factor 2 (18), tumor necrosis factor-{alpha} (19), and transforming growth factor {beta} (20). A number of transcription factors that bind to specific regions of the osteocalcin gene promoter have also been identified. These factors include AP-1 family members (21, 22), MSX-2/HOX 8.1 (23, 24), DLX-5 (25), CCAAT/enhancer binding proteins (26), and RUNX2 (27), the osteoblast-specific product of the Cbfa1 gene. These factors play important roles in osteoblast and bone development and mediate the response of osteoblasts to the differentiation signals mentioned above. Among these factors, only RUNX2 has unique roles in bone formation, which are essential for the differentiation of hypertrophic chondrocytes and osteoblasts (27–30). RUNX2 expression and functional activity are regulated by a number of factors including bone morphogenetic proteins, fibroblast growth factor 2, PTH, tumor necrosis factor-{alpha}, and extracellular matrix signals (17–19, 31, 32).

Two regions of the mouse osteocalcin gene 2 (mOG2) promoter are required for its bone-specific expression, OSE2 (osteoblast-specific element 2) (33), the binding site for RUNX2, and OSE1, which binds a partially characterized factor designated as Osf1 (34). OSE1 has a core sequence of TTACATCA, located at –55 to –48 relative to the transcription start site. Schinke and Karsenty (34) showed that OSE1 and OSE2 are equally important in terms of their contribution to mOG2 promoter activity in osteoblasts both in vitro and in vivo. Osf1 is present in nuclear extracts of osteoblasts at the early stage of cell differentiation but is absent in differentiated osteoblasts, suggesting that it may play a role in osteoblastic proliferation and early differentiation (33, 34). A preliminary report indicated that Osf1 may play a role in the regulation of bone mass (35); however, the mechanism of action is not well understood.

The ability of PTH to regulate gene expression is dependent on the activation of specific transcription factors such as cAMP-response element-binding protein (CREB) (36, 37), AP-1 family members (38, 39), pituitary-specific transcription factor 1 (40), and RUNX2 (38). Although it is well known that PTH induces OCN gene expression, the mechanism mediating this regulation is not known. In the present study, we show for the first time that PTH induction of the OCN gene requires an intact OSE1 sequence in the mOG2 promoter and increased Osf1 in osteoblast nuclear extracts.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Reagents—Tissue culture medium and fetal bovine serum were obtained from HyClone (Logan, UT). Other reagents including forskolin, GF109203X, H89, and cycloheximide were obtained from Sigma; U0126 was obtained from Promega (Madison, WI), U0124 from Calbiochem (La Jolla, CA), and PTH-(1–34) from Bachem (Torrance, CA). All other chemicals were of analytical grade.

Cell Cultures—Two previously described MC3T3-E1 subclonal cell lines with high osteoblast differentiation potential were used in this study (32). Both subclones (MC-4 and MC-42 cells) express osteoblast phenotypic marker genes and mineralize only after growth in a medium containing ascorbic acid. MC3T3-E1 subclone 42 (MC-42) cells have the same phenotype as MC-4 cells and also contain stably integrated copies of a 1.3-kb mOG2 promoter driving a firefly luciferase reporter gene. Luciferase expression closely follows levels of endogenous OCN mRNA (32). Both cell lines were maintained in ascorbic acid free {alpha}-minimum Eagle's medium (Invitrogen), 10% fetal bovine serum, and 1% penicillin/streptomycin and were not used beyond passage 15.

Mouse Bone Marrow Stromal Cell Cultures (BMSCs)—Isolation of mouse BMSCs was described previously (41). Briefly, 6-week-old male C57BL/6 mice were sacrificed by cervical dislocation. Tibiae and femurs were isolated, and the epiphyses were cut. Marrow was flushed with Dulbecco's modified Eagle's medium containing 20% FBS, 1% penicillin/streptomycin, and 10–8 M dexamethasone into a 60-mm dish, and the cell suspension was aspirated up and down with a 20-gauge needle to break up clumps of marrow. The cell suspension (marrow from two mice/flask) was then cultured in a T75 flask in the same medium. After 10 days, cells reached confluency and were ready for experiments.

DNA Constructs—All luciferase reporter plasmids (except wild-type and mutant 4OSE1mOG-luc, which were constructed in –34mOG2pGL3B-luc vector) were constructed by cloning mOG2 promoter inserts and multimeric oligonucleotides into the p4-luc promoterless luciferase expression vector as previously described (33). p657OSE2mut-luc, which contains a 2-bp substitution mutation in OSE2 at positions –134 and –133 (CCAAGAACA), was described previously (33). p116OSE1mut3-luc and p657OSE1mut3-luc, which both contain a 3-bp substitution mutation in OSE1 at positions –52, –51, and –50 (TTAGTACA), were generated from p116-luc and p657-luc by PCR amplification using the QuickChange XL site-directed mutagenesis kit (Stratagene, La Jolla, CA) according to the manufacturer's instructions. The two primers used for making these mutant constructs were GCATCCCCTGCTCCTCCTGCTTAGTACAGAGAGCACAGAGTAGCCG (forward) and CGGCTACTCTGTGCTCTCTGTACTAAGCAGGAGGAGCAGGGGATGC (reverse). –34mOG2pGL3B-luc was constructed by cloning the –34 to +13 mOG2 minimal promoter region into the BglII/HindIII site in pGL3-basic vector (Promega). Multimers (four copies) of wild-type or mutated (containing OSE1mut3) oligonucleotide 4 were cloned into the Bg1II site of the –34mOG2pGL3B-luc vector. All sequences were verified by automatic DNA sequencing.

Transfections—Cells were plated on 35-mm dishes at a density of 5 x 104 cells/cm2. After 24 h, cells were transfected with LipofectAMINE (Invitrogen) according to the manufacturer's instructions. Each transfection contained 0.5 µg of the indicated plasmid plus 0.05 µg of pRL-SV40 containing a cDNA for Renilla reniformis luciferase to control for transfection efficiency. Cells were harvested and assayed using the dual luciferase assay kit (Promega) on a Monolight 2010 luminometer (BD Biosciences, San Diego, CA).

Preparation of Nuclear Extracts and Gel Mobility Shift Assays— Nuclear extracts were prepared, and gel mobility shift assays were conducted as described previously (32). Each reaction contained 1 µg of nuclear extracts. The OSE2 wild-type and mutant oligonucleotides used in gel mobility shift assays in this study were described previously (32). Additional oligonucleotides used in this study are described under "Results."

RNA Analysis—RNA was isolated using TRIzol (Invitrogen) reagent according to the manufacturer's protocol. Aliquots were fractionated on 1.0% agarose-formaldehyde gels and blotted onto nitrocellulose paper as described by Thomas (42). Mouse OCN cDNA probe used for hybridization was obtained from Dr. John Wozney (Genetics Institute, Boston, MA) (43). The cDNA inserts were excised from plasmid DNA with the appropriate restriction enzymes and purified by agarose gel electrophoresis before labeling with {alpha}-[32P]dCTP using a random primer kit (Roche Applied Science). Hybridizations were performed as previously described using a Bellco Autoblot hybridization oven (44) and quantitatively scanned using a Packard A2024 InstantImager. All values were normalized for RNA loading by probing blots with cDNA to 18 S rRNA (45).

Statistical Analysis—All experiments were repeated two to five times, and qualitatively identical results were obtained. Statistical analyses were performed using Instat 3.0 software (GraphPad, Inc., San Diego, CA). Unless indicated otherwise, each value reported is the mean and standard deviation of triplicate independent samples.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
PTH Stimulates Osteocalcin Gene Expression and Promoter Activity—The effect of PTH on mouse OCN gene expression was evaluated in MC-4 cells and primary mouse bone marrow stromal cells. Confluent cells were treated with increasing concentrations of PTH for 6 h. As illustrated in Fig. 1A, PTH stimulated OCN mRNA expression in a dose-dependent manner with a significant stimulatory effect first detected at 10–10 M. PTH also stimulated OCN message levels in primary mouse bone marrow stromal cells (Fig. 1B). Time course experiments showed that the levels of OCN mRNA began to rise within 1 h of PTH administration and remained elevated for at least 6 h (Fig. 1C). PTH stimulation was not blocked by the protein synthesis inhibitor, cycloheximide, suggesting that de novo protein synthesis is not required for the PTH response (Fig. 1D). To establish whether the mOG2 promoter can be activated by PTH, MC-42 cells, which contain stably integrated copies of a 1.3-kb mOG2 promoter driving a firefly luciferase reporter gene, were treated with various concentrations of PTH (from 10–13 to 10–7 M) for 6 h. Cells were then harvested and assayed for luciferase activity. As shown in Fig. 2A, PTH stimulated promoter activity in a dose-dependent manner with a detectable response seen at a PTH concentration of 10–9 M (significance at p < 0.001). Measurable activation of the mOG2 promoter was observed 1 h after PTH addition with maximal induction occurring between 3 and 6 h and lasting for more than 6 h (Fig. 2B).



View larger version (38K):
[in this window]
[in a new window]
  		FIG. 1.
PTH increases OCN mRNA levels in MC3T3-E1 preosteoblastic cells and in BMSCs. A and B, effect of various concentrations of PTH on OCN mRNA expression. MC-4 cells or BMSCs were seeded at a density of 50,000 cells/cm2 in 35-mm dishes and cultured in 10% FBS medium overnight. Cells were then switched to 0.1% FBS in the absence or presence of various concentrations of PTH for 6 h. For each group, total RNA (20 µg/lane) was loaded for Northern hybridization using cDNA probes for mouse OCN mRNA and 18 S rRNA (for normalization). Northern blots were scanned, and OCN mRNA signals (top) were normalized to 18 S rRNA (bottom) (A, MC-4 cells; B, BMSCs). C, time course of PTH-induced OCN mRNA expression. MC-4 cells were treated as in A for indicated times in the absence ({circ}) or presence (•) of 10–7 M PTH. D, effect of cycloheximide (CHX) treatment on PTH induction of OCN mRNA. MC-4 cells were treated with vehicle or 10 µg/ml cycloheximide in the absence or presence of PTH for 6 h. OCN mRNA and 18 S rRNA were determined by Northern blot analysis. Experiments were repeated a minimum of two times, and qualitatively identical results were obtained.

 



View larger version (13K):
[in this window]
[in a new window]
  		FIG. 2.
PTH activates OCN promoter activity in stably transfected MC3T3-E1 preosteoblastic cells. A, dose dependence. MC-42 cells containing stably integrated copies of a 1.3-kb mOG2-luc construct were seeded at a density of 50,000 cells/cm2 in 35-mm dishes and cultured overnight in 10% FBS medium. Cells were then switched to 0.1% FBS medium in the absence or presence of the indicated concentration of PTH (from 10–12 to 10–7 M) for 6 h. Cells were then harvested for luciferase assay. Luciferase activity was normalized to total protein. B, time course. MC-42 cells were treated as in A for the indicated times in the absence ({circ}) or presence (•) of 10–7 M PTH. Data represent mean ± S.D. Experiments were repeated three times, and qualitatively identical results were obtained.

 
Multiple Signaling Pathways Mediate PTH Stimulation— PTH signals mainly through the PKA pathway, although involvement of PKC and MAPK pathways has also been described. To identify signaling pathways mediating PTH induction of the mOG2 gene, we examined the effects of various inhibitors or activators. As shown in Fig. 3A, H89, a selective inhibitor of the PKA pathway, completely abolished the PTH-stimulated OCN gene expression. Forskolin, a well known activator of PKA, increased OCN expression. In combination with PTH, the effect of forskolin was not additive, indicating that the PKA pathway is maximally stimulated. GF109203X, a specific inhibitor of the PKC pathway, also dramatically decreased PTH stimulation. Interestingly, U0126 (a specific inhibitor of MAPK) but not its inactive analog, U0124, also partially suppressed PTH stimulation. Similar results were obtained when PTH-induced mOG2 promoter activity was examined in MC-42 cells (all three inhibitors significantly blocked PTH induction, p < 0.001; Fig. 3B). The concentrations of the inhibitors or activators used in this study are in the ranges reported by us and others to selectively affect the relevant pathways (18, 47–49. We found no evidence of toxicity. Compounds did not reduce cell DNA or protein under the current conditions (data not shown). Collectively, these results indicate that PTH stimulation of OCN gene expression requires PKA and PKC as well as MAPK signaling pathways.



View larger version (18K):
[in this window]
[in a new window]
  		FIG. 3.
Multiple signaling pathways mediate the PTH response. A, effects of inhibitors/activators on OCN mRNA expression. MC-4 cells were treated with 10 µM inhibitors/activators in the absence or presence of 10–7 M PTH for 6 h and then assayed for OCN gene expression by Northern blot analysis. OCN mRNA level was normalized to 18 S rRNA. H89, a PKA inhibitor; FSK, forskolin, a PKA activator; U0126, a MAPK inhibitor; U0124, an inactive analog of U0126; and GF109203X, a PKC inhibitor. B, effects of inhibitors/activators on OCN mOG2 promoter activity in stable cells. MC-42 cells were treated with 10 µM inhibitors/activators in the absence or presence of 10–7 M PTH for 6 h and then assayed for luciferase activity. Luciferase activity was normalized to protein concentration. Data represent mean ± S.D. Experiments were repeated three times, and qualitatively identical results were obtained.

 
Minimal PTH-response Region Is within 116 bp of the Transcriptional Start Site—Several deletion mutants of the mOG2 promoter driving firefly luciferase gene expression have been described and shown to be active in osteoblast cell lines (32, 33). To determine in which region PTH is necessary to activate transcription, these constructs were transiently transfected into MC-4 cells in the presence or absence of PTH. Results showed that luciferase activity of both control and PTH-treated groups decreased with progressively larger 5' deletions. However, a major drop in PTH stimulation was observed when the promoter was deleted from the –116 to –34-bp region (Fig. 4, inset). Thus, it is clear from these results that a major PTH-responsive element is located in the –116 to –34 mOG2 promoter region.



View larger version (18K):
[in this window]
[in a new window]
  		FIG. 4.
PTH activates the mouse OCN promoter via a proximal element present from –116 to –34. Various mouse OCN promoter constructs directing expression of a luciferase reporter gene were transiently transfected into MC-4 cells, treated with vehicle (open bars) or 10–7 M PTH-containing medium (closed bars) for 6 h, and then harvested and assayed for luciferase activity. Firefly luciferase activity was normalized to Renilla luciferase activity (for transfection efficiency). Data represent mean ± S.D. Experiments were repeated five times, and qualitatively identical results were obtained.

 
PTH Treatment Increases Binding of Nuclear Proteins to OSE1—As an initial step to identify the DNA sequence responsible for the PTH response, an 82-bp DNA oligonucleotide from –116 to –34 of the mOG2 promoter was synthesized and used as a probe for gel mobility shift assays using nuclear extracts from MC-4 cells with or without PTH treatment. Results revealed that PTH treatment increased nuclear protein binding to this region (data not shown). To further identify the DNA sequence responsible for PTH responsiveness, four smaller overlapping DNA oligonucleotides (designated oligonucleotide 1, 2, 3, and 4, located at –116 to –89, –98 to –69, –80 to –50, and –61 to –34, respectively) covering the entire 82-bp region from –116 to –34 of the mOG2 promoter were synthesized (Fig. 5A). These oligonucleotides were then used as probes for gel mobility shift assays using nuclear extracts from MC-4 cells with or without PTH treatment. As shown in Fig. 5B, PTH had virtually no effect on the binding of nuclear proteins to oligonucleotides 1 and 2 (containing an E-box motif, CACATG, and a CCAAT/enhancer binding protein motif, CCAATT, respectively). In contrast, PTH treatment dramatically increased binding to oligonucleotides 3 and 4 (Fig. 5B, bands 1 and 2). The lower shifted band (band 3) bound to and was not competed by the four oligonucleotides and thus was clearly nonspecific. Because the region shared by oligonucleotides 3 and 4 contains the OSE1 core sequence, TTACATCA, we predicted that a PTH-induced nuclear factor binds to this region. To confirm this, a set of double-stranded DNA oligonucleotides containing 3-bp mutations that span the entire OSE1 region was synthesized and evaluated in competitive gel mobility shift assays using wild-type oligonucleotide 4 as the probe and nuclear extracts from PTH-treated MC-4 cells (Fig. 6A). As shown in Fig. 6B, PTH-stimulated band 2 was completely abolished by the addition of 100-fold molar excess of unlabeled wild-type or mutant oligonucleotides 1, 5, and 6 but not by unlabeled mutant oligonucleotides 2, 3, and 4. These latter three oligonucleotides have 3-bp substitution mutations that exactly cover the OSE1 core sequence (TTACATCA). The band 2 increased by PTH treatment was further demonstrated to be the result of sequence-specific interactions in that it was disrupted by a 25–100-fold molar excess of OSE1 oligonucleotide but was not affected by the mutant oligonucleotide 3 (from CAT to GTA, mutant 3) (Fig. 6C). Band 1 was also competed by both unlabeled wild-type and mutant oligonucleotides 1, 5, and 6. However, mutant oligonucleotides 2, 3, and 4 could still partially compete its binding to the DNA oligo. It remains to be determined whether the band 1 and 2 protein-DNA complexes share common nuclear factors. These results clearly show that PTH treatment of cells increases the binding of a nuclear factor to OSE1. Because PTH regulates a number of transcription factors such as CREB, AP-1 family members, and RUNX2, we used supershift analysis to determine whether any of those factors might be present in the complex binding to OSE1. Antibodies recognizing conserved domains of CREB, c-Fos, c-Jun, Fra-1, Fra-2, ATF-1, and RUNX2 did not supershift or disrupt the complex binding to OSE1 (data not shown).



View larger version (56K):
[in this window]
[in a new window]
  		FIG. 5.
Effect of PTH treatment on the binding of nuclear extracts to mOG2 promoter elements. A, regulatory elements in the proximal mOG2 promoter. The region of the mOG2 promoter from –116 to –34 and the sequences of four oligonucleotides used for gel mobility shift assay are shown. E-box, CCAAT/enhancer binding proteins, Sp1, and OSE1 motifs are boxed. B, gel mobility shift assays using oligonucleotides 1, 2, 3, and 4 as probes. Nuclear extracts were prepared from MC-4 cells with (P) or without (C) PTH treatment for 6 h. One microgram of extract was incubated with the indicated end-labeled double-stranded oligonucleotides and analyzed by electrophoresis on 4% polyacrylamide gels as described under "Experimental Procedures."

 



View larger version (44K):
[in this window]
[in a new window]
  		FIG. 6.
Identification of the binding site for the PTH-induced nuclear factor. A, summary of the wild-type and mutant competitor DNA oligonucleotides. A series of double-stranded mutant oligonucleotides were synthesized to span the entire region of oligonucleotide 4 containing the OSE1 core sequence (TTACATCA). Each oligonucleotide contains a 3-bp mutation as indicated. The presence (+) or absence (–) of competition is indicated. The ability of each oligonucleotide to compete binding to the labeled wild-type sequence (see oligo 4 in Fig. 5) was measured using gel shift assays (B). Dose dependence for competition by wild-type oligo (wt) or mutant oligo (mt3) is shown in panel C. The table in A summarizes the result of competition studies.

 
Mutation of the OSE1 Site Dramatically Reduces PTH Stim-ulation—If OSE1 is indeed required for the activation of mOG2 by PTH, mutation of this element should abolish the PTH response. Furthermore, OSE1 fused to a minimal promoter should also respond to PTH. The results shown in Fig. 7 confirm these predictions. The introduction of a mutation of the core OSE1 sequence TTACATCA to TTAGTACA (mutant 3 in Fig. 6A) in the context of either 116mOG2-luc (Fig. 7A) or 657mOG2-luc (Fig. 7B) essentially abolished PTH responsiveness. The result with 657mOG2-luc is of particular significance in that this promoter fragment contains sufficient information to direct osteoblast-specific expression in vivo (46). Finally, an artificial promoter containing four copies of OSE1 fused to a –34 to +13 minimal mOG2 promoter was induced by PTH treatment whereas the same construct containing mutated OSE1 was not (Fig. 7C).



View larger version (11K):
[in this window]
[in a new window]
  		FIG. 7.
The OSE1 site mediates the PTH response. MC-4 cells were transfected with p116-luc (A), p657-luc (B), and p4OSE1-luc (C) reporter plasmids or the same plasmids containing mutated OSE1 (OSE1mut3) and Renilla luciferase normalization plasmid and were cultured in 10% FBS medium for 42 h. Cells were then switched to 0.1% FBS in the absence (open bars) or presence (closed bars) of 10–7 M PTH for 6 h. Firefly luciferase activity was normalized to Renilla luciferase activity. Data represent mean ± S.D. Experiments were repeated five times, and qualitatively identical results were obtained.

 
RUNX2 has been reported to mediate PTH responses in other systems (38). To address the possible involvement of this factor in the PTH response, we used two different approaches. In the first, we focused on the OSE2 located at –139 to –131 in the mOG2 promoter using a 147-bp mOG2-luc reporter gene. Although the introduction of a 2-bp mutation that renders this sequence nonfunctional as a RUNX2 binding site decreased basal promoter activity, it did not affect PTH induction (10.7-fold for the wild-type versus 10.3-fold for the OSE2 mutant) (Fig. 8A). Similar results were obtained when this site was mutated either alone or together with a second OSE2 at –608 to –602 in the context of a 647-bp mOG2 promoter (result not shown). Consistent with these results, PTH treatment did not alter binding of RUNX2 to OSE2 DNA in gel mobility shift assays (Fig. 8B). Because RUNX2 may also be able to form complexes with other tissue-specific nuclear factors bound to non-OSE2 sites, we examined whether anti-RUNX2 antibodies could alter the mobility of the complex binding to OSE1 oligonucleotide, but no changes in mobility were observed (data not shown). In summary, we were unable to obtain any evidence for the involvement of RUNX2 or its DNA binding site in the PTH response.



View larger version (19K):
[in this window]
[in a new window]
  		FIG. 8.
PTH responsiveness is independent of the presence of RUNX2 binding site in the promoter. A, MC-4 cells were transfected with p147-luc reporter plasmids or the same plasmids containing mutated OSE2 and Renilla luciferase normalization plasmids and cultured in 10% FBS medium for 42 h. Cells were then switched to 0.1% FBS in the absence (open bars) or presence (closed bars) of 10–7 M PTH for 6 h. Firefly luciferase activity was normalized to Renilla luciferase activity. Data represent mean ± S.D. Experiments were repeated five times, and qualitatively identical results were obtained. B, gel mobility shift assays using wild-type or mutant OSE2 (OSE2mt) oligonucleotides as probes. Nuclear extracts were prepared from MC-4 cells with (P) or without (C) PTH treatment for 6 h. One microgram of extract was incubated with end-labeled double-stranded oligonucleotides and analyzed by electrophoresis on 4% polyacrylamide gels as described under "Experimental Procedures."

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
This study examined the molecular mechanism and signaling pathways mediating PTH induction of the mouse OCN gene. Our studies show that: 1) PTH rapidly stimulates OCN gene expression and mOG2 promoter activity in mouse MC3T3-E1 preosteoblastic cells and primary bone marrow stromal cells; 2) the PTH response does not require induction of a protein intermediate and involves PKA, PKC, and MAPK pathways; 3) the actions of PTH on the endogenous OCN gene can be reproduced with a short 116-bp mOG2 promoter and that this promoter lacks the RUNX2 transcription factor binding site that has been implicated in PTH action in other systems; and 4) PTH treatment increases binding of nuclear proteins to an OSE1 sequence in the proximal mOG2 promoter, and this sequence is essential for PTH responsiveness.

A number of signaling transduction pathways have been associated with PTH (8, 9, 47–50). For example, Boguslawski et al. (16) showed that PKA and PKC pathways cooperatively interact in PTH-mediated OCN gene expression in rat and human osteoblast cell lines. Consistent with these reports, the present study shows that these two pathways are also required for PTH-induced mouse OCN gene expression in MC3T3-E1 preosteoblast cells. Furthermore, our results show that the mitogen-activated protein kinase/extracellular signal-regulated kinase (MEK)/MAPK pathway is also required for PTH responsiveness. Fujita et al. (51) recently described a PKA-independent Epac/Rap1/B-Raf pathway involved in PTH/cAMP signaling. Specifically, PTH treatment of MC-4 cells increased phosphorylation of extracellular signal-regulated kinases 1 and 2, and this stimulation was blocked by the specific MAPK inhibitor, PD98059, but not by the PKA inhibitor, H89. Furthermore, cAMP-stimulated extracellular signal-regulated kinase phosphorylation occurred only in B-Raf-expressing cells such as MC-4 cells. Whether the novel Epac/Rap1/B-Raf pathway is involved in PTH-induced OCN gene expression needs to be determined. Consistent with our results, the MAPK pathway was reported to mediate parathyroid hormone-related peptide stimulation of type I collagen gene expression and alkaline phosphatase activity in MG-63 cells (8). Swarthout et al. (9) also recently showed that low concentrations of PTH (10–12 to 10–11 M) can substantially increase MAPK activity in UMR-106-01 and primary rat osteoblasts (52).

Studies on the collagenase-3 gene promoter showed that both a RUNX2 binding site and a conserved AP-1 binding site are necessary for PTH stimulation (38, 39, 53, 54). Mutations in either site that abrogated the binding of RUNX2 or c-Fos/c-Jun, respectively, abolished PTH stimulation of promoter activity. Furthermore, overexpression of both RUNX2 and AP-1 (c-Fos and c-Jun) protein increased PTH responsiveness suggesting that these factors cooperatively interact. Indeed, immunoprecipitation experiments provided direct evidence that RUNX2 and c-Fos/c-Jun can form a complex in intact cells. Krishnan et al. (55) recently showed that sustained treatment (24 h) with low concentrations of PTH (from 0.05 to 5.0 nM) increased Runx2 gene expression and RUNX2-dependent transactivation using an artificial expression system containing six copies of OSE2 driving firefly luciferase expression in rat UMR-106 cells. However, under the conditions used in our study, PTH did not alter RUNX2 activity (i.e. OSE2 binding activity) in nuclear extracts. Furthermore, deletion or mutation of OSE2 sites in the context of either a 147- or 657-bp mOG2 promoter did not affect PTH responsiveness. Based on these findings, we conclude that RUNX2 plays a minor role, if any, in PTH-mediated mOG2 gene expression.

Experiments described in this study show that an OSE1 sequence contained in the proximal 116 bp of mOG2 promoter is necessary and sufficient to mediate the PTH response. Mutation or deletion of this element abolished PTH regulation. OSE1 oligomers in the absence of other mOG2 promoter elements were able to confer PTH responsiveness to a –34 to +13 minimal mOG2 promoter construct. Furthermore, PTH up-regulated Osf1, the nuclear factor that binds OSE1. Although our results do not exclude the possibility that other elements elsewhere in the mOG2 promoter may be responsive to PTH, it is clear that such sequences require the presence of OSE1 for activity.

PTH regulation of osteoblast and bone metabolism is dependent on the dose and the time of treatment as well as cell differentiation status. In vivo studies show that continuous administration at high PTH doses results in sustained elevated levels of circulating PTH and a net catabolic response in bone, whereas intermittent or low PTH dosing results in an anabolic response. In vitro, PTH inhibits bone marker gene expression and mineralization in differentiated osteoblasts and cementoblasts (49, 56). In contrast, PTH rapidly induces osteoblast-specific gene expression in undifferentiated, proliferating osteoblasts (8, 16, 57, 58). Thus, PTH may preferentially stimulate osteoblast differentiation in immature cells while inhibiting it in more mature cells. The basis for this difference remains to be elucidated. Osf1 was reported to be present only in proliferating osteoblasts (33), which may play a role in this regard. In the future, it will be important to address whether Osf1 contributes to the anabolic effect of PTH on osteoblasts and bone under physiological and pathological conditions.

A preliminary report describes Osf1 as a leucine zipper-containing transcription factor having a role in the regulation of osteoblastic proliferation (35). The precise mechanism through which PTH regulates Osf1 is not known. Because PTH stimulation of OCN gene expression occurs rapidly (within 1 h) and does not require protein synthesis, it is highly possible that PTH can activate pre-existing Osf1 through post-translational modifications such as phosphorylation. PTH is known to phosphorylate and activate CREB (36, 37) and may also phosphorylate RUNX2 (47). Alternatively, PTH could increase the stability of Osf1 protein. Regulation of ubiquitin/proteasome activity has been linked to osteoblast activity and bone formation (59). Accumulating evidence has shown that PTH can regulate osteoblast and bone metabolism through the ubiquitin/proteasome pathway (60, 61). Many targets of PTH such as p27 Kip, c-Fos, c-Jun, UBP41, and RUNX2 are regulated in this way (2, 62–65). Whether Osf1 is regulated by this mechanism needs to be determined. Finally, PTH may alter interactions between Osf1 and other proteins much as it modifies interactions between RUNX2 and AP-1 factors on the collagenase gene (39, 53). Determining the precise mechanisms through which PTH regulates Osf1 transcriptional activity must await the availability of molecular reagents for Osf1.


   FOOTNOTES
 
* This work was supported by National Institutes of Health Grants DE14454 (to G. X.) and DE13386, DE 11723, and DE12211 (to R. T. F.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

To whom correspondence should be addressed: Dept. of Periodontics, Prevention, and Geriatrics, School of Dentistry, University of Michigan, 1011 N. University Ave., Ann Arbor, MI 48109-078. Tel.: 734-763-5487; Fax: 734-763-5503; E-mail: xiaogz{at}umich.edu.

1 The abbreviations used are: PTH, parathyroid hormone; MAPK, mitogen-activated protein kinase; OCN, osteocalcin; mOG2, mouse osteocalcin gene 2; OSE1, osteoblast-specific element 1; Osf1, osteoblast-specific factor 1; FBS, fetal bovine serum; CREB, cAMP-response element-binding protein; MC, MC3T3-E1 subclone; BMSC, bone marrow stromal cell culture; PKA, protein kinase A; PKC, protein kinase C. Back


   ACKNOWLEDGMENTS
 
We thank Dr. Laurie K. McCauley for critical reading of this manuscript, Dr. Abraham Schneider for assistance with preparation of mouse bone marrow stromal cells, and Drs. Chunxi Ge and Zhuoran Zhao for technical support.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Neer, R. M., Arnaud, C. D., Zanchetta, J. R., Prince, R., Gaich, G. A., Reginster, J. Y., Hodsman, A. B., Eriksen, E. F., Ish-Shalom, S., Genant, H. K., Wang, O., and Mitlak, B. H. (2001) N. Engl. J. Med. 344, 1434–1441[Abstract/Free Full Text]
  2. Swarthout, J. T., D'Alonzo, R. C., Selvamurugan, N., and Partridge, N. C. (2002) Gene (Amst.) 282, 1–17[Medline] [Order article via Infotrieve]
  3. Miao, D., He, B., Karaplis, A. C., and Goltzman, D. (2002) J. Clin. Invest. 109, 1173–1182[CrossRef][Medline] [Order article via Infotrieve]
  4. Demiralp, B., Chen, H. L., Koh, A. J., Keller, E. T., and McCauley, L. K. (2002) Endocrinology 143, 4038–4047[Abstract/Free Full Text]
  5. Partridge, N. C., Alcorn, D., Michelangeli, V. P., Kemp, B. E., Ryan, G. B., and Martin, T. J. (1981) Endocrinology 108, 213–219[Abstract/Free Full Text]
  6. McCauley, L. K., Koh, A. J., Beecher, C. A., Cui, Y., Decker, J. D., and Franceschi, R. T. (1995) J. Bone Miner. Res. 10, 1243–1255[Medline] [Order article via Infotrieve]
  7. McCauley, L. K., Koh, A. J., Beecher, C. A., Cui, Y., Rosol, T. J., and Franceschi, R. T. (1996) J. Cell. Biochem. 61, 638–647[CrossRef][Medline] [Order article via Infotrieve]
  8. Carpio, L., Gladu, J., Goltzman, D., and Rabbani, S. A. (2001) Am. J. Physiol. 281, E489–E499
  9. Swarthout, J. T., Doggett, T. A., Lemker, J. L., and Partridge, N. C. (2001) J. Biol. Chem. 276, 7586–7592[Abstract/Free Full Text]
  10. Ducy, P., Desbois, C., Boyce, B., Pinero, G., Story, B., Dunstan, C., Smith, E., Bonadio, J., Goldstein, S., Gundberg, C., Bradley, A., and Karsenty, G. (1996) Nature 382, 448–452[CrossRef][Medline] [Order article via Infotrieve]
  11. Morrison, N. A., Shine, J., Fragonas, J. C., Verkest, V., McMenemy, M. L., and Eisman, J. A. (1989) Science 246, 1158–1161[Abstract/Free Full Text]
  12. Staal, A., Geertsma-Kleinekoort, W. M., Van Den Bemd, G. J., Buurman, C. J., Birkenhager, J. C., Pols, H. A., and Van Leeuwen, J. P. (1998) J. Bone Miner. Res. 13, 36–43[CrossRef][Medline] [Order article via Infotrieve]
  13. Kesterson, R. A., Stanley, L., DeMayo, F., Finegold, M., and Pike, J. W. (1993) Mol. Endocrinol. 7, 462–467[Abstract/Free Full Text]
  14. Morrison, N., and Eisman, J. (1993) J. Bone Miner. Res. 8, 969–975[Medline] [Order article via Infotrieve]
  15. Lian, J. B., Shalhoub, V., Aslam, F., Frenkel, B., Green, J., Hamrah, M., Stein, G. S., and Stein, J. L. (1997) Endocrinology 138, 2117–2127[Abstract/Free Full Text]
  16. Boguslawski, G., Hale, L. V., Yu, X. P., Miles, R. R., Onyia, J. E., Santerre, R. F., and Chandrasekhar, S. (2000) J. Biol. Chem. 275, 999–1006[Abstract/Free Full Text]
  17. Yang, S., Wei, D., Wang, D., Phimphilai, M., Krebsbach, P. H., and Franceschi, R. T. (2003) J. Bone Miner. Res. 18, 705–715[CrossRef][Medline] [Order article via Infotrieve]
  18. Xiao, G., Jiang, D., Gopalakrishnan, R., and Franceschi, R. T. (2002) J. Biol. Chem. 277, 36181–36187[Abstract/Free Full Text]
  19. Gilbert, L., He, X., Farmer, P., Rubin, J., Drissi, H., van Wijnen, A. J., Lian, J. B., Stein, G. S., and Nanes, M. S. (2002) J. Biol. Chem. 277, 2695–2701[Abstract/Free Full Text]
  20. Banerjee, C., Stein, J. L., Van Wijnen, A. J., Frenkel, B., Lian, J. B., and Stein, G. S. (1996) Endocrinology 137, 1991–2000[Abstract]
  21. Aslam, F., McCabe, L., Frenkel, B., van Wijnen, A. J., Stein, G. S., Lian, J. B., and Stein, J. L. (1999) Endocrinology 140, 63–70[Abstract/Free Full Text]
  22. Owen, T. A., Bortell, R., Yocum, S. A., Smock, S. L., Zhang, M., Abate, C., Shalhoub, V., Aronin, N., Wright, K. L., van Wijnen, A. J., Stein, J. L., Curran, T., Lian, J. B., and Stein, G. S. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 9990–9994[Abstract/Free Full Text]
  23. Newberry, E. P., Boudreaux, J. M., and Towler, D. A. (1997) J. Biol. Chem. 272, 29607–29613[Abstract/Free Full Text]
  24. Towler, D. A., Rutledge, S. J., and Rodan, G. A. (1994) Mol. Endocrinol. 8, 1484–1493[Abstract/Free Full Text]
  25. Ryoo, H. M., Hoffmann, H. M., Beumer, T., Frenkel, B., Towler, D. A., Stein, G. S., Stein, J. L., van Wijnen, A. J., and Lian, J. B. (1997) Mol. Endocrinol. 11, 1681–1694[Abstract/Free Full Text]
  26. Gutierrez, S., Javed, A., Tennant, D. K., van Rees, M., Montecino, M., Stein, G. S., Stein, J. L., and Lian, J. B. (2002) J. Biol. Chem. 277, 1316–1323[Abstract/Free Full Text]
  27. Ducy, P., Zhang, R., Geoffroy, V., Ridall, A. L., and Karsenty, G. (1997) Cell 89, 747–754[CrossRef][Medline] [Order article via Infotrieve]
  28. Komori, T., Yagi, H., Nomura, S., Yamaguchi, A., Sasaki, K., Deguchi, K., Shimizu, Y., Bronson, R. T., Gao, Y. H., Inada, M., Sato, M., Okamoto, R., Kitamura, Y., Yoshiki, S., and Kishimoto, T. (1997) Cell 89, 755–764[CrossRef][Medline] [Order article via Infotrieve]
  29. Mundlos, S., Otto, F., Mundlos, C., Mulliken, J. B., Aylsworth, A. S., Albright, S., Lindhout, D., Cole, W. G., Henn, W., Knoll, J. H., Owen, M. J., Mertelsmann, R., Zabel, B. U., and Olsen, B. R. (1997) Cell 89, 773–779[CrossRef][Medline] [Order article via Infotrieve]
  30. Otto, F., Thornell, A. P., Crompton, T., Denzel, A., Gilmour, K. C., Rosewell, I. R., Stamp, G. W., Beddington, R. S., Mundlos, S., Olsen, B. R., Selby, P. B., and Owen, M. J. (1997) Cell 89, 765–771[CrossRef][Medline] [Order article via Infotrieve]
  31. Xiao, G., Gopalakrishnan, R., Jiang, D., Reith, E., Benson, M. D., and Franceschi, R. T. (2002) J. Bone Miner. Res. 17, 101–110[CrossRef][Medline] [Order article via Infotrieve]
  32. Xiao, G., Cui, Y., Ducy, P., Karsenty, G., and Franceschi, R. T. (1997) Mol. Endocrinol. 11, 1103–1113[Abstract/Free Full Text]
  33. Ducy, P., and Karsenty, G. (1995) Mol. Cell. Biol. 15, 1858–1869[Abstract]
  34. Schinke, T., and Karsenty, G. (1999) J. Biol. Chem. 274, 30182–30189[Abstract/Free Full Text]
  35. Yang, X., and Karsenty, G. (2002) J. Bone Miner. Res. 17, S126
  36. Pearman, A. T., Chou, W. Y., Bergman, K. D., Pulumati, M. R., and Partridge, N. C. (1996) J. Biol. Chem. 271, 25715–25721[Abstract/Free Full Text]
  37. Gonzalez, G. A., and Montminy, M. R. (1989) Cell 59, 675–680[CrossRef][Medline] [Order article via Infotrieve]
  38. Selvamurugan, N., Chou, W. Y., Pearman, A. T., Pulumati, M. R., and Partridge, N. C. (1998) J. Biol. Chem. 273, 10647–10657[Abstract/Free Full Text]
  39. D'Alonzo, R. C., Kowalski, A. J., Denhardt, D. T., Nickols, G. A., and Partridge, N. C. (2002) J. Biol. Chem. 277, 24788–24798[Abstract/Free Full Text]
  40. Ogata, Y., Nakao, S., Kim, R. H., Li, J. J., Furuyama, S., Sugiya, H., and Sodek, J. (2000) Matrix Biol. 19, 395–407[CrossRef][Medline] [Order article via Infotrieve]
  41. Krebsbach, P. H., Kuznetsov, S. A., Satomura, K., Emmons, R. V., Rowe, D. W., and Robey, P. G. (1997) Transplantation 63, 1059–1069[CrossRef][Medline] [Order article via Infotrieve]
  42. Thomas, P. S. (1980) Proc. Natl. Acad. Sci. U. S. A. 77, 5201–5205[Abstract/Free Full Text]
  43. Celeste, A. J., Rosen, V., Bueker, J. L., Kriz, R., Wang, E. A., and Wozney, J. M. (1986) EMBO J. 5, 1885–1890[Medline] [Order article via Infotrieve]
  44. Franceschi, R. T., Iyer, B. S., and Cui, Y. (1994) J. Bone Miner. Res. 9, 843–854[Medline] [Order article via Infotrieve]
  45. Renkawitz, R., Gerbi, S. A., and Glatzer, K. H. (1979) Mol. Gen. Genet. 173, 1–13[CrossRef][Medline] [Order article via Infotrieve]
  46. Frendo, J. L., Xiao, G., Fuchs, S., Franceschi, R. T., Karsenty, G., and Ducy, P. (1998) J. Biol. Chem. 273, 30509–30516[Abstract/Free Full Text]
  47. Selvamurugan, N., Pulumati, M. R., Tyson, D. R., and Partridge, N. C. (2000) J. Biol. Chem. 275, 5037–5042[Abstract/Free Full Text]
  48. Yu, X. P., and Chandrasekhar, S. (1997) Endocrinology 138, 3085–3092[Abstract/Free Full Text]
  49. Ouyang, H., Franceschi, R., McCauley, L., Wang, D., and Somerman, M. (2000) Endocrinology 141, 4671–4680[Abstract/Free Full Text]
  50. Doggett, T. A., Swarthout, J. T., Jefcoat, S. C., Jr., Wilhelm, D., Dieckmann, A., Angel, P., and Partridge, N. C. (2002) Endocrinology 143, 1880–1888[Abstract/Free Full Text]
  51. Fujita, T., Meguro, T., Fukuyama, R., Nakamuta, H., and Koida, M. (2002) J. Biol. Chem. 277, 22191–22200[Abstract/Free Full Text]
  52. Miao, D., Tong, X. K., Chan, G. K., Panda, D., McPherson, P. S., and Goltzman, D. (2001) J. Biol. Chem. 276, 32204–32213[Abstract/Free Full Text]
  53. Hess, J., Porte, D., Munz, C., and Angel, P. (2001) J. Biol. Chem. 276, 20029–20038[Abstract/Free Full Text]
  54. Winchester, S. K., Selvamurugan, N., D'Alonzo, R. C., and Partridge, N. C. (2000) J. Biol. Chem. 275, 23310–23318[Abstract/Free Full Text]
  55. Krishnan, V., Moore, T. L., Ma, Y. L., Helvering, L. M., Frolik, C. A., Valasek, K. M., Ducy, P., and Geiser, A. G. (2003) Mol. Endocrinol. 17, 423–435[Abstract/Free Full Text]
  56. Gopalakrishnan, R., Ouyang, H., Somerman, M. J., McCauley, L. K., and Franceschi, R. T. (2001) Endocrinology 142, 4379–4388[Abstract/Free Full Text]
  57. Boudreaux, J. M., and Towler, D. A. (1996) J. Biol. Chem. 271, 7508–7515[Abstract/Free Full Text]
  58. Yang, R., and Gerstenfeld, L. C. (1996) J. Biol. Chem. 271, 29839–29846[Abstract/Free Full Text]
  59. Garrett, I. R., Chen, D., Gutierrez, G., Zhao, M., Escobedo, A., Rossini, G., Harris, S. E., Gallwitz, W., Kim, K. B., Hu, S., Crews, C. M., and Mundy, G. R. (2003) J. Clin. Invest. 111, 1771–1782[CrossRef][Medline] [Order article via Infotrieve]
  60. Murray, E. J., Bentley, G. V., Grisanti, M. S., and Murray, S. S. (1998) Exp. Cell Res. 242, 460–469[CrossRef][Medline] [Order article via Infotrieve]
  61. Murray, E. J., Grisanti, M. S., Bentley, G. V., and Murray, S. S. (1997) Metabolism 46, 1090–1094[CrossRef][Medline] [Order article via Infotrieve]
  62. Onishi, T., and Hruska, K. (1997) Endocrinology 138, 1995–2004[Abstract/Free Full Text]
  63. Isaksson, A., Musti, A. M., and Bohmann, D. (1996) Biochim. Biophys. Acta 1288, F21–29[Medline] [Order article via Infotrieve]
  64. Miles, R. R., Sluka, J. P., Halladay, D. L., Santerre, R. F., Hale, L. V., Bloem, L., Patanjali, S. R., Galvin, R. J., Ma, L., Hock, J. M., and Onyia, J. E. (2002) J. Cell. Biochem. 85, 229–242[CrossRef][Medline] [Order article via Infotrieve]
  65. Tintut, Y., Parhami, F., Le, V., Karsenty, G., and Demer, L. L. (1999) J. Biol. Chem. 274, 28875–28879[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 EndocrinologyHome page
S. Yu, R. T. Franceschi, M. Luo, X. Zhang, D. Jiang, Y. Lai, Y. Jiang, J. Zhang, and G. Xiao
Parathyroid Hormone Increases Activating Transcription Factor 4 Expression and Activity in Osteoblasts: Requirement for Osteocalcin Gene Expression
Endocrinology, April 1, 2008; 149(4): 1960 - 1968.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
S. Yu, Y. Jiang, D. L. Galson, M. Luo, Y. Lai, Y. Lu, H.-J. Ouyang, J. Zhang, and G. Xiao
General Transcription Factor IIA-{gamma} Increases Osteoblast-specific Osteocalcin Gene Expression via Activating Transcription Factor 4 and Runt-related Transcription Factor 2
J. Biol. Chem., February 29, 2008; 283(9): 5542 - 5553.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
A. Rey, D. Manen, R. Rizzoli, J. Caverzasio, and S. L. Ferrari
Proline-rich Motifs in the Parathyroid Hormone (PTH)/PTH-related Protein Receptor C Terminus Mediate Scaffolding of c-Src with beta-Arrestin2 for ERK1/2 Activation
J. Biol. Chem., December 15, 2006; 281(50): 38181 - 38188.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
G. Xiao, D. Jiang, C. Ge, Z. Zhao, Y. Lai, H. Boules, M. Phimphilai, X. Yang, G. Karsenty, and R. T. Franceschi
Cooperative Interactions between Activating Transcription Factor 4 and Runx2/Cbfa1 Stimulate Osteoblast-specific Osteocalcin Gene Expression
J. Biol. Chem., September 2, 2005; 280(35): 30689 - 30696.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
F. Q. Pirih, A. Tang, I. C. Ozkurt, J. M. Nervina, and S. Tetradis
Nuclear Orphan Receptor Nurr1 Directly Transactivates the Osteocalcin Gene in Osteoblasts
J. Biol. Chem., December 17, 2004; 279(51): 53167 - 53174.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
279/7/5329    most recent
M311547200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jiang, D.
Right arrow Articles by Xiao, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jiang, D.
Right arrow Articles by Xiao, G.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2004 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement