Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M312346200 on November 20, 2003

J. Biol. Chem., Vol. 279, Issue 7, 6035-6045, February 13, 2004
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
279/7/6035    most recent
M312346200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hashmi, S.
Right arrow Articles by Lustigman, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hashmi, S.
Right arrow Articles by Lustigman, S.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

The Caenorhabditis elegans Cathepsin Z-like Cysteine Protease, Ce-CPZ-1, Has a Multifunctional Role during the Worms' Development*

Sarwar Hashmi{ddagger}§, Jun Zhang{ddagger}, Yelena Oksov¶, and Sara Lustigman{ddagger}

From the {ddagger}Laboratory of Molecular Parasitology and the Laboratory of Electron Microscopy, Lindsley F. Kimball Research Institute, New York Blood Center, New York, New York 10021

Received for publication, November 11, 2003


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
We have analyzed the expression and function of Cecpz-1, a Caenorhabditis elegans cathepsin Z-like cysteine protease gene, during development of the worm. The cpz-1 gene is expressed in various hypodermal cells of all developmental stages and is specifically expressed in the gonads and the pharynx of adult worms. Disruption of cpz-1 function by RNA interference or cpz-1(ok497) deletion mutant suggests that cpz-1 has a role in the molting pathways. The presence of the native CPZ-1 protein in the hypodermis/cuticle of larval and adult stages and along the length of the pharynx of adult worms, as well as the cyclic expression of the transcript during larval development, supports such function. We hypothesize that the CPZ-1 enzyme functions directly as a proteolytic enzyme degrading cuticular proteins before ecdysis and/or indirectly by processing other proteins such as proenzymes and/or other proteins that have an essential role during molting. Notably, an impressive level of the CPZ-1 native protein is present in both the new and the old cuticles during larval molting, in particular in the regions that are degraded prior to shedding and ecdysis. The similar localization of the related Onchocerca volvulus cathepsin Z protein suggests that the function of CPZ-1 during molting might be conserved in other nematodes. Based on the cpz-1 RNA interference and cpz-1 (ok497) deletion mutant phenotypes, it appears that cpz-1 have additional roles during morphogenesis. Deletion of cpz-1 coding sequence or inhibition of cpz-1 function by RNA interference also caused morphological defects in the head or tail region of larvae, improperly developed gonad in adult worms and embryonic lethality. The CPZ-1 native protein in these affected regions may have a role in the cuticular and the basement membrane extracellular matrix assembly process. The present findings have defined a critical role for cathepsin Z in nematode biology.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Based on the identification and characterization of a cysteine protease in human brain, a new subfamily of cysteine proteases of the papain family, the cathepsin Z-like enzyme, was recently classified (1). The human brain cathepsin Z was, however, found to be widely expressed in many tissues, suggesting that this enzyme is possibly involved in the normal intracellular protein degradation that takes place in all cell types. Notably, the enzyme was also found in many cancer cell lines and in primary tumors from different sources, which also suggested a role for this enzyme in tumor progression (1). The human cathepsin Z contains distinctive features that separate it from other human cysteine proteases (2). Cathepsin Z is characterized by an unusual and unique 3-amino acid insertion (HIP) in the highly conserved region between the glutamine of the putative oxyanion hole and the active site cysteine, which might confer special properties to the enzyme (3). It functional diversity is generated by the addition of the HIP residues including His23 in the mature enzyme that provides an anchor for the C terminus of a substrate, thereby allowing favorable enzyme-substrate interaction independent of the P2-P1 sequence. In another study, cathepsin Z-like enzyme (CPZ)1 was shown to exhibit carboxymonopeptidase as well as carboxydipeptidase activity (4). Moreover, the pro-region of the cathepsin Z is the shortest known to exist in the papain family, and it does not share any significant similarity with the other cathepsin family sequences (1), suggesting that the structural basis for regulating the activity and the processing of this zymogen might be different from that of the other members of the papain family.

Interestingly, cDNA sequences encoding cathepsin Z-like enzymes have been identified among both parasitic and free-living nematodes (5, 6). The only two published nematode cathepsin Z-like enzymes were postulated to function during molting (6), which is an obligatory process for nematode development and potentially in other fundamental biochemical processes that are still undefined (5). The role of the Onchocerca volvulus CPZ during molting was evidenced by its distinct localization, as determined by using monospecific antibodies raised against the O. volvulus LOVCP enzyme (renamed Ov-CPZ) and thin sections of the parasitic nematode. The native enzyme was localized in the region where the separation between the cuticles of the third-stage larvae (L3) and the fourth-stage larvae (L4) during molting takes place (6). The homologous enzyme in Toxocara canis (Tc-CPZ), however, was also highly expressed in adult stages, which precluded its exclusive role during T. canis molting. Unfortunately, it is still difficult to elucidate gene functions directly in parasitic nematodes because of the lack of molecular genetic approaches to directly investigate the role of a desired gene in the biology/biochemistry of these organisms. To conclusively uncover the broad range of the cathepsin Z enzyme function in the parasitic nematodes, we took advantage of the presence of CPZ-encoding sequences in the free-living nematode, Caenorhabditis elegans, and the availability of molecular tools that provide for high throughput characterization of genes in this powerful model system. The C. elegans has only two genes that encode cathepsin Z-like cysteine proteases, which we named Ce-cpz-1 (F32B5.8) and Ce-cpz-2 (M04G12.2); this makes it an ideal in vivo system for studying the putative functions of the homologous genes in the parasitic nematodes for which the most important biochemical interactions are likely to be conserved (7, 8). The use of the C. elegans model system for the study of homologous genes found in many other organisms including humans has already revolutionized the progress toward the confirmation of genes that can become targets for new drug development (7, 8). The amino acid sequence of Ce-CPZ-1 is 82 and 73% identical to the O. volvulus and T. canis CPZ enzymes, whereas Ce-CPZ-2 shows only 57 and 53% identity, respectively. Because of the greater identity of Ce-CPZ-1 to the parasitic nematode sequences, we chose to study the functional role of Ce-CPZ-1 during C. elegans development as the model system for the parasitic CPZ enzymes, and consequently validate whether these enzymes in the parasitic nematodes could become potential targets for the development of therapeutic intervention. Cysteine proteases in many other parasite systems have been identified as potential targets for drug or vaccine development (9, 10).


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
The Cathepsin Z-like Cysteine Proteases of C. elegans—A BLAST search (11) of ACeDB, the C. elegans data base (www.sanger.ac.uk/projects/C_elegans/wormpep/1) using the O. volvulus Ov-CPZ amino acid sequence (U71150 [GenBank] ) identified two predicted C. elegans cathepsin Z-like genes (F32B5.8 and M04G12.2), which we named Ce-cpz-1 and Ce-cpz-2, respectively. Alignment of the CPZ protein sequences within the GenBankTM data base was made using ClusterW multiple sequence alignment. The Ce-CPZ-1 protein encoded by the F32B5.8 gene had the highest similarity with the Ov-CPZ protein (82%) in comparison to 57% identity of Ce-CPZ-2 with Ov-CPZ, and is therefore the focus of the studies outlined below. Few cDNA clones corresponding to the F32B5.8 gene were identified in the Expressed Sequence Tag Data Base, one of which contained the full-length Ce-cpz-1 cDNA sequence (clone yk94b1, accession no. D66235 [GenBank] ). The pBluescript phagemid of the {lambda}ZAPII phage of clone yk94b1 (obtained from Yuji Kohara, C. elegans Consortium, National Institute of Genetics, Mishima, Japan) was excised and the DNA sequenced in both directions to confirm the predicted amino acid sequence of the F32B5.8 gene. Based on the cDNA sequence and trans-splicing patterns, there appear to be 5 exons in the F32B5.8 gene instead of 7 exons as predicted by Genefinder. In addition, we amplified the corresponding SL1 trans-spliced cDNA product from total RNA, and its sequence has confirmed the first ATG codon in the yk94b1 cDNA clone.

The signal sequence and its putative cleavage site were identified using the SignalP Server (www.cbs.dtu.dk/services/SignalP). Analysis of the putative promoter region of Ce-cpz-1 gene was performed using Genefinder provided by the BCM server (www.hgsc.bcm.tmc.edu/searchlauncher).

Stage-specific Profile of the Ce-cpz-1 mRNA Transcript Using Real-time PCR—A synchronous population of arrested first-stage larvae (L1) was prepared by treatment of gravid hermaphrodites with sodium hypochlorite and subsequent hatching from the embryos overnight in water (12). The arrested L1 were then transferred onto NGM agarose plates seeded with bacteria, which allowed the collection of synchronous worms over a 40-h period during L1 to young adult C. elegans development at 2-h intervals (Fig. 2), as previously described (13). Approximately 40,000 worms collected from each stage were washed several times with autoclaved distilled water and stored at -70 °C until needed. Total RNA was prepared from embryos and from all the other developmental stages using TRIzolTM reagent (Invitrogen) according to manufacturer's instructions. First strand cDNA was generated from 1 µg of total RNA using the Omniscript RT kit (Qiagen, Valencia, CA) and priming with random hexamers. The specific cDNA fragment of Ce-cpz-1 was then amplified using the forward 5'-GCTTCTTCGGCTTATGGC-3' and the reverse 5'-AACTGACAGATAGGCTTGTGG-3' primers and the copy number quantified by real-time PCR using QuantiTechTM SYBR Green PCR kit (Qiagen). Another set of primers, forward 5'-GCATTGTCTCACGCGTTCAG-3' and reverse 5'-TTCTTCCTTCTCCGCTGCTC-3', was used for the specific amplification of an internal control, the ama-1 transcript (13). Both sets of primers were designed to span an intron to distinguish cDNA from contaminating gDNA products. The following PCR conditions, which allowed reactants to remain in excess, were used: 50 °C for 2 min, 95 °C for 15 min, followed by 45 cycles of 94 °C for 15 s, 62 °C for 30 s, and 72 °C for 45 s. To determine the copy number of each transcript within the stage-specific cDNA preparations, standard curves for cpz-1 and ama-1 were drawn based on quantitative PCR using known amounts of template DNA in a range of 10-106 copies. The relative content of the transcript corresponding to cpz-1 is expressed in each developmental stage as the ratio between its copy numbers relative to that of ama-1.



View larger version (16K):
[in this window]
[in a new window]
  		FIG. 2.
Temporal pattern of Ce-cpz-1 gene expression as determined by real-time PCR. The levels of the cpz-1 transcript in each stage of development were compared. The graph shows the ratio (± S.D.) between cpz-1 levels and those of the constitutively expressed control gene ama-1 (y axis). We used the ama-1 gene as an internal control transcript to allow the relative quantification of cpz-1 expression in each stage. The mRNA was isolated from mixed-stage embryos and synchronized larval and adult populations collected at 2-h intervals and used for the preparation of stage-specific cDNA as indicated on x axis. Stage-specific molting within the life cycle is indicated by vertical and horizontal arrows. Note that cpz-1 transcripts increased in the intermolt period of each larval stage and at 40 h when the fertilized embryos go through the process of embryogenesis. Each experimental point was repeated at least twice.

 
Construction of cpz-1 Transgenic C. elegans Strains—Two types of reporter fusion construct were generated. The transcriptional fusion construct designated pSL108A contained a 2.3-kb promoter region of the Ce-cpz-1 and was generated by PCR from C. elegans genomic DNA (Fig. 1C). It was cloned into the lacZ reporter vector pPD90.23, which contains the nuclear localization signal (NLS) motif. The translational fusion gene constructs designated pSL103 and pSL107A contained a genomic fragment of Ce-cpz-1, which included a 1.4-kb promoter region and the first 4 exons (Fig. 1C). The gene fragment for these constructs was amplified from C. elegans genomic DNA and subsequently cloned into the PCR 2.1 cloning vector (TOPO cloning kit, Invitrogen) before excision and subcloning into two C. elegans expression vectors: 1) pPD95.75 (pSL103), which expressed the gene in frame with gfp; and 2) pPD90.23, which expressed the gene in frame with {beta}-galactosidase (pSL107A) and in the nuclei of the worms. Sequencing of the final constructs was performed to confirm that the coding sequence of cpz-1 in both translational constructs was in frame with gfp or the lacZ sequences.




View larger version (148K):
[in this window]
[in a new window]
  		FIG. 1.
A, sequence of the Ce-CPZ-1 promoter, cDNA, and the encoded protein. The promoter is in lowercase, and the cDNA sequence is in uppercase. The signal peptide of the protein is boxed. An arrow indicates the predicted post-translational cleavage site of the propeptide from the mature enzyme, and the asterisks indicate the cysteine, histidine, and asparagine residues within the active site. The conserved HIP motif, the cysteine active site CGSCWAF, and the CGSCW repeat amino acid sequences are in bold letters. The primers used for subcloning the gene fragments into the C. elegans expression vectors are underlined (transcription construct, pSL108A) and double underlined (translation constructs, pSL103; pSL107A). The transcriptional motifs within the putative promoter region are in uppercase. B, multiple alignment of the deduced amino acid sequence of O. volvulus cathepsin Z-like cysteine protease (Ov-CPZ) and its homologues, two C. elegans sequences (Ce-CPZ-1 and Ce-CPZ-2), T. canis (Tc-CPZ), and the human cathepsin Z-like enzyme from brain (Hs-CPZ). Arrow indicates the putative cleavage site of the signal peptide, the block arrow indicates the putative cleavage between the propeptide and the mature enzyme, and the asterisks indicate the cysteine, histidine, and asparagine residues within the active sites. ### indicates the conserved HIP motif in all the cathepsin Z sequences; the nematode-specific CGSCW repeat and the cysteine active site CGSCWAF sequence are boxed. C, genomic organization of the C. elegans Ce-cpz-1 gene. Exons are indicated as shaded boxes, and the numbers underneath indicate the amino acid residues within that exon. D, genomic organization of the O. volvulus Ov-cpz gene. Exons are indicated as shaded boxes; the size of the box indicates the size of exon in each gene. The conserved HIP motif, the cysteine (CGSCWAF), histidine, and the asparagine residues within the active site, the CGSCW repeat, and the cleavage sites for the signal peptide (arrowhead) and the propeptide (arrow) are marked in B and C. E, reporter constructs used to generate transgenic lines. Translational fusion constructs were generated by fusing a 1.4-kb promoter region upstream of cpz-1 and its first four exons in frame with gfp (pSL103) or lacZ (pSL107A). The transcriptional fusion construct was created by fusing a 2.3-kb promoter region upstream of the cpz-1 cDNA to a lacZ reporter construct (pSL108A). NLS, nuclear localization signal within the lacZ reporter constructs; ATG, the codon for the first methionine within the expression constructs.

 
C. elegans adult hermaphrodites were transformed by microinjecting ~80 ng/µl recombinant plasmid DNA, prepared using the ConcertTM rapid plasmid miniprep system (Invitrogen), into their gonadal syntium as described previously (14, 15). A plasmid DNA (pRF4) containing the dominant selectable marker gene rol-6 (su1006), which encodes a mutant collagen, was co-injected (~80 ng/µl) with the Ce-cpz-1:lacZ or Ce-cpz-1:gfp fusion constructs. C. elegans expressing the rol-6 gene continuously roll over, thereby providing a visible phenotype for the selection of transgenic worms (16). F2 rollers were picked and transferred into individual Escherichia coli plates to establish a number of independent lines. Lines in which F3 and subsequent generations showed the roller phenotype were stained for {beta}-galactosidase expression using DAPI (4',6-diamidino-2-phenylindole, final concentration 0.1%) as a co-stain to aid in the identification of cell types (17). cpz-1:gfp transgenes were visualized by mounting live transgenic worms on a 2% agarose pad in 0.01% sodium azide as described (18).

Double-stranded RNA (dsRNA) Preparation and RNA Interference (RNAi)—RNAi procedure was carried out using dsRNA as described by Fire et al. (19) and Tabara et al. (20). The full-length Ce-cpz-1 cDNA clone (yk94b1) in pBluescript was used as the template for RNA synthesis. The cDNA was first amplified with commercially available T3 and T7 primers (Invitrogen) and then used with either T3 or T7 RNA polymerase for the single-stranded sense or antisense RNA synthesis using the MEGAscript high yield transcription kit (Ambion Inc., Austin, TX). To obtain dsRNA, equal amounts of T3 and T7 reaction products were mixed and incubated for 10 min at 68 °C, followed by 37 °C for 30 min to yield a final concentration of dsRNA at ~5 µg/µl. Soaking with dsRNA (20) and feeding (21) with E. coli transformed with a plasmid DNA encoding cpz-1 were employed in the RNAi experiments. To determine the effect of cpz-1 gene disruption during post-embryonic development of C. elegans, RNAi was performed on synchronized L1, L2, L3, and L4 worms. The synchronized C. elegans population was prepared as described for stage-specific real-time PCR except that the L1, L2, L3, and L4 worms were collected at one point during their development: 8, 14, 21, and 28 h after transfer of hatched L1 worms to NGM plate, respectively. For RNAi using the soaking method, 40 C. elegans L1 and L2, 25 L3, and 20 L4 worms were incubated in 20 µl of 0.2 M sucrose in 0.1x PBS premixed with 1 µl of Lipofectin (Invitrogen) and containing cpz-1 dsRNA at a final concentration of 2 µg/µl. After 24 h, soaked larvae were transferred to individual E. coli plates and their development examined for 2-3 days. Stage-specific larvae soaked in 0.2 M sucrose, 0.1x PBS and Lipofectin but without dsRNA served as the control. For RNAi using the feeding method, stage-specific larvae were fed on HT115(DE3) bacteria expressing dsRNA of cpz-1. Briefly, full-length cpz-1 cDNA fragment (~1 kb) was amplified from total RNA and was cloned into the L4440 feeding vector (21). The resulting plasmid was transformed into the HT115(DE3) RNase III-deficient E. coli strain. Single colonies of HT115 bacteria containing the cloned L4440 plasmid were selected on tetracycline plates and then were grown overnight in culture in Luria Broth with 50 µg/ml ampicillin, and seeded directly onto NGM plates with 1 mM isopropyl-1-thio-{beta}-D-galactopyranoside and 50 µg/ml ampicillin. The induction of the Ce-cpz-1 dsRNA was carried out at room temperature overnight. Staged larvae obtained from synchronous culture were placed onto NGM plates containing seeded bacteria expressing cpz-1 dsRNA for 36 h using optimal induction and feeding conditions as described (22). Non-induced bacteria served as a control. The treated worms were observed under light microscope using Nomarski optics.

To detect the early effect on embryonic development in F1 generation, RNAi was also performed by injecting adult hermaphrodite worms with dsRNA (concentration ~1 µg/µl) as previously described (20). The development of the F1 was observed over 2 days after egg laying. Each of the RNAi experiments described above was repeated at least three times.

Initial Characterization of cpz-1 Mutant Worms—We obtained a C. elegans cpz-1 mutant strain RB732 (allele ok497) from the C. elegans Gene Knockout Consortium (Oklahoma Medical Research Foundation). The ok497 allele has a deletion that covers part of exon 1 and complete removal of exons 2, 3, and 4 within the F32B5.8 gene. This mutant was back-crossed four times using wild type N2 strain males at the beginning of the cross according to standard protocol and maintained as homozygous. The homozygous mutant was sequenced to confirm the deletion site, using inner right sequence primer ATCTTGAACCATCCGTGCTC corresponding to position 59-79 in relation to ATG start codon and inner left sequence CTTATGGCAAGGTTCGGAAG corresponding to position 2614-2633 in relation to ATG start codon. Individual homozygous cpz-1 (ok497) mutant hermaphrodites were grown on plates at 20 °C, and their self-progeny were used in several experiments. For temperature shift experiments, the cpz-1 mutants L3 or L4 were raised at 15, 20, or 25 °C to see the effects of different temperatures on the growth and development of the mutant worms. For morphological comparison between mutant and wild type strains, living animals were observed using Nomarski differential interference contrast microscopy. RT-PCR was performed on cpz-1 mutant strain to determine the effect of mutation on the production of the cpz-1 transcript.

Production of Recombinant C. elegans CPZ-1 Fusion Polypeptide—A fragment of Ce-cpz-1 cDNA encoding the pro-region and the mature enzyme (amino acids 23-306, Fig. 1A) was amplified and cloned into the BamHI and XhoI sites of the pGEX4T-3 expression vector (Amersham Biosciences). The recombinant GST-CPZ-1 protein was expressed in E. coli strain HB101. As the recombinant protein was mostly expressed in the inclusion bodies, it was purified as follows: bacterial cells from a 500-ml culture were harvested and lysed by sonication in 40 ml of 50 mM Tris-HCl buffer, pH 8.0. The insoluble proteins were recovered by centrifugation at 12,000 x g for 15 min and re-sonicated in the same buffer one more time. After centrifugation, the pellet was suspended in 20 ml of 6 M urea in 50 mM Tris-HCl buffer, pH 8.0, and incubated at 37 °C for 10 min, followed by centrifugation at 14,000 rpm for 20 min. The soluble fraction was then subjected to preparative separation using the Prep Cell (Bio-Rad) according to the instructions from the manufacturer. Specific fractions containing the purified recombinant protein were identified by Western blot using antibodies against GST or antibodies against the homologous O. volvulus Ov-CPZ protein and pooled. The CPZ-1 protein was then cleaved from the GST fusion peptide by thrombin according to the recommendation from the manufacturer. A mouse anti-serum was raised against the purified CPZ-1 recombinant protein using the repetitive immunizations/multiple sites strategy (23, 24). Each mouse received a total of 10 µg of CPZ-1 emulsified in Ribi's adjuvant on days 0, 3, 6, 8, and 10. The anti-serum strongly reacted with the recombinant CPZ-1 protein but not with the recombinant GST Ce-CPL-1 (18) or Ce-CPZ-2 fusion proteins (data not shown).

Detection of the Native Ce-CPZ-1 Protein in C. elegans by Immunofluorescence—For detection of the native Ce-CPZ-1 enzyme in C. elegans embryos, gravid hermaphrodites were washed off culture plates in PBS and cut open to release the embryos. The embryos were then collected and fixed in methanol/acetone using the freeze-cracking protocol (25). For whole mounted immunostaining, mixed-stage population of larvae and adults were collected and washed in PBS and Ruvkun Fixation Buffer before being fixed and permeabilized using 1% paraformaldehyde in Ruvkun Fixation Buffer for 30 min and two freeze-thaw cycles in dry/ethanol bath. The fixed embryos or the permeabilized whole worms were treated with a blocking solution (60 mg/ml normal goat serum in PBS; Jackson Immunoresearch Laboratories, Inc., Westgrove, PA) for 1 h before reaction with antibodies. Primary anti-CPZ-1 antibodies were used at 1:20 and 1:40 dilution. Fluorescein isothiocyanate-conjugated rabbit anti-mouse secondary antibodies were used at a 1:50 dilution. Specimens were mounted on slides with 15 µl of mounting medium, Vectashield containing DAPI (Vector Laboratories, Inc., Burlingame, CA). The edges of the cover slips were sealed with nail polish and viewed under fluorescence microscope using appropriate filter sets.

Ultrastructural Localization of the Native Ce-CPZ-1 Protein in C. elegans—To study the subcellular localization of the native CPZ-1 protein during C. elegans development, samples were collected from synchronized cultures during the molting processes throughout C. elegans development. Worms were fixed for 60 min in 4% paraformaldehyde, 0.1% glutaraldehyde in 0.1 M phosphate buffer, pH 7.4, containing 1% sucrose. The fixed worms were then processed for immunoelectron microscopy as previously described (6, 26, 27). Thin sections of C. elegans embedded worms were probed with mouse antisera raised against the recombinant C. elegans CPZ-1 fusion polypeptide before incubation with 15 nm gold particles coated with anti-mouse IgG (Amersham Biosciences). Mouse preimmune serum was used as the control.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
The C. elegans Cathepsin Z-like Enzyme Ce-cpz-1—BLASTP search with the O. volvulus cathepsin Z-like protease Ov-CPZ (accession no. U71150 [GenBank] ), identified only two closely related protein sequences in the C. elegans data base (ACeDB); one in cosmid F32B5, which maps to chromosome 1 (accession no. AF003148 [GenBank] ) and the second in cosmid M04G12, which maps to chromosome 5 (accession no. Z81103 [GenBank] ). We have designated the two putative cathepsin Z-like sequences Ce-CPZ-1 (F32B5.8) and Ce-CPZ-2 (M04G12.2). A comparison of the F32B5.8 genomic sequence and the yk94b1 cDNA clone encoding the full-length amino acid sequence of the corresponding protein revealed that the first Met residue in the N terminus sequence of F32B5.8 predicted by Genfinder was incorrect. This was also confirmed by cloning the 5'-noncoding region of the cDNA using the 22-nucleotide splice leader sequence, SL1, of C. elegans. In C. elegans, SL1 tends to be spliced very close, and often immediately adjacent, to the initiating methionine codon, and may possibly play a role in translation initiation (28). The putative ATG start codon of Ce-cpz-1 is at bp 25,362 instead of bp 27,752 of cosmid F32B5. The corresponding Ce-CPZ-1 cDNA therefore encodes a protein of 306 amino acids, containing a signal peptide of 23 residues, a propeptide of 42 amino acid, and a mature enzyme of 261 amino acid residues (Fig. 1A). By analogy with other cysteine proteases, the putative processing site of the zymogen to the mature form of the enzyme had been assigned to the Asp65-Leu bond. The Ce-CPZ-2 sequence comprises 467 amino acid residues with a putative zymogen-processing site at the Asp220-Leu bond. Although the CPZ subfamily is characterized by a short propeptide (41-42 amino acids) relative to those present in other cysteine proteases (1), Ce-CPZ-2 is an exception. It has a very long propeptide of 208 amino acid residues.

The amino acid sequences encoding the mature Ce-CPZ-1 and Ce-CPZ-2 enzymes have 82 and 57% identity with the Ov-CPZ amino acid sequence, and 73 and 53% identity with the T. canis (Tc-CPZ) cathepsin Z-like sequence, respectively. All the nematode cathepsin Z-like sequences, Ce-CPZ-1, Ce-CPZ-2, Ov-CPZ, and Tc-CPZ (Fig. 1B), contain upstream to the cysteine active site the conserved HIP amino acid sequence and an additional two other peptide insertions within the protein sequence characteristic of this new subfamily within the papain family of cysteine proteases (1, 5). Although the O. volvulus sequence of the CPZ proteins was the first one cloned (6), it was only subsequently classified as cathepsin Z once a homologous CPZ sequence was cloned from the human brain (Hs-CPZ) (1). The human cathepsin Z is 62, 50, 60, and 57% identical to Ce-CPZ-1, Ce-CPZ-2, Ov-CPZ, and Tc-CPZ, respectively. Interestingly, only the nematode cathepsin Z-like sequences have downstream of the cysteine active site a stretch of 5 amino acids, CGSCW, that is identical to the amino acid sequence within the conserved cysteine active site, CGSCWAF (Fig. 1, A and B) (5, 6). The significance or the function of the CGSCW repeat is unknown.

The following is the gene structure for Ce-cpz-1. The gene is composed of 5 exons and 4 introns, spanning ~2.8 kb. The second and the fourth introns of Ce-cpz-1 are unusually large (570 and 1110 bp); the first and third introns are 55 and 56 bp long (Fig. 1C). Interestingly, the gene structure is very similar to that of the Ov-cpz genomic sequence (accession no. U71150 [GenBank] ), which contains 8 exons (Fig. 1D). Regardless, both contain a very short third exon that encodes only the conserved sequence of the cysteine active site (CGSCWAF). This gene structure is different from that of the cpz-2 gene (data not shown). Because of the close structural similarity among cpz-1, Ov-cpz, and Tc-cpz, we have chosen to study cpz-1 in great length and thus utilized the C. elegans model system to elucidate its function(s) during nematode development in comparison to those postulated in the parasitic nematodes (5, 6).

The Transcript Corresponding to Ce-cpz-1 Gene Is Constitutively Expressed in All Developmental Stages of C. elegans and Is Elevated Prior to each Molt—To determine the temporal expression profile of the Ce-cpz-1 mRNA transcript during C. elegans development, quantitative real-time PCR was performed on total RNA prepared from synchronized populations of C. elegans at 2-h intervals. We used the ama-1 gene as an internal control transcript to allow the relative quantification of cpz-1 expression in each stage. It has previously been shown that the levels of ama-1, which encodes the large subunit of RNA polymerase II (29), are relatively constant during development, and it is therefore a suitable control gene for comparison of transcript levels between different stages of the worm (13, 30). As shown in Fig. 2, although the cpz-1 transcript is present throughout development, it is least expressed in embryos and during L1 to L2 growth. Interestingly, the level of the cpz-1 transcript increased significantly prior to the L2/L3 molt at 16 h and decreased after the L2/L3 molt (~20 h), and then periodically increased before the L3/L4 molt (~24 h) and the L4/adult molt (~34 h). In addition, a significant increase in its level occurred during the period when the early part of embryogenesis takes place (~40 h after L1). During adulthood there is a 2-3-h period when the fertilized eggs go through the process of embryogenesis (31).

Temporal and Spatial Expression of Ce-cpz-1 in Transgenic Worms—The spatial expression pattern of Ce-cpz-1 was examined after transformation of C. elegans with a gfp reporter fusion cpz-1:gfp construct (pSL103) or with cpz-1:lacZ fusion constructs (pSL107A and pSL108A) containing a NLS cassette (Fig. 1E). Three independent transgenic lines carrying an extrachromosomal array of the reporter gene and the pRF4 transformation marker were established for each construct. The three lines for each transgene showed similar expression patterns. For a more detailed analysis of the expression patterns and to identify the individual cells showing promoter activity, reporter gene constructs containing the NLS cassette were used. Transgenic lines created after injection of either transcriptional (pSL108A) or translational (pSL107A) cpz-1:lacZ constructs showed identical expression patterns indicating that the 1.4-kb promoter region within pSL103 and pSL107A contains all the required regulatory elements. A typical cpz-1:lacZ expression pattern is shown in Fig. 3. {beta}-Galactosidase expression was observed in many cells, including gut, hypodermal, and other cells within the developing embryos (Fig. 3, a and b). However, because of the intense staining in some parts of the developing embryos, the identification of the many stained cells was not possible. In post-embryonic stages, {beta}-galactosidase staining was present in the hypodermal cells of all larval stages (Fig. 3c) and young adults (Fig. 3, e and f) until they developed to fully mature gravid hermaphrodites (7-10 days after L4 adult hermaphrodite). {beta}-Galactosidase staining was also detected in intestinal cells. The cpz-1:lacZ expression in all stages was specifically detected in the large hypodermal syncytium covering most of the worm (hyp7), and in the hypodermal cells of the head (hyp4 and hyp6) and occasionally in hypodermal cells in the tail. {beta}-Galactosidase staining was also present in few pharyngeal cells of the adult worms but not in the pharyngeal cells of larval stages (Fig. 3, d and e). Expression of cpz-1:gfp translational construct was detected in all developmental stages except embryos. The cpz-1:gfp expression was restricted to the hypodermis, with additional expression in the pharynx and the gonad only in the L4 and adult worms stages (Fig. 4). The specific expression in the pharynx of adult stages was similar to that observed in cpz-1:lacZ transgenic worms. Interestingly, there was no embryonic expression of the gfp construct. The reason for the absence of embryonic expression is unknown, but could be because of some intrinsic effects of the gfp construct on such temporal expression.



View larger version (120K):
[in this window]
[in a new window]
  		FIG. 3.
Cell-specific expression of Ce-cpz-1:lacZ during C. elegans development. Lines of transgenic C. elegans carrying the cpz-1:lacZ reporter gene were created as described under "Experimental Procedures." The histochemical stain for {beta}-galactosidase produces insoluble products in nuclei transcribing the cpz-1 gene. In all transgenic lines, the expression of cpz-1 was observed in hypodermal cells as follows: a, developing embryo (arrows); b, mixed stage embryos while the embryos are still in the uterus; c, mixed-stage larvae; d, L3 (note that there is no expression in the pharynx (arrowhead)); e, the anterior portion of an adult worm (arrow) (note that expression is also observed in the cells of the pharynx (arrowhead)); f, the posterior region of an adult worm. Transgenic C. elegans worms were photographed using Nomarski optics (original magnification, x400).

 



View larger version (36K):
[in this window]
[in a new window]
  		FIG. 4.
Transgenic worms showing Ce-cpz-1:gfp expression. GFP was expressed in all larval stages of the worm. A representation of the GFP expression profiles is shown: a, along the length of the body in the cuticular region of L2; b, hypodermal cells (hyp) of L3; c, gonad (g) region of L4; and d, the posterior bulb of pharynx (arrowhead) in an adult worm. The gfp expression was observed under Zeiss fluorescent microscope using fluorescein isothiocyanate filter sets and photographed (original magnification, x200).

 
Ce-cpz-1 Is Critical for Molting and Normal Development of Worms—RNAi was used to determine the function of cpz-1 during development and specifically its potential role(s) during molting. RNAi on stage-specific C. elegans worms was employed using both the soaking and the feeding methods (20, 21). RNAi with the Ce-cpz-1 activity resulted mostly in severe molting and/or morphological defects and some embryonic developmental arrest (Fig. 5). Inactivation of Ce-cpz-1 in L4 larvae by soaking or by injection in young hermaphrodites resulted in embryonic arrest at >50-cell stage of development (Fig. 5b). Moreover, the development of a small percentage (12%) of the laid embryos that escaped the embryonic arrest and progressed to the L2 stage was arrested at the L2 to L3 molt. In these worms the old cuticle remained attached to the mid-portion of the body resulting in a constriction in the mid body (Fig. 5c). A similar percentage of embryonic lethality was obtained when L4 larvae were fed on cpz-1 dsRNA.



View larger version (103K):
[in this window]
[in a new window]
  		FIG. 5.
Phenotypes of the C. elegans cpz-1 RNAi mutants showing distinct morphological defects in the affected worms. Various stages of C. elegans were soaked in or fed on cpz-1 dsRNA as described under "Experimental Procedures." a, wild type embryo; b, mutant embryos arrested at >50-cell stage proliferation; c, cuticular constriction (arrow) formed in defective L2/L3 molt; d, L2 worm with morphological defect in the head (arrow); e, wild type worm with a normal head (arrow); f, structural defect in the tail of L2 (arrow); g, wild type worm with a normal pointed tail (arrow); h, L3,with a partially detached cuticle at the head while the buccal plaque between mouth and the cuticle is still attached (arrow); i, late L4 worm showing defects in the gonad extension (arrow); j, late L4 with a normal gonad (arrow); k, a worm arrested at the L3/L4 molt. All photographs were taken using Nomarski optics (original magnification, x400).

 
For a finer analysis of the temporal effects of cpz-1 gene suppression, RNAi assays were performed on various stage-specific worms using soaking and feeding methodology. When L1 worms were soaked in cpz-1 dsRNA, 20% of the treated L1 had severe structural defects in anterior or posterior regions of the L2 body. The head of the affected larvae was strikingly swollen and curved (Fig. 5d), and the tail was bifurcated (Fig. 5f). Soaking of L2 in cpz-1 dsRNA resulted in L3 to L4 molting defects (23%) and morphological defects (35%) in L4. The treated L2 arrested at the L3/L4 molt as a result of incomplete shedding of old cuticle (Fig. 5h). The morphological defects were confined to the gonads and included abnormal gonad extension and improper vulva opening (Fig. 5i). When L2 larvae were fed on cpz-1 dsRNA, 80% of the larvae arrested at the L3/L4 molt; these worms under Nomarski optics had major morphological defects in the anterior region of the worms (Fig. 5k). With the exception of feeding L2 on cpz-1 dsRNA, the percentage of phenotypes resulting from RNAi was relatively low and ranged between 20 and 80%. Regardless, we obtained similar results using the different treatment methods in repeated experiments, except that the feeding of L2 with cpz-1 dsRNA has increased the percentage of the arrested molting phenotype from 23% to 80%. The soaking of L2 larvae in dsRNA had more severe effects, possibly related to a high level of cpz-1 transcripts in this stage of the worm (Fig. 2).

Mutation in cpz-1 Gene Affects C. elegans Development—Because of the low penetrance and variability of the stage-specific RNAi phenotypes, it was of importance to analyze a cpz-1 deletion mutant. Sequence analysis of cpz-1 (ok497) homozygous mutant revealed a 1,925-bp deletion in the coding sequence of the gene, which includes a deletion of a portion of exon 1 (amino acids 39-49) and complete removal of exons 2-4, which also resulted in the loss of an open reading frame between exon 1 and exon 5. Homozygous cpz-1 (ok497) mutant animals were examined using Nomarski microscopy to study the effects of disrupting the normal function of cpz-1. Individual cpz-1 mutant worms were raised at 15, 20, or 25 °C and examined for phenotypic differences. At all these temperatures, cpz-1 homozygous mutant worm were both viable and fertile. However, at 20 and at 25 °C, ~20% of the cpz-1(ok497) mutant embryos showed embryonic lethality (Fig. 6a). Some embryos that escaped embryonic lethality although they completed the L1 molt have shown morphological defects in the head (Fig. 6b) or the tail of the L2 worms (Fig. 6c). These phenotypes were similar to that obtained after cpz-1 RNAi (Fig. 5, d and f). Interestingly, at 15 °C higher and broader phenotypic defects were observed. Approximately 60% of the mutant embryos showed embryonic lethality, and ~6% of the F1 generation larvae had molting defects; some larvae hatched to L1 but they could not separate themselves from the eggshell completely (Fig. 6d), and few larvae arrested at the L2/L3 molt (Fig. 6e). These larvae often could not shed the L2 cuticle during L2/L3 molt, resulting in the formation of severe constriction of unshed cuticle in L3 animals. In addition, few cpz-1 mutant animals showed partially detached cuticle at the head during L2/L3 molt (Fig. 6f); these animals were stuck within the old cuticle and were thus unable to proceed with ecdysis. Similar to cpz-1 RNAi, ~5% of the cpz-1 mutant worms developed gonad defect in L4 (Fig. 6g).



View larger version (84K):
[in this window]
[in a new window]
  		FIG. 6.
Phenotypes of the C. elegans cpz-1 (ok497) mutants worms showing distinct morphological and molting defects. The homozygous cpz-1 (ok497) mutant strains were analyzed as described under "Experimental Procedures." a, a mutant embryos failed to progress beyond cell proliferation stage; b, a mutant L2 showing structural defect in the head (arrow); c, L2 worm showing structural defect in the tail of a mutant worm (instead of a pointed and long tail, the mutant worm has a short and hooklike structure (arrow)); d, L1 larvae showing molting defect (the old cuticle is still attached to larvae); e, an old cuticle from a previous larval stage remains attached to mid-body of nematode causing a severe constriction (arrow); f, larval arrest during L2/L3 molt showing characteristic phenotype of partially detached cuticle at the head and the buccal plaques still attached between mouth and the cuticle (arrow); g, late L4 showing defects in the gonad. All photographs were taken using Nomarski optics (original magnification, x400).

 
Localization of the Native CPZ-1 Protein in C. elegans by Immunofluorescence and Immunoelectron Microscopy—Antibodies raised against the recombinant CPZ-1 protein (amino acid residues 23-306) were first confirmed to not cross-react with the Ce-CPZ-2 and Ce-CPL recombinant proteins by Western blot (data not shown) before they were used to localize the CPZ-1 native protein on whole worms and in thin sections. Using immunofluorescence staining of fixed embryos and permeabilized whole mounted worms, the native Ce-CPZ-1 protein was localized in many cells in early embryonic stages (Fig. 7a). DAPI was added to the mounting media to identify stained nuclei. Although few hypodermal cells were identified, the exact identification of many other cells was not possible because of the extensive staining. During morphogenesis of the embryos, the native CPZ-1 protein was localized along the hypodermal region, whereas the embryo was at the lima bean stage (at 6 h within the embryogenesis process) (Fig. 7b). In all larval stages (L1-L4), a restricted pattern of CPZ-1 localization became apparent, with the most prominent staining detectable throughout the hypodermis (Fig. 7c). In L4 worms the native CPZ-1 protein was also localized in the hypodermis, but in addition, the CPZ-1 protein was also detected in few gonad cells (Fig. 7c) and along the whole length of the pharynx of adult worm (Fig. 7d).



View larger version (62K):
[in this window]
[in a new window]
  		FIG. 7.
Localization of the native Ce-CPZ-1 enzyme in C. elegans by immunofluorescence. Immunostaining of embryos and whole mounted worms was performed as described under "Experimental Procedures." The CPZ-1 protein is localized as follows: a, various cells of early embryos (bracket); b, cells positioned in the dorsal end of the lima bean stage embryo (bracket) during early morphogenesis; c, along the whole length of L4, where it is localized in the cuticular (arrow) and in vulval (arrowhead) regions; and d, along the length of the pharynx of an adult worm including median (arrowhead) and posterior bulb of the pharynx (arrow). The localization of CPZ-1 was observed under Zeiss fluorescent microscope using fluorescein isothiocyanate filter sets (original magnification, x200).

 
To identify more precisely the hypodermal regions within the worms where the native CPZ-1 protein is localized, thin sections from various developmental stages of C. elegans were stained for immunoelectron microscopy analysis. In larval and adult stages, the CPZ-1 native protein was localized in the cuticular regions of the worms (Fig. 8, a and e). In molting larvae (Fig. 8, b-d), the protein was localized in both the new and old cuticles, in particular in the interface where the old cuticle is being degraded before ecdysis (Fig. 8c).



View larger version (61K):
[in this window]
[in a new window]
  		FIG. 8.
Ultrastructural localization of the native CPZ-1 protein in C. elegans at different stages of development. Antibodies raised against the C. elegans enzyme were used to study the subcellular localization of CPZ-1 as described under "Experimental Procedures." The native CPZ-1 protein is localized as follows: a, the cuticle (cu) of young larvae prior to molting; b, in the old as well as in the new cuticle of molting larvae (arrowhead); c, in both the old and the new cuticles when they separate. Note that the CPZ-1 native protein is also present in the space between the old and the new cuticles that degrades during ecdysis (arrowhead); d, in the old and the new cuticle in the final phase of ecdysis (note the thinner old cuticle with remaining struts of the median cuticular zone); and e, in the new cuticle after completion of molting. Each bar is 250 nm.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
In the present study, we have shown that cathepsin Z plays several critical roles in the biology of nematodes. Suppression of gene expression by RNAi or by cpz-1 (ok497) deletion in mutant strain has resulted in varying degree of functional loss including molting defect, morphological defect, and embryonic lethality. Similar to cpz-1 RNAi worms, the cpz-1 (0k497) mutant strain showed defects in embryogenesis and morphogenesis at the normal growth temperature (20 °C). Only at lower temperature (15 °C) did the cpz-1 mutant also show molting defects, similar to those seen with RNAi. The importance of Ce-cpz-1 in molting was thus established by the phenotypes obtained after cpz-1 RNAi and from initial analysis of homozygous cpz-1 (ok497) mutant worms and is supported by the distinct expression and localization of the gene product in the hypodermis and the pharynx of C. elegans worms.

Molting in nematodes has three major steps: 1) separation of the old cuticle from the hypodermis (apolysis), 2) formation of new cuticle arising from the outermost surface of the hypodermis, and 3) the shedding of the old cuticle (ecdysis) (32). In C. elegans, components of the old cuticle are degraded before ecdysis in mechanisms that are not yet established and that are believed to be dependent in part on the function of proteases and other components within the cuticle (33-36). The entire cuticle is shed at each molt and replaced with the new cuticle synthesized by the underlying layer of the hypodermal tissue, a large syncytium that extends throughout the length of the nematode. Both the synthesis and secretion of cuticular components by the hypodermis are tightly coupled to the molting cycles and are dependent upon precise control of a complex series of cellular events (35). The cuticle is mostly composed of collagen proteins, however, in each larval stage a unique set of collagen genes are produced by the hypodermal cell and exported to the surface (37). Notably, successful molting depends on the complete expulsion of the pharyngeal lining (32). About 30 min before ecdysis, the posterior bulb of the pharynx begins to twitch spasmodically, the cuticular lining breaks, and the posterior piece passes back into the intestine. Then the old cuticle of the body wall becomes inflated around the tip of the head, and the nematode pulls back from it repeatedly until the remainder of the cuticular lining of the pharynx is detached and then expelled through the mouth. The nematode then escapes from the old cuticle by pushing against the softened old cuticle with its head until a hole is made (32). Failing to expel the anterior piece can cause a cuticular plug in its mouth, which is not easily dislodged and can result in death by starvation.

It appears that the C. elegans CPZ-1 is similar to several other proteases of nematodes that have been reported to participate in this crucial process of molting during the development of nematodes. The role of these proteases was suggested to be in the digestion of old cuticle, degradation of the cuticular anchoring proteins, and/or the activation of peptide molting hormones or other molting enzymes by processing their proenzymes (38). Proteases such as serine, cathepsin L-like cysteine proteases, and/or aminopeptidases that are active during molting have been described in Phocanema decipiens (39), Ancylostoma (40), Homonchus contortus (41, 42), and filariae (43, 44). In the filarial parasites, Dirofilaria immitis and Brugia pahangi, metallopeptidases have been suggested to be intimately associated with molting (34, 43, 44). The O. volvulus CPZ enzyme has been suggested to have an essential role during molting (6). In our previous studies, we have shown that the C. elegans CPL-1 and the filarial cathepsin L play a potentially important role in molting (18).

We propose that cpz-1 may be involved indirectly in the process of degradation of anchoring proteins that are present in the old cuticle, which needs to be digested before shedding of the old cuticle occurs. The immunoelectron microscopy data clearly indicate the presence of CPZ-1 native protein in both the new and the old cuticles during molting, specifically at the time when the separation between the old and the new cuticles occurs. At the end of this process, a thinner old cuticle with remaining struts of the median cuticular zone is observed. In addition, CPZ-1 may acts as a proteolytic enzyme that degrades cuticular and/or other proteins that are part of the pharyngeal lining. Consequently, CPZ-1 may advance the complete separation process of the cuticles along the length of the worm body as well as in the pharynx even before complete ecdysis occurs. Further support for its digestive activity is based on previous studies on its homologous protein, Ov-CPZ, in O. volvulus. In O. volvulus, the native Ov-CPZ enzyme was localized specifically in the region where the separation between the cuticle of L3 and L4 during molting occurs, and culturing of O. volvulus L3 in the presence of synthetic irreversible inhibitors resulted in an incomplete separation between the two cuticles (6). In O. volvulus, the old cuticle is not degraded before ecdysis; however, the anchoring protein between the cuticles needs to be digested before complete ecdysis. Alternatively or additionally, CPZ-1 may participate in the processing of other nematode proteins that are critical for completion of the molting process, such as collagenases, peptide molting hormones, and/or other enzymes secreted by the worms during molting (38, 39, 41). Similar indirect function during C. elegans molting have been attributed to the C. elegans LRP-1 protein (35, 36). Mutation in the lrp-1 gene conferred an inability to shed and degrade all of the old cuticle at each of the larval molts. The extracellular part of LRP-1 was postulated to be required for the activation of collagenases or other proteases secreted during molts that partially degrade the old cuticle. Interestingly, both LRP-1 and CPZ-1 are expressed on the apical surface of the hyp7 cells that cover 90% of the nematode's surface area (36).

The periodic molting in C. elegans as well as in other nematodes requires strict temporal and spatial regulation of the expression of multiple genes that jointly regulate this process. Control mechanisms that regulate such a complicated process are poorly understood, but recent studies have implicated two C. elegans nuclear hormone receptors (NHR-23 and NHR-25) in the regulation of molting (45-47). Molting defects were observed after interference with C. elegans nhr-25 gene expression by RNAi. The arrested L1-L2 worms were unable to shed their cuticle properly during molting as whole cuticles or parts of cuticle remained attached to the rectum (38, 39). Soaking or feeding of all four larval stages of worms in nhr-23 dsRNA also resulted in molting defects, however, in the later developmental stages of the worms suggesting that nhr-23 may also regulate molting at each of the C. elegans larval developmental stages (47, 48). So far, it is not clear whether both proteins have a direct function or their role is through downstream gene(s) that are not activated because of the nhr-23 or nhr-25 RNAi inactivation. It is possible that a cascade of proteins take part in the molting process of C. elegans, some of which may or may not regulate the expression of others. The penetrance of both cpz-1 RNAi and the mutant phenotypes was low, suggesting that there are other genes might contribute additively to cpz-1 function during development. For example, the C. elegans cathepsin L, Ce-cpl-1, was shown to be involved in molting (18). Interestingly, during larval development, the mRNA transcript levels of cpl-1 and nhr-23, similar to that of the cpz-1 gene, increase before the molts. Future studies on cpz-1 mutant involving other genes that function during molting will shed light on the interaction between cpz-1 and other molting genes. A comprehensive functional analysis of all C. elegans genes using RNAi has been initiated (49, 50) and, in conjunction with genome-wide functional genomic approaches (51-53), including assays characterizing protein-protein interactions, will contribute to uncover the molecular basis and the components that are essential for molting.

Besides molting, the C. elegans cpz-1 appears to have additional regulatory function(s). Disruption of cpz-1 resulted in abnormal head or tail morphology of L2 worms when L1 were fed or soaked on cpz-1 dsRNA. Similar phenotypes were observed in homozygous cpz-1 (ok497) deletion mutant. The expression of cpz-1 in hypodermal cells may suggest that cpz-1 is also involved in morphological processes. Two forms of collagenous extracellular matrix (ECM) are present in nematodes: the cuticle that forms the exoskeleton and the basement membrane that surrounds the tissues. The ECM, both the cuticular and the basement membrane, is essential for the viability of all stages, as it helps maintain the worm's post-embryonic body shape (37). The cuticular ECM is predominantly composed of small highly cross-linked collagens that are assembled through complex post-translational modifications to form the cuticle in each of the newly developed larval stages. Previous studies have shown that mutations or inappropriate expressions of any of the temporarily expressed collagen genes during development can cause a variety of gross morphological defects (37, 54-56). We suggest that cpz-1, which is expressed in many hypodermal cells, may have an upstream regulatory role of the hypodermal morphogenic pathway and, as such, be responsible for the proper proteolytic processing of some of the procollagens expressed during larval development. Insufficient maturation of these precursors might produce abnormal cuticle and thus a deformed body. Notably, these abnormalities were only found in L2 stages. Another protease that belongs to the subtilisin-like proteinase family has been shown to be part of a similar process. It was shown to regulate the processing of the SQT-1 cuticle collagen (37, 57). The sqt-1 mutants exhibit the roller phenotype. Interestingly, inhibition of nhr-23, nhr-25, and lrp-1 gene expression also resulted in some morphological abnormalities. All these genes, including cpz-1, are highly expressed in the major hypodermal cells in all larval stages of nematodes, which supports their involvement in epidermal differentiation during or after molting (45, 46, 48).

In addition, cpz-1 RNAi in L2 worms as well as cpz-1 deletion mutant resulted in improperly developed gonad, suggesting another role for cpz-1 in the somatic gonad development. This is supported by cpz-1:gfp expression in the gonadal tissues of transgenic young hermaphrodite and the presence of the native CPZ-1 protein in some portion of the vulva. There are examples of C. elegans collagen-modifying enzyme, which affect morphology and development. For example, GON-1 is an ECM-modifying enzyme affecting organ morphogenesis (58); gon-1 mutant phenotype shows severe abnormality in the gonad. CPZ-1 may have a role similar to that of the GON-1 metalloprotease, which was suggested to direct the expansion of gonad by remodeling the basement membrane collagens (58).

Moreover, CPZ-1 has an additional function during embryonic development. Both cpz-1 mutant and cpz-1 RNAi caused embryonic lethality in the developing embryos. During normal development the cpz-1 transcript (reporter construct) and the protein are both expressed in many embryonic cells, including hypodermal cells, and in the hypodermis of the later stage embryos. Interestingly, both cpz-1 mutant and the cpz-1 RNAi-affected embryos failed to progress beyond the cell proliferation stage arresting before morphogenesis, which may suggest that cpz-1 directly or indirectly target those proteins that are essential in cell fate specification and organization of tissues and organs during development. The hypodermis plays a critical role in altering the shape of the embryo during C. elegans morphogenesis (59). The hypodermal cells originate on the dorsal surface of the embryo and migrate ventrally to enclose the embryo at the beginning of morphogenesis (59, 60). Subsequently, the hypodermal actin cytoskeleton reorganizes, forming an array of parallel actin fiber, and the contraction of these actin fibers within the hypodermal cells determines the shape of the embryo during elongation (59). Future experiments aimed at the identification of the protein(s) that are targeted by CPZ-1 activity when it controls these morphological processes would clarify the distinct function(s) of CPZ-1.

In summary, we suggest that CPZ-1 has a multifunctional role during C. elegans development. Although there are parallels between localization of the O. volvulus and C. elegans CPZ-1 enzymes during molting in both nematodes, the precise function(s) of the cpz-1 gene in other processes in both the free living and the parasitic nematodes will need further confirmation. These observations are encouraging for future investigation in the discovery of selective inhibitors unique to CPZ and thus will aid in the development of potential chemotherapeutic agents that will interfere with normal development of parasitic nematodes. The unique structure of cathepsin Z among other members of the papain family of cysteine proteases will be of great value in designing specific inhibitor useful as a research tools to investigate the physiological roles of this enzyme.


   FOOTNOTES
 
* This work was supported by National Institutes of Health Grant AI48057 and by a grant from the Rose M. Badgeley Residuary Charitable Trust (to S. L.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

§ To whom correspondence should be addressed: Laboratory of Molecular Parasitology, Lindsley F. Kimball Research Inst., New York Blood Center, 310 E. 67th St., New York, NY 10021. E-mail: shashmi{at}nybloodcenter.org.

1 The abbreviations used are: CPZ, cysteine protease cathepsin Z-like protein; ama-1, {alpha}-amanitin-resistant gene; BLAST, basic local alignment search tool; cpz-1, cysteine protease cathepsin Z-like gene; DAPI, 4'6-diamidino-2-phenylindole; dsRNA, double-stranded RNA; GFP, green fluorescence protein; kb, kilobase(s); L1, first-stage larvae; L2, second-stage larvae; L3, third-stage larvae; L4, fourth-stage larvae; lacZ, {beta}-galactosidase gene; RNAi, RNA interference; RT, reverse transcriptase; PBS, phosphate-buffered saline; NLS, nuclear localization signal; NGM, nematode growth medium; ECM, extracellular matrix; GST, glutathione S-transferase. Back


   ACKNOWLEDGMENTS
 
We thank Andy Fire for providing the gfp and LacZ expression vectors, Yuji Kohara for providing the yk94b1 cDNA clone, and Iva Greenwald for providing the L4440 feeding vector. We also thank C. elegans Gene Knockout Consortium (Oklahoma Medical Foundation) for the creation of cpz-1 mutant on our request. We thank Shahid Siddiqui and Mohandas Narla for comments on the manuscript, Jing Liu for expert technical assistance, Kelly Martens for generating some of the RNAi data, and Susan Fetic at the Laboratory of Microchemistry for DNA sequencing. cpz-1 mutant strain (allele ok497) and HT115(DE3) E. coli strain were provided by the Caenorhabditis elegans Genetics Center.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Santamaria, I., Velasco, G., Pendas, A. M., Fueyo, A., and Lopez-Otin, C. (1998) J. Biol. Chem. 273, 16816-16823[Abstract/Free Full Text]
  2. Nagler, D. K., and Menard, R. (1998) FEBS Lett. 434, 135-139[CrossRef][Medline] [Order article via Infotrieve]
  3. Nagler D. K., Zhang, R., Tam, W., Sulea, T., Purisima, E. O., and Menard, R. (1999) Biochemistry 38, 12648-12654[CrossRef][Medline] [Order article via Infotrieve]
  4. Guncar, G., Klemencic, I., Turk, B., Turk, V., Karaoglanovic-Carmona, A., Juliano, L., and Turk, D. (2000) Structure 8, 305-313[Medline] [Order article via Infotrieve]
  5. Falcone, F. H., Tetteh, K. K., Hunt, P., Blaxter, M. L., Loukas, A., and Maizels, R. M. (2000) Exp. Parasitol. 94, 201-207[CrossRef][Medline] [Order article via Infotrieve]
  6. Lustigman, S., McKerrow, J. H., Shah, K., Lui, J., Huima, T., Hough, M., and Brotman, B. (1996) J. Biol. Chem. 271, 30181-30189[Abstract/Free Full Text]
  7. Hashmi, S., Wilson, T., and Lustigman, S. (2001) Trends Parasitol. 17, 387-393[CrossRef][Medline] [Order article via Infotrieve]
  8. Burling, R. T., Lobos, E., and Blaxter, M. L. (1998) Int. J. Parasitol. 28, 395-411[CrossRef][Medline] [Order article via Infotrieve]
  9. Tort, J., Brindley, P. J., Knox, D., Wolfe, K. H., and Dalton, J. P. (1999) Adv. Parasitol. 48, 161-266
  10. Dalton, J. P., McGonigle, S., Rolph, T. P., and Andrew, S. J. (1996) Infect. Immun. 64, 5066-5074[Abstract]
  11. Altschul, S. F., Gish, W., Miller, W., Myers, E. W., and Lipman, D. J. (1990) J. Mol. Biol. 215, 403-410[CrossRef][Medline] [Order article via Infotrieve]
  12. Sulston, J., and Hodgkin, J. (1988) in The Nematode, Caenorhabditis elegans (Wood,. B., ed) pp. 587-606, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
  13. Johnstone, I. L., and Barry, J. D. (1996) EMBO J. 15, 3633-3639[Medline] [Order article via Infotrieve]
  14. Fire, A. (1986) EMBO J. 5, 2673-2680[Medline] [Order article via Infotrieve]
  15. Mello, C. C., Kramer, J. M., Stinchcomb, D., and Ambros, V. (1991) EMBO J. 10, 3959-3970[Medline] [Order article via Infotrieve]
  16. Kramer, J. M., French, R. P., Park, E. C., and Johnson, J. J. (1990) Mol. Cell Biol. 10, 2081-2089[Abstract/Free Full Text]
  17. Fire, A. (1992) Genet. Anal. Tech. Appl. 9, 151-158[Medline] [Order article via Infotrieve]
  18. Hashmi, S., Britton, C., Liu, J., Guiliano, D. B., Oksov, Y., and Lustigman, S. (2002) J. Biol. Chem. 277, 3477-3486[Abstract/Free Full Text]
  19. Fire, A., Xu, S., Montgomery, M. K., Kostas, S. A., Driver, S. E., and Mello, C. C. (1998) Nature 391, 806-811[CrossRef][Medline] [Order article via Infotrieve]
  20. Tabara, H., Grishok, A., and Mello, C. C. (1998) Science 282, 430-431[Free Full Text]
  21. Timmons, L., and Fire, A. (1998) Nature 395, 854[CrossRef][Medline] [Order article via Infotrieve]
  22. Kamath, R. S., Martinez-Campos, M., Zipperlen, P., Fraser, A. G., and Ahringer, J. (2000) Genome Biol. 2, 1-10[Medline] [Order article via Infotrieve]
  23. Bynum, J., Andrews, J. L., Ellis, B., Kull, F. C., Jr., Austin, E. A., and Kilpatrick, K. E. (1999) Hybridoma 18, 407-411[Medline] [Order article via Infotrieve]
  24. Kilpatrick, K. E., Wring, S. A., Walker, D. H., Macklin, M. D., Payne, J. A., Su, J. L., Champion, B. R., Caterson, B., and McIntyre, G. D. (1997) Hybridoma 16, 381-389[Medline] [Order article via Infotrieve]
  25. Kemphues, K. J., Wolf, N., Wood, W. B., and Hirsh, D. (1986) Dev. Biol. 113, 449-460[CrossRef][Medline] [Order article via Infotrieve]
  26. Lustigman, S., Brotman, B., Huima, T., Prince, A. M., and McKerrow, J. H. (1992) J. Biol. Chem. 267, 17339-17346[Abstract/Free Full Text]
  27. Radice, A. D., and Lustigman, S. (1996) Mol. Biochem. Parasitol. 80, 41-53[CrossRef][Medline] [Order article via Infotrieve]
  28. Liou, R. F., and Blumenthal, T. (1990) Mol. Cell Biol. 10, 1764-1768[Abstract/Free Full Text]
  29. Bird D. M., Riddle D. L. (1989) Mol. Cell Biol. 9, 4119-4130[Abstract/Free Full Text]
  30. Larminie, C. G., and Johnstone, I. L. (1996) DNA Cell Biol. 15, 75-82[Medline] [Order article via Infotrieve]
  31. Wood, W. B. (ed) (1988) The Nematode, Caenorhabditis elegans, pp. 215-241, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
  32. Singh, R. N., and Sulston, J. E. (1978) Nematologica 24, 63-71
  33. Cole, S. C., Jr., Charnley, A. K., and Cooper, R. M. (1993) FEMS Microbiol. Lett. 113, 189-196
  34. Samuels, R. I., and Paterson, I. C. (1995) Comp. Biochem. Physiol. 110B, 661-669
  35. Lee, D. L. (ed) (2002) The Biology of Nematodes, pp. 171-209, Taylor and Francis Inc., New York
  36. Yochem, J., Tuck, S., Greenwald, I., and Han, M. (1999) Development 126, 597-606[Abstract]
  37. Kramer, J. M. (1997) in C. elegans II (Riddle, D. L., Blumenthal, T., Meyer, B. J., and Priess, J. R., eds) pp. 471-500, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
  38. Lustigman, S. (1993) Parasitol. Today 9, 294-297[CrossRef][Medline] [Order article via Infotrieve]
  39. Davey, K. G., and Kan, S. P. (1968) Can. J. Zool. 46, 893-899[Medline] [Order article via Infotrieve]
  40. Hotez, P., Haggerty, J. Hawdon, J., Milstone, L., Gamble, H. R., Schad, G., and Richards, F. (1990) Infect. Immun. 58, 3883-3892[Abstract/Free Full Text]
  41. Gamble, H. R., Prucell, J. P., and Fetterer, R. H. (1989) Mol. Biochem. Parasitol. 33, 49-58[CrossRef][Medline] [Order article via Infotrieve]
  42. Gamble, H. R., Prucell, J. P., and Lichtenfels, J. R. (1989) J. Parasitol. 75, 303-307[CrossRef][Medline] [Order article via Infotrieve]
  43. Richter, J. K., Sakanari, J. A., Frank, G. R., and Grieve, R. B. (1992) Exp. Parasitol. 75, 213-222[CrossRef][Medline] [Order article via Infotrieve]
  44. Hong, X., Bouvier, J., Wong, M. M., Yamagata, G. Y., and McKerrow, J. H. (1993) Exp. Parasitol. 76, 127-133[CrossRef][Medline] [Order article via Infotrieve]
  45. Gissendanner, R., and Sluder, A. E. (2000) Dev. Biol. 221, 259-272[CrossRef][Medline] [Order article via Infotrieve]
  46. Asahina, M., Ishihara, T., Jindra, M., Kohara, Y., Katsura, I., and Hirose, S. (2000) Genes Cells 5, 711-723[Abstract]
  47. Kostrouchova, M., Krause, M., Kostrouch, Z., and Rall, J. E. (1998) Development 125, 1617-1626[Abstract]
  48. Kostrouchova, M., Krause, M., Kostrouch, Z., and Rall, J. E. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 7360-7365[Abstract/Free Full Text]
  49. Fraser, A. G., Kamath, R. S., Zipperlen, P., Martinez-Campos, M., Sohrmann, M., and Ahringer, J. (2000) Nature 408, 325-330[CrossRef][Medline] [Order article via Infotrieve]
  50. Gonczy, P., Echeverri, C., Oegema, K., Coulson, A., Jones, S. J., Copley, R. R., Duperon, J., Oegema, J., Brehm, M., Cassin, E., Hannak, E., Kirkham, M., Pichler, S., Flohrs, K., Goessen, A., Leidel, S., Alleaume, A. M., Martin, C., Ozlu, N., Bork, P., and Hyman, A. A. (2000) Nature 408, 331-336[CrossRef][Medline] [Order article via Infotrieve]
  51. Hill, A. A., Hunter, C. P., Tsung, B. T., Tucker-Kellogg, G., and Brown, E. L. (2000) Science 290, 809-812[Abstract/Free Full Text]
  52. Kim, S. K., Lund, J., Kiraly, M., Duke, K., Jiang, M., Stuart, J. M., Eizinger, A., Wylie, B. N., and Davidson, G. S. (2001) Science 293, 2087-2092[Abstract/Free Full Text]
  53. Stein, L., Sternberg, P., Durbin, R., Thierry-Mieg, J., and Spieth, J. (2001) Nucleic Acids Res. 29, 82-86[Abstract/Free Full Text]
  54. Cox, G. N., Laufer, J. S., Kusch, M., and Edgar, R. S. (1980) Genetics 95, 317-339[Abstract/Free Full Text]
  55. Cox, G. N., Kusch, M., and Edgar, R. S. (1981) J. Cell Biol. 90, 7-17[Abstract/Free Full Text]
  56. Cox, G. N., Staprans, S., and Edgar, R. S. (1981) Dev. Biol. 86, 456-470[CrossRef][Medline] [Order article via Infotrieve]
  57. Yang, J., and Kramer, J. M. (1999) J. Biol. Chem. 274, 32744-32749[Abstract/Free Full Text]
  58. Blelloch, R., Anna-Arriola, S. S., Gao, D., Li, Y., Hodgkin, J., and Kimble, J. (1999) Dev. Biol. 216, 382-393[CrossRef][Medline] [Order article via Infotrieve]
  59. Priess, J. R., and Hirsh, D. I. (1986) Dev. Biol. 117, 156-173[CrossRef][Medline] [Order article via Infotrieve]
  60. Williams-Masson, E. M., Malik, A. N., and Hardin, J. (1997) Development 124, 2889-2901[Abstract]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 GeneticsHome page
S. Liegeois, A. Benedetto, G. Michaux, G. Belliard, and M. Labouesse
Genes Required for Osmoregulation and Apical Secretion in Caenorhabditis elegans
Genetics, February 1, 2007; 175(2): 709 - 724.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
S. Hashmi, J. Zhang, Y. Oksov, Q. Ji, and S. Lustigman
The Caenorhabditis elegans CPI-2a Cystatin-like Inhibitor Has an Essential Regulatory Role during Oogenesis and Fertilization
J. Biol. Chem., September 22, 2006; 281(38): 28415 - 28429.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
L. Ford, D. B. Guiliano, Y. Oksov, A. K. Debnath, J. Liu, S. A. Williams, M. L. Blaxter, and S. Lustigman
Characterization of a Novel Filarial Serine Protease Inhibitor, Ov-SPI-1, from Onchocerca volvulus, with Potential Multifunctional Roles during Development of the Parasite
J. Biol. Chem., December 9, 2005; 280(49): 40845 - 40856.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
279/7/6035    most recent
M312346200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hashmi, S.
Right arrow Articles by Lustigman, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hashmi, S.
Right arrow Articles by Lustigman, S.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2004 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement