Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M307214200 on November 17, 2003

J. Biol. Chem., Vol. 279, Issue 8, 6720-6729, February 20, 2004
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
279/8/6720    most recent
M307214200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pham, V.
Right arrow Articles by Sexton, P. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pham, V.
Right arrow Articles by Sexton, P. M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Spatial Proximity between a Photolabile Residue in Position 19 of Salmon Calcitonin and the Amino Terminus of the Human Calcitonin Receptor*

Vi Pham, John D. Wade{ddagger}, Brooke W. Purdue, and Patrick M. Sexton, NHMRC senior research fellow§

From the Howard Florey Institute of Experimental Physiology and Medicine, the University of Melbourne, Victoria 3010, Australia

Received for publication, July 7, 2003 , and in revised form, October 23, 2003.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Calcitonins are 32-amino acid peptide hormones with both peripheral and central actions mediated via specific cell surface receptors, which belong to the class II subfamily of G protein-coupled receptors. Understanding receptor function, particularly in terms of ligand recognition by calcitonin receptors, may aid in the rational design of calcitonin analogs with increased potency and improved selectivity. To directly identify sites of proximity between calcitonin and its receptor, we carried out photoaffinity labeling studies followed by protein digestion and mapping of the radiolabeled photoconjugated receptor. A fully active salmon calcitonin analog [Arg11,18,Bpa19]sCT, incorporating a photolabile p-benzoyl-L-phenylalanine into position 19 of the ligand, has been used to demonstrate spatial proximity between residue 19 of the peptide and the amino-terminal extracellular domain of the receptor. Cyanogen bromide cleavage together with endoproteinase Asp-N digestion indicated that binding was predominantly to the region delimited by receptor residues Cys134 and Met187. Binding to this fragment was supported further by cyanogen bromide-digestion of receptors that were mutated to remove the predicted cleavage site at Met133 (M133A, M133L). Binding within the 54-amino acid fragment was refined further by digestion with endoproteinase Lys-C to the 8-amino acid region corresponding to Cys134–Lys141. These results provide the first direct demonstration of a contact domain between salmon calcitonin and its receptor and will contribute toward modeling of the calcitonin-receptor interface.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Calcitonins (CTs)1 are 32-amino acid peptide hormones, secreted from the thyroid gland, whose most recognized action is the inhibition of osteoclast-mediated bone resorption (1). Calcitonin receptors (CTRs), however, are expressed widely in both peripheral and central tissues, and CTs exert a wide range of actions including modulation of ion excretion in the kidney, inhibition of appetite, and gastric acid secretion via both peripheral and central mechanisms as well as affecting embryological implantation and development and sperm function (13). CTs, through their action on osteoclasts and to a lesser extent in the kidney, are widely used clinically in the treatment of bone-related disorders such as hypercalcemia of malignancy and osteoporosis but are most effective in conditions that have high bone turnover such as Paget's disease (1, 2).

CT peptides, derived from different species, fall into three broad classes according to structural and biological similarities: teleost/avian, exemplified by salmon CT (sCT); artiodactyl; and rodent/human. Of these, the teleost/avian class has the highest affinity and efficacy, although the relative potency of CTs varies according to the species of receptor under study (1, 4). As a consequence of its higher potency and in vivo stability, sCT is the most common form of CT used therapeutically.

The CTR is a member of the class II subfamily of G protein-coupled receptors, which includes the receptors for peptide hormones such as parathyroid hormone (PTH) and PTH-related protein, secretin, vasoactive intestinal polypeptide, and glucagons (5). These receptors exhibit homology with each other and have a number of common structural features including a large amino-terminal domain that contains at least one site of N-linked glycosylation and 6 conserved cysteines that yield a common pattern of disulfide bonding (6, 7). The human CTR has two common splice variants that differ by the absence or presence of a 16-amino acid insert in intracellular domain 1; these receptors have been designated hCTRa and hCTRb by the IUPHAR receptor nomenclature subcommittee (8). Of these two variants, hCTRa is the most prevalent isoform (810).

Little is known about the molecular nature of the interaction between CT and its receptor, with only limited data from NH2-terminal domain exchange chimeras between CTR and either the glucagon receptor (11, 12) or the PTH1 receptor (13). These have provided preliminary evidence for a prominent role for the NH2 terminus in high affinity ligand binding and for overlap in the mode of interaction between CT with its receptor and the interaction of other class II ligands and their receptors.

To provide direct information about the nature of the interface between peptides and their respective receptors, a number of laboratories have adopted a photoaffinity scanning approach that relies on the spatially restricted (within 3.1 Å) cross-linking of photolabile amino acids within peptide ligands and their cognate receptors (14). This approach has proved successful in providing constraints on the relative orientation of peptides and receptors for at least four class II peptide hormone receptors (1528).

In this study we have developed a photolabile derivative of sCT, substituted with p-benzoyl-L-phenylalanine (Bpa) at amino acid 19 for photoaffinity labeling of the hCTRa. Salmon CT was chosen as the template molecule because of its wide use clinically and its high affinity and efficacy at all CTRs (13). Using this molecule we have identified a short domain in the NH2 terminus of the receptor close to the transmembrane domain, delimited by Cys134 and Lys141, as the site of covalent interaction. The current work provides the first constraint in defining the interface between sCT and its receptor.


    EXPERIMENTAL PROCEDURES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Materials
Cyanogen bromide (CNBr), protein G-agarose beads, 3-isobutyl-1-methylxanthine, forskolin, dithiothreitol, and iodoacetamide were purchased from Sigma. Sequencing grade endoproteinases Lys-C and Asp-N, N-glycosidase F, and protease inhibitor mixture tablets were obtained from Roche Applied Science. Salmon CT and all amino acid derivatives were synthesized by Auspep (Parkville, Australia). Na125I(specific activity of 2,200 Ci/mmol) was from Amersham Biosciences. 125I-Goat anti-mouse immunoglobulin G antibody (specific activity 1,035 Ci/mmol) was obtained from PerkinElmer Life Sciences. Bovine serum albumin (BSA) was from ICN (Costa Mesa, CA). Penicillin G/streptomycin was from Multicell Technologies (Warwick, RI). Dulbecco's modified Eagle's medium, fetal bovine serum, HEPES, Fungizone, and trypsin together with LipofectAMINE reagents and protein molecular mass markers were from Invitrogen. Tissue culture disposables and plasticware were purchased from Falcon (Bedford, MA). 12CA5 mouse monoclonal antibody directed against the hemagglutinin (HA) epitope was purified from hybridoma cells via a Hi-Trap protein G column (Amersham Biosciences) according to the manufacturer's instructions.

Synthesis of the Photoactive Analog [Arg11,18,Bpa19]sCT(132) ([Bpa19]sCT)
Lysine residues at positions 11 and 18 in the native sCT sequence were replaced with arginines to render the ligand resistant to enzymatic cleavage by endoproteinase Lys-C; this substitution does not alter activity of the peptide (29). In general, the procedure for analog synthesis was as follows.

Solid Phase Peptide Synthesis—A 0.2-mmol scale was used with the continuous flow Fmoc-polyamide method and a MilliGen 9050 automated synthesizer as described previously (30). Fmoc-PAL-PEG-PS resin was used as the solid support to generate a COOH-terminal peptide-amide. Amino acid side chain protection was afforded by tert-butyl esters and ethers for Glu, Ser, Thr, and Tyr, trityl for Asn, Gln, His, and Cys, and 2,2,4,6,7-pentamethyldihydrobenzofuran-5-sulfonyl for Arg. Residue 19 was introduced manually via its Fmoc-p-benzoylphenyalanine derivative. All amino acid derivatives were activated in situ with 2-(1H-benzotrazole-1-yl)-1,1,3,3-tetramethylronium hexafluorophosphate/N,N'-diisoethylpropylamine in dimethyl formamide. Each acylation was of 30-min duration, and subsequent N{alpha}-Fmoc deprotection was with 20% piperidine in dimethyl formamide. After synthesis, the peptide was separately cleaved and deprotected by a 3-h treatment with 95% trifluoroacetic acid, 3% anisole, 1% triethylsilane, 1% phenol (v/v/v/w) at room temperature. The crude cleaved peptide was precipitated from ice-cold ether and freeze dried.

Folding and Oxidation—The crude S-reduced peptide was treated with 20% aqueous dimethyl sulfoxide in 5% aqueous acetic acid (31). Oxidation was monitored by analytical reversed phase high performance liquid chromatography (HPLC) on a Vydac C18 column (Hesperia) using a gradient of CH3CN in 0.1% aqueous trifluoroacetic acid for 21 h. The reaction was stopped by further acidification with neat trifluoroacetic acid. Peptide purification was by preparative reversed phase HPLC with a Vydac C18 column.

Characterization—Peptide purity was confirmed by analytical reversed phase HPLC and matrix-assisted laser desorption ionization time-of-flight mass spectrometry using a Bruker Biflex instrument (Bremen, Germany) in the linear mode at 19.5 kV. For peptide 1–32, calculated: MH+ 3,627.0; found: 3,628.2. Peptide quantitation was by amino acid analysis of a 24-h acid hydrolysate.

Radioiodination of Peptides
Radiolabeled sCT and [Bpa19]sCT (specific activity ~700 Ci/mmol) were prepared by the chloramine-T method as described previously (32). The iodinated peptides were purified using silica QUSO G32 (North America Silica Co.), washed twice with H2O, and eluted with 20% acetone and 1% acetic acid.

Receptor Mutagenesis and Construction of HA-tagged hCTR
cDNA of the hCTRa isoform was excised from the pZEM228cc expression vector (10) using the restriction enzymes HindIII and BamHI and subcloned into the multicloning site of the mammalian expression vector pcDNA3.1zeo+ (Invitrogen). The receptor was mutated to introduce a unique AgeI restriction site at amino acid 23, immediately following the predicted signal peptide cleavage site, using site-directed mutagenesis (QuikChange site-directed mutagenesis kit; Stratagene). To create NH2-terminal double epitope tags, complementary oligonucleotides that contained two HA epitope peptide sequences flanked by AgeI restriction sites, 5'-GCTGCTGCACCGGTCCCATATGATGTACCAGATTATGCACCAT ATGATGTACCAGATTATGCCACCGGTGCTGCTGCT-3' and 5'-AGCAGCAGCACC GGTGGCATAATCTGGTACATCATATGGTGCATAATCTGGTACATCATATGGGACCGGTGCAGCAGC-3', were annealed by heating at 95 °C, then gradually cooled and digested with AgeI restriction enzyme. The AgeI-digested double-stranded oligonucleotides were purified and ligated into AgeI-digested, mutated pCDNA3.1zeo+:hCTRa to generate the "wild-type HA-hCTRa" construct. At each step, the sequence integrity of the constructs was verified using PCR dideoxynucleotide chain termination sequencing.

The following point mutations were introduced, by QuikChange site-directed mutagenesis, into wild-type HA-hCTRa: L90M, V108M, V117M, M133A, M133L, C134A, N135A, A136V, F137A, T138A, P139A, E140A, K141A, M346L, and M367L. Selected clones were chosen for plasmid isolation (Qiagen; La Jolla, CA), and the presence of mutations was confirmed by nucleotide sequencing (Australian Genome Research Facility, Parkville, Australia).

Cell Cultures and DNA Transfections
COS-7 cells were routinely cultured in Dulbecco's modified Eagle's medium supplemented with 5% heat-inactivated fetal bovine serum, 100 units/ml penicillin and 100 µg/ml streptomycin, HEPES, and Fungizone at 37 °C in a humidified atmosphere of 95% air and 5% CO2. For radioligand receptor binding assay and analysis of cell surface receptor expression, COS-7 cells were seeded into 24-well plates. For cross-linking studies, COS-7 cells were grown in 6-well plates for small scale, and in 60-cm2 dishes or 140-cm2 dishes for large scale experiments. Once the cell monolayers were at 95% confluence, cells were transfected with LipofectAMINE using 100 ng, 500 ng, 3 µg, and 7 µg of plasmid DNA in 24-well plates, 6-well plates, 60-cm2 and 140-cm2 dishes, respectively according to the manufacturer's protocol. All transient transfections were performed with either wild-type or mutant HA-hCTRa.

Receptor Binding Assay
Transiently transfected COS-7 cells were grown to confluence in 24-well plates. The cells were incubated with either ~90 pM 125I-sCT or [125I-Bpa19]sCT in binding buffer (Dulbecco's modified Eagle's medium, 0.1% BSA) in the absence (total binding) or presence of varying concentrations of unlabeled peptides. Cells were incubated for 1 h at 37 °C and subsequently washed with phosphate-buffered saline and lysed with 1 M NaOH. The entire cell lysate was counted in a PerkinElmer Life Sciences {gamma}-irradiation counter to determine the bound radioactivity.

cAMP Assay
Intracellular cAMP assay was performed in 384-well plates using the Alpha Screen cAMP kit (PerkinElmer Life Sciences). In brief, transiently transfected COS-7 cells in 60-cm2 dishes were harvested, counted, and resuspended into stimulation buffer (phenol red free medium, 0.1% BSA, 1 mM 3-isobutyl-1-methylxanthine) and preincubated at 37 °C for ~20 min. Cells (10,000 cells/well) were then incubated at 37 °C for 30 min in the absence and presence of increasing concentration of agonists, either sCT or [Bpa19]sCT. After incubation, anti-cAMP acceptor beads that were prepared in lysis buffer (5 mM HEPES, 0.3% Tween 20, 0.1% BSA) were added to all wells and incubated at room temperature for 30 min in the dark. The detection mix of biotinylated cAMP/streptavidin donor beads, which was preincubated in the dark for 30 min at room temperature, was then added to all wells. The assay plate was incubated overnight at room temperature before reading on a Fusion plate reader (PerkinElmer Life Sciences). For each experiment, forskolin and cAMP dose-response curves were performed in parallel to allow translation of the {alpha}-screen signal to either cAMP or a percent of the maximum forskolin response.

Photoaffinity Cross-linking of [Bpa19]sCT to COS-7 Cells Transfected with HA-hCTRa
COS-7 cells transiently expressing wild-type or mutated receptors were incubated for 1 h in darkness with binding buffer (Dulbecco's modified Eagle's medium, 0.1% BSA) containing ~900 pM [125IBpa19]sCT/well in the presence (nonspecific binding) or absence (total binding) of 10-7 M [Bpa19]sCT. Cells were washed twice with cold 1 x phosphate-buffered saline to remove unbound ligand and then irradiated at a distance of ~ 5 cm with a 365-nm UV lamp on ice for 30 min. Lysis buffer (0.1 M Tris, 10 mM EDTA, pH 7.3) was then added, and the cells were scraped free of the culture plates and centrifuged at 1,800 x g for 10 min.

Immunoprecipitation
To remove potential contamination of signal arising from carry forward of noncovalently bound radioligand, cell lysates were subjected to immunoprecipitation according to the method of Sengstag et al. (33). For this, 2 µg of anti-HA antibody was incubated with each sample to precipitate the [125I-Bpa19]sCT·HA-hCTRa complex, with complexes subsequently isolated using protein G-Sepharose beads. For samples not subjected to enzymatic or chemical cleavage, the complexes were eluted directly from the beads using 1 x "reduced" SDS-sample buffer and the eluted proteins were immediately electrophoresed on 10% SDS-PAGE.

Reduction and Alkylation
When necessary, the samples were reduced with 0.5% SDS, 100 mM dithiothreitol, followed by alkylation with 100 mM iodoacetamide for 25 min at room temperature in the dark to break the disulfide bonds irreversibly.

Enzymatic and Chemical Cleavage of the Ligand-Receptor Conjugates
After immunoprecipitation, the ligand-receptor conjugates were subjected to enzymatic or chemical cleavage. For Endo-F deglycosylation, the bead samples were resuspended in 0.15 M Tris, pH 8.8, 1% Nonidet P-40, 0.1% SDS, 0.1% {beta}-mercaptoethanol containing 1 unit of N-glycosidase F. For endoproteinase Asp-N digestion, samples were incubated in 50 mM sodium phosphate buffer, pH 8.0, 0.1% SDS, containing 0.04 µg/µl Asp-N enzyme. For endoproteinase Lys-C digestion, samples were resuspended in 0.1 M Tris, pH 8.5, containing 0.1 µg/µl Lys-C enzyme. All enzyme-treated samples were incubated at 37 °C for 18 h. For CNBr cleavage, samples were incubated in 100 µl of 70% trifluoroacetic acid with 10 mg/ml CNBr for 24 h at room temperature, in darkness and under nitrogen. After the incubation period, samples were diluted 5-fold with H2O and dried using a vacuum concentrator. Samples were then redissolved in 500 µl of H2O and dried again.

Electrophoresis and Autoradiography
Radiolabeled samples were assessed using a combination of 10% SDS-PAGE and 16.5% SDS-Tricine or 10–20% SDS-Tricine (for low molecular mass proteins). After electrophoresis, gels were stained with Coomassie Blue R-250, destained, dried, and exposed to phosphorimaging screens (Fuji-Bas; Tokyo, Japan) for 1–5 days to identify radiolabeled fragments. The relative molecular mass (Mr) of the radiolabeled band was determined, by interpolation, on a plot of the mobility of protein standards versus the log values of their apparent molecular mass.

Cell Surface Expression of Mutated Receptors
Independent monitoring of the cell surface expression of wild-type and mutated HA-hCTRa, in intact COS-7 cells, was performed using the 12CA5 anti-HA antibody as described (34), with minor modifications. Transfected COS-7 cells were rinsed twice with binding buffer (50 mM Tris-HCl, pH 7.7, 100 mM NaCl, 5 mM KCl, 2 mM CaCl2, 1% BSA); cells were then incubated for 3 h at 4 °C with binding buffer alone, for nonspecific binding, and binding buffer containing HA-antibody (4 µg/well in 24-well plates) for total binding. Cells were rinsed twice and incubated further with 125I-goat anti-mouse immunoglobulin G antibody for 3 h at 4 °C. Cells were washed twice with phosphate-buffered saline and then lysed with 1 M NaOH. The whole cell lysate was counted in a PerkinElmer Life Sciences {gamma}-irradiation counter to determine the bound radioactivity. The specific binding of antibody to each mutant was calculated by subtracting the nonspecifically bound radioactivity from total binding.

Statistical Analysis
All experiments were repeated independently at least three times, unless otherwise indicated. The binding curves and cAMP dose-response data are expressed as the mean ± S.D. Data were analyzed using nonlinear regression with the Prism Software package (Graph-Pad Software, Inc., San Diego). Values in the tables are presented as mean ± S.E., unless otherwise indicated.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Pharmacological Characterization of [Bpa19]sCT—A photoactive analog of sCT, substituted with Bpa at position 19 [Bpa19]sCT was synthesized as a photoaffinity probe of the CTR. Evaluation of the interaction of this analog with the HA-hCTRa transiently transfected into COS-7 cells revealed similar affinity ([Bpa19]sCT, IC50 = 2.94 ± 0.46 nM versus sCT, IC50 = 2.07 ± 0.32 nM, n = 3) and efficacy (EC50 = 33.79 ± 16.81 pM versus 8.21 ± 3.84 pM, respectively, n = 3) to native sCT (Fig. 1, A and B). [125I-Bpa19]sCT also displayed similar affinity to the unlabeled peptide (IC50 = 3.56 ± 0.75 nM for sCT and 3.21 ± 0.34 nM for [Bpa19]sCT, n = 3, Fig. 1C). Therefore, this analog was suitable for photoaffinity labeling of the receptor and assessment of sites of proximity between residue 19 of the peptide and the receptor.



View larger version (14K):
[in this window]
[in a new window]
 
FIG. 1.
Biological assessment of the photoactive analog [Bpa19]sCT on COS-7 cells transiently expressing HA-hCTRa. A, radioligand binding assay showed that the analog [Bpa19]sCT ({blacktriangleup}) competed with radiolabeled 125I-sCT for binding to the receptor with similar affinity to the native peptide, sCT ({blacksquare}). B, dose-response curves for ligand-induced cAMP stimulation demonstrate that [Bpa19]sCT ({blacktriangleup}) is a potent agonist at HA-hCTRa, with efficacy similar to sCT ({blacksquare}). C, the analog ({blacktriangleup}) and parent peptide ({blacksquare}) compete for binding of [125IBpa19]sCT with very high affinity. All values are the mean ± S.D. of triplicate data from three independent experiments.

 
Photoaffinity Cross-linking of hCTRa with [125I-Bpa19]sCT— Cross-linking of [125I-Bpa19]sCT to intact COS-7 cells transiently expressing the HA-hCTRa revealed a single radiolabeled band of Mr ~72,000, and this band was shifted to Mr ~51,000 after treatment of the ligand-receptor complex with Endo-F to remove N-linked carbohydrate on the receptor NH2 terminus (Fig. 2). These bands are receptor-specific because they were not observed in the nontransfected cells and were completely inhibited by coincubation with excess unlabeled sCT (10-7 M) (Fig. 2). The receptor mass and level of glycosylation are consistent with the expected mass of the receptor and previously characterized level of receptor glycosylation (35). The cross-linked receptor-[125I-Bpa19]sCT conjugate was then subjected to a series of chemical and enzymatic cleavages to identify the site of covalent contact between the ligand and receptor.



View larger version (38K):
[in this window]
[in a new window]
 
FIG. 2.
Photoaffinity cross-linking of [125I-Bpa19]sCT to the hCTRa transiently transfected into COS-7 cells. [125I-Bpa19]sCT was cross-linked to hCTRa either alone or in the presence of unlabeled 10-7 M [Bpa19]sCT. After cross-linking and immunoprecipitation, the ligand-receptor complexes were treated with Endo-F and subsequently analyzed on a 10% SDS-polyacrylamide gel. Autoradiography revealed a radiolabeled band of Mr ~72,000 which was shifted to Mr ~51,000 upon deglycosylation as indicated by arrows. The low molecular mass standards (Bio-Rad) are shown at the left. The autoradiograph is a representative of more than three independent experiments.

 
The photolabeled HA-hCTRa was digested with CNBr, which cleaves at the COOH terminus of methionine residues, followed by resolution on an SDS-Tricine gel and autoradiography. One specifically labeled band of Mr ~9,300 was identified. Sequential digestion with Endo-F followed by CNBr did not alter the mobility of the Mr 9,000 fragment (Fig. 3). Possible candidate receptor fragments for this band included Lys23–Met48 (Mr ~4,800 including the HA tag), Cys134–Met187 (Mr ~6,000), Ile197–Met229 (Mr ~4,000), Ala307–Met327 (Mr ~2,500), and Ile347–Met367 (Mr ~2,500) (Fig. 4), given the molecular mass of the radiolabeled ligand (3.8 kDa).



View larger version (50K):
[in this window]
[in a new window]
 
FIG. 3.
CNBr cleavage and N-glycosidase-F digestion of ligand-receptor conjugates. Photoaffinity cross-linking of the probe [125IBpa19]sCT to the whole COS-7 cells transiently expressing HA-hCTRa was immunoprecipitated and then treated with Endo-F followed by CNBr. The radiolabeled protein was electrophoresed on a 16.5% SDSTricine gel. CNBr digestion of native receptor yielded a prominent fragment of Mr ~9,300. Sequential digestion with Endo-F followed by CNBr did not alter the mobility of the Mr 9,300 fragment. The See Blue molecular mass markers (Invitrogen) are shown at the left. The autoradiograph is a representative of more than three independent experiments.

 



View larger version (44K):
[in this window]
[in a new window]
 
FIG. 4.
Schematic diagram of the amino acid sequence of HA-hCTRa, including the predicted sites for CNBr digestion. Theoretically, CNBr digestion of the intact receptor, which cleaves at the COOH terminus of methionine residues (black circles), generates 16 fragments, 2 of which contain consensus sites for N-linked glycosylation (Y). The molecular mass of each CNBr-digested fragment is shown. The site of insertion of the double HA tag is also illustrated.

 
Immunoprecipitation of the [125I-Bpa19]sCT·HA-hCTRa complex after cleavage with CNBr did not precipitate a radioactive band, indicating that the far NH2-terminal end of the receptor was not a site of cross-linking (data not shown). Mutation of Met346 or Met367 to leucine, which did not alter either sCT binding or cell surface expression of the receptor, did not shift the migration of the lower molecular mass band, indicating that cross-linking did not occur within extracellular loop 3. However, mutation of Met133 to either leucine or alanine completely abolished the generation of the Mr 9,300 band, with a higher prominent radiolabeled fragment of Mr 20,000 formed following sequential digestion with Endo-F and CNBr (Fig. 5). This band, which was consistent with digestion around the Met133 site in the wild-type receptor, was equivalent in size to the two accumulated fragments, Gln60–Met133 (8.8 kDa) and Cys134–Met187 (6.1 kDa) (Fig. 4). In some experiments of the wild-type hCTR, digestion with CNBr was incomplete with weak bands of Mr 20,000 and Mr 40,000 (Endo-F-treated and untreated, respectively) seen in addition to the predominant band of Mr 9,300. These data suggested incomplete digestion around Met133 in these experiments and was consistent with data from L90M, V108M, and V117M mutants, which demonstrated progressive decreases in molecular mass of the incomplete digestion products (data not shown). Thus, [125IBpa19]sCT cross-links to a single CNBr-derived domain that is delimited by Cys134 and Met187.



View larger version (37K):
[in this window]
[in a new window]
 
FIG. 5.
CNBr cleavage and N-glycosidase-F digestion of ligand-mutated receptor conjugates. Photoaffinity cross-linked [125IBpa19]sCT in intact COS-7 cells transiently transfected with WT and mutated HA-hCTRa receptors was immunoprecipitated and treated with Endo-F followed by CNBr. The radiolabeled protein was electrophoresed on a 16.5% SDS-Tricine gel. CNBr cleavage of either mutated receptors M133A or M133L gave rise to a single band of Mr ~40,000. Receptor deglycosylation prior to CNBr cleavage shifted this band to Mr ~20,000. Mutation of Met133 to either leucine or alanine completely abolished the generation of the lower Mr 9,300 band, which was observed with the WT receptor. The See Blue molecular mass markers are shown at the left. The autoradiograph is a representative of more than three independent experiments.

 
To define and confirm further the binding domain of the [125I-Bpa19]sCT, the intact photolabeled HA-hCTRa was incubated with the enzyme Asp-N, which digests specifically at the NH2-terminal side of aspartic acid residues. Asp-N cleavage yielded two radiolabeled bands after resolution on SDS-Tricine gel: an Mr ~26,000 fragment in addition to a higher molecular mass band presumably resulting from incomplete digestion. When treated with Endo-F, the electrophoretic mobility of the Mr 26,000 band shifted to Mr ~12,000, demonstrating that it is glycosylated (Fig. 6). Only two Asp-N-generated domains on hCTRa contain glycosylation sites (Fig. 7). One comprises Asp57–Trp76 (Mr ~2,400) and is too small compared with the band size. The other region, Asp113–Arg214 is Mr ~12,000. The predicted mass for this fragment plus [125I-Bpa19]sCT (Mr ~16,000) is close to the observed electrophoretic mobility of the smallest fragment. Furthermore, this receptor segment is consistent with that identified from analysis of CNBr cleavage, supporting cross-linking of [125I-Bpa19]sCT to within Cys134 and Met187 of the receptor.



View larger version (53K):
[in this window]
[in a new window]
 
FIG. 6.
Endoproteinase Asp-N cleavage and N-glycosidase-F digestion of ligand-receptor conjugates. Photoaffinity cross-linked [125I-Bpa19]sCT in intact COS-7 cells transiently expressing HA-hCTRa was immunoprecipitated and then treated with Asp-N enzyme followed by Endo-F. The radiolabeled protein was electrophoresed on a 10–20% SDS-Tricine gel. Asp-N digestion yielded two radiolabeled bands, one migrating at Mr ~52,000 and the other at Mr ~26,000. After treating with Endo-F, these bands were shifted to Mr ~33,000 and Mr ~12,000, respectively. The See Blue molecular mass markers are shown at the left. The results shown are representative of at least three different experiments.

 



View larger version (40K):
[in this window]
[in a new window]
 
FIG. 7.
Schematic diagram of the amino acid sequence of HA-hCTRa, including the predicted sites for Endo-Asp-N digestion. Theoretically, Asp-N digestion of the intact receptor, which cleaves at the NH2 terminus of aspartic acid residues (black circles with the labeled numbers), would generate 14 fragments, 2 of which contain possible glycosylation sites (Y). The molecular mass of each Asp-N-digested fragment is shown. The site of insertion of the double HA tag is also illustrated.

 
Additional refinement of the interacting site was achieved via digestion of the ligand-receptor complex with the endoproteinase Lys-C, which cleaves at the COOH terminus of lysine residues. Digestion of the [125I-Bpa19]sCT·HA-hCTRa complex with Endo-Lys-C yielded an Mr ~20,000 fragment in addition to a higher molecular mass band resulting from incomplete digestion (Fig. 8). When treated with Endo-F, the electrophoretic mobility of the Mr 20,000 band shifted to Mr ~8,000 (Mr ~4,000 after subtracting the 3.8 kDa probe), demonstrating that it is glycosylated. Only two Endo-Lys-C-generated domains on HA-hCTRa contain glycosylation sites: Cys55–Lys107 (Mr ~5,900), which contains one glycosylation site, and His121–Lys141 (Mr ~2,300), which contains two glycosylation sites (Fig. 9), suggesting that the latter fragment is the probable site of cross-linking.



View larger version (64K):
[in this window]
[in a new window]
 
FIG. 8.
Endoproteinase-Lys-C cleavage and N-glycosidase-F digestion of ligand-receptor conjugates. Photoaffinity cross-linked [125I-Bpa19]sCT in intact COS-7 cells transiently expressing HA-hCTRa was immunoprecipitated and then treated with Endo-F, followed Endo-Lys-C enzyme. The radiolabeled protein was electrophoresed on a 16.5% SDS-Tricine gel. Endo-Lys-C digestion yielded two fragments, one migrating at approximately Mr 40,000 and the other at Mr ~20,000. When treated with Endo-F, these bands were shifted to Mr ~30,000 and Mr ~8,000, respectively. The See Blue molecular mass markers are shown at the left. The results shown are representative of three different experiments.

 



View larger version (41K):
[in this window]
[in a new window]
 
FIG. 9.
Schematic diagram of the amino acid sequence of HA-hCTRa, including the predicted sites for Endo-Lys-C digestion. Theoretically, Endo-Lys-C digestion of the intact receptor, which cleaves at the COOH terminus of lysine residues (black circles attached with the number) would generate 21 fragments, 2 of which contain possible glycosylation sites (Y). The molecular mass of each Lys-C-digested fragment is shown. The site of insertion of the double HA tag is also illustrated.

 
Taken together with the CNBr data, the results indicate that [Bpa19]sCT cross-links specifically to a site contained within the small receptor region delimited by residues Cys134 and Lys141 of hCTRa.

In an attempt to identify individual receptor amino acids involved in the cross-linking, this small region of the receptor was subjected to alanine scanning mutagenesis. Wild-type and mutant receptors were transiently transfected into COS-7 cells and assessed for cell surface expression, binding affinity, and functional response. With one exception, all mutants were fully expressed at the cell surface and displayed equivalent affinity for sCT in 125I-sCT competition binding studies (Table I). Likewise, there was little change in either EC50 (Table I) or Emax values (not shown) for sCT-mediated accumulation of cAMP. The exception to this was the C134A mutant, which was very poorly expressed at the cell surface and essentially did not bind or respond to sCT. Cysteine 134 is one of 6 highly conserved cysteine residues in the NH2 terminus of class II G protein-coupled receptors. Studies with other class II receptors have demonstrated that each of these cysteines forms a disulfide bond that is believed to maintain the topology required for ligand binding and for the receptor to be properly folded and expressed at the cell surface (34, 36, 37). Thus, lack of functionality of this mutant is not surprising. The data with the other mutants (N135A, A136V, F137A, T138A, P139A, E140A and K141A) demonstrate that conversion to alanine did not functionally affect ligand-receptor interaction. Photoaffinity cross-linking of [125I-Bpa19] sCT to each of the mutated receptors transiently expressed into COS-7 cells gave rise to a band of Mr ~75,000 (Fig. 10A), and subsequent digestion with CNBr resulted in a predominant band of Mr 9,300 (Fig. 10B). These radiolabeled fragments were not markedly different from the wild-type receptor, indicating that substitution of individual amino acids with alanine was not sufficient to alter the efficiency of cross-linking.


View this table:
[in this window]
[in a new window]
 
TABLE I
Effects of point mutations in hCTRa on 125I-sCT binding, cell surface receptor expression and sCT-induced cAMP response

All values are expressed as the mean ± S.E.

 



View larger version (74K):
[in this window]
[in a new window]
 
FIG. 10.
Photoaffinity cross-linking of [125I-Bpa19]sCT to either wild type-HA-hCTRa or mutated receptors (C134A, N135A, V136A, F137A, T138A, P139A, E140A, K141A) transiently transfected into COS-7 cells. A, after cross-linking, the cell lysate was immunoprecipitated and subsequently electrophoresed on a 10% SDS-polyacrylamide gel. The conjugates of ligand and mutated receptors revealed a band of Mr ~75,000, which was not observed in the nontransfected cells (NT). The Mr 75,000 band was not different from that seen with the wild-type (WT) receptor, indicating that substitution of individual amino acids with alanine was not sufficient to alter the efficiency of cross-linking. The low molecular mass standards (Bio-Rad) are shown at the left. The autoradiograph is a representative of two independent experiments. B, CNBr digestion of ligand-receptor conjugates resolved on a 16.5% SDS-Tricine gel yielded a prominent fragment of Mr ~9,300 for all alanine scanning mutants, which were not different from the digestion seen with the wild-type receptor, further emphasizing that substitution of individual amino acids with alanine was not sufficient to alter peptide binding. The location of the See Blue molecular mass markers is shown at the left. The autoradiograph is a representative of three independent experiments.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Three primary mechanisms are used to investigate the nature of ligand-receptor interaction: 1) alteration to ligand structure; 2) alteration to receptor structure (e.g. by mutation or formation of receptor chimeras or receptor truncation); and 3) physiochemical investigation of points of contact between the ligand and receptor. Although all three approaches provide potentially important information for understanding of how ligands interface with their receptors, the first two approaches have limitations in the interpretation of data because they can provide only indirect and inferential information about the nature of the bimolecular interaction and cannot precisely define the complementary domains in the apposing partner involved in the interaction. This is particularly true for ligands with diverse pharmacophores such as those for class II G protein-coupled receptors, where significant potential exists for conformational changes to affect sites distal to the point of modification. The third approach provides a mechanism for directly defining the ligand-receptor interface by using photo-active amino acid derivatives spaced along the peptide to define proximity of particular amino acids in the receptor and ligand. This approach has been used successfully in the study of class II receptors including the PTH1 and PTH2 receptors (1522), the secretin receptor (2327), and the vasoactive intestinal peptide/pituitary adenylate cyclase-activating peptide (VPAC1) receptor (28). The constraints provided by these studies have allowed preliminary models of ligand receptor interaction of the PTH1 and secretin receptors to be generated (38, 39), whereas the initial work with the VPAC1 receptor is generally supportive of homology modeling of the NH2-terminal domain of the receptor using a yeast lipase as template (28).

In this study we have generated an analog of sCT substituted at position 19 of its sequence with the photoactive Bpa moiety. CD and NMR analysis of sCT structure indicate that it forms an amphipathic {alpha}-helix between amino acids 8 and 22 (4043). Within this context, amino acid 19 is predicted to lie along the hydrophobic face of the helix, and substitution of leucine with the benzoyl-phenylalanine is unlikely to disrupt this structure. Earlier studies with ({epsilon}-p-benzoyl-benzoyl) lysine-substituted sCT analogs have demonstrated that substitution of amino acids 8, 16, and 19 can be tolerated without significant loss of binding affinity (44), but the utility of these analogs for delineation of binding domains has not been assessed. Pharmacological analysis of the Bpa19-substituted analog in the current study demonstrated that it also had similar affinity and only slightly reduced efficacy relative to the native sCT peptide. Photoaffinity cross-linking combined with chemical and enzymatic cleavage and receptor mutagenesis identified the site of cross-linking to the receptor as the fragment Cys134–Lys141. Delineation of the interaction site was problematic because of incomplete cleavage of the receptor with each of the digestion reagents, although this was less evident for CNBr digestion. Nonetheless, mutagenesis to introduce or remove methionine residues unambiguously placed the site of cross-linking within amino acids Cys134–Met187. Endo-Lys-C digestion refined this to amino acids 134–141. Potential reasons for the poor digestion may include steric masking of cleavage sites by surrounding amino acids, low protein solubility in strong dissociating agents (like trifluoroacetic acid), or, in the case of CNBr, oxidation of the methionine residues during protein manipulations (45). In addition, the NH2 terminus of the hCTRa (as with other class II receptors) contains 6 conserved cysteines that for PTH1 and corticotropin-releasing factor receptors have been shown to link via disulfide bonds (6, 7), and these are required for expression of functional receptors (34, 36, 37). The loss of cell surface receptor expression and functionality of the C134A mutant in the current study is consistent with these findings. Thus, the tight folding of the receptor NH2 terminus may provide steric hindrance to efficient cleavage at some sites, although, in our hands, reduction and alkylation (not shown) did not improve cleavage efficiency. Salmon CT, when binding to the hCTRa receptor, forms a quasi-irreversible interaction with the receptor over time (46). Although this binding is reversed under acidic conditions, when covalently bound to the receptor, it is possible that sCT derivatives maintain a degree of conformational constraint on the receptor leading to lower efficiency of receptor cleavage.

Further analysis of the Cys134–Lys141 receptor subdomain via alanine scanning mutagenesis failed to identify specifically the primary site of cross-linking. The lack of resolution with this methodology is not necessarily surprising. The accommodation of the larger Bpa moiety in place of leucine 19, without significant loss of affinity, implies a degree of conformational flexibility within the receptor domain that interfaces with this part of the peptide. Mutation of the native amino acids in the receptor sequence to alanine may have allowed adjacent amino acids to have greater proximity to Bpa19 of the peptide with consequent maintenance of cross-linking efficiency. In studies of the interaction of [Bpa23]PTH (136) with the PTH1 receptor, alanine scanning mutagenesis of the receptor domain involved in cross-linking also failed to abolish photolabeling (21); however, in this case mutation of 2 of the amino acids caused modulation of ligand binding, implicating these receptor residues as important functional contact sites for PTH-related protein (21). In our study, no significant shift in binding affinity was observed, indicating that sCT does not form functionally important contacts with this part of the receptor. Recent work by Dong and colleagues2 with a Bpa16 analog of hCT has shown that amino acid 16 has spatial proximity to Phe137 of the hCTRa, which lies within the short domain that we identified as the site of interaction of [Bpa19]sCT. The close proximity in the position of covalent cross-linking between amino acids 16 and 19 of the CT peptides is consistent with their location ~1 turn apart within the predicted {alpha}-helical domain of the peptides (42, 43). A similar observation was made for the spatial proximity sites of Bpa18- and Bpa22-substituted secretins, which are also predicted on NMR structure (47, 48) to lie ~1 helical turn apart. These analogs interacted with arginine 14 and leucine 17 of the secretin receptor, respectively (25, 26).

There is little direct information available on the mechanism underlying the interaction of CT with its receptor, with most information deriving from studies of chimeras between CT receptors and either the glucagon receptor (11, 12) or the PTH1 receptor (13). NH2-terminal domain exchange between the glucagon receptor and hCTRa confirmed that the NH2-terminal domain is the principal high affinity binding domain of the receptor (11), and this is consistent with other class II peptide hormone receptors (4953); however, receptor activation requires interaction with the receptor trunk (transmembrane domains and extracellular loops), and this can occur independently of the NH2-terminal domain and demonstrable radioligand binding (11). Using the glucagon-hCTRa NH2-terminal domain swap chimeras, Stroop and colleagues (12) also provided evidence that the {alpha}-helical domain of the CT peptide interacts directly with the receptor NH2 terminus. Our data with the [Bpa19]sCT analog and the data of Dong and colleagues with the [Bpa16]hCT analog2 provide direct support for this mode of ligand receptor interaction. Chimeras between the CTR and PTH1 receptor provide additional evidence for conservation in the mode of ligand-receptor interaction for these class II receptors (13); NH2-terminal domain exchange of these two receptors led to a significant loss of interaction with the "native" CT and PTH peptides that was recovered with chimeric sCT/PTH peptides. Chimeric sCT/hCT peptides have demonstrated that the higher affinity of sCT in binding to the CTRs involves residues within the COOH terminus (amino acids 22–32) of the peptide (4). Amino acids within this domain likely interact with both the NH2 terminus (as this domain is required for high affinity binding), and also with the receptor trunk because sCT (832) potently antagonizes agonist responses in the hCTRa chimera incorporating the glucagon NH2 terminus (11). Further photoaffinity scanning analyses are required to test these hypotheses empirically and to provide a more detailed model of CT-receptor interaction.

In conclusion, we have identified a short segment of the hCTRa, close to the border with transmembrane domain 1, which is proximal to amino acid 19 of sCT. The work provides a valuable constraint for molecular modeling of the interface between sCT and its receptor. Further work is required to identify additional constraints that will enable the generation of a working model of CT-receptor interaction and to determine the degree to which the mode of interaction of class II peptide ligands and their cognate receptors overlaps.


    FOOTNOTES
 
* This study was supported by National Health and Medical Research Council Project Grant 145703. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

{ddagger} NHMRC principal research fellow. Back

§ To whom correspondence should be addressed: Howard Florey Institute, University of Melbourne, Gate 11, Royal Parade, Parkville, Victoria 3010, Australia. Fax: 61-3-9348-1707; E-mail: p.sexton{at}hfi.unimelb.edu.au.

1 The abbreviations used are: CT(s), calcitonin(s); Bpa, p-benzoyl-L-phenylalanine; [Bpa19]sCT, [Arg11,18,Bpa19]sCT(132); BSA, bovine serum albumin; CTR, calcitonin receptor; Endo-F, endoglycosidase F; Fmoc, N-(9-fluorenyl)methoxycarbonyl; HA, hemagglutinin; hCTR, human calcitonin receptor; HPLC, high performance liquid chromatography; PTH, parathyroid hormone; sCT, salmon calcitonin; Tricine, N-[2-hydroxy-1,1-bis(hydroxymethyl)ethyl]glycine. Back

2 Dong, M., Pinon, D. I., Cox, R. F., and Miller, L. J. (2004) J. Biol. Chem. 279, 1167–1175. Back


    ACKNOWLEDGMENTS
 
We thank Drs. Michael Chorev and Larry Miller for helpful advice.



    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Sexton, P. M., Findlay, D. M., and Martin, T. J. (1999) Curr. Med. Chem. 6, 1067-1093[Medline] [Order article via Infotrieve]
  2. Pondel, M. (2000) Int. J. Exp. Pathol. 81, 405-422[CrossRef][Medline] [Order article via Infotrieve]
  3. Purdue, B. W., Tilakaratne, N., and Sexton, P. M. (2002) Receptors Channels 8, 243-255[CrossRef][Medline] [Order article via Infotrieve]
  4. Houssami, S., Findlay, D. M., Brady, C. L., Martin, T. J., Epand, R. M., Moore, E. E., Murayama, E., Tamura, T., Orlowski, R. C., and Sexton, P. M. (1995) Mol. Pharmacol. 47, 798-809[Abstract]
  5. Sexton, P. M. (ed.) (2002) Receptors Channels 8, 135-255[CrossRef][Medline] [Order article via Infotrieve]
  6. Grauschopf, U., Lilie, H., Honold, K., Wozny, M., Reusch, D., Esswein, A., Schafer, W., Rucknagel, K. P., and Rudolph, R. (2000) Biochemistry 39, 8878-8887[CrossRef][Medline] [Order article via Infotrieve]
  7. Perrin, M. H., Fischer, W. H., Kunitake, K. S., Craig, A. G., Koerber, S. C., Cervini, L. A., Rivier, J. E., Groppe, J. C., Greenwald, J., Moller Nielsen, S., and Vale, W. W. (2001) J. Biol. Chem. 276, 31528-31534[Abstract/Free Full Text]
  8. Poyner, D. R., Sexton, P. M., Marshall, I., Quirion, R., Kangawa, K., Born, W., Fischer, J. A., Muff, R., Smith, D. M., and Foord, S. M. (2002) Pharmacol. Rev. 54, 233-246[Abstract/Free Full Text]
  9. Gorn, A. H., Rudolph, S. M., Flannery, M. R., Morton, C. C., Weremowicz, S., Wang, T. Z., Krane, S. M., and Goldring, S. R. (1995) J. Clin. Invest. 95, 2680-2691[Medline] [Order article via Infotrieve]
  10. Kuestner, R. E., Elrod, R. D., Grant, F. J., Hagen, F. S., Kuijper, J. L., Matthewes, S. L., O'Hara, P. J., Sheppard, P. O., Stroop, S. D., Thompson, D. L., Whitmore, T., Findlay, D. M., Houssami, S., Sexton, P. M., and Moore, E. E. (1994) Mol. Pharmacol. 46, 246-255[Abstract]
  11. Stroop, S. D., Kuestner, R. E., Serwold, T. F., Chen, L., and Moore, E. E. (1995) Biochemistry 34, 1050-1057[CrossRef][Medline] [Order article via Infotrieve]
  12. Stroop, S. D., Nakamuta, H., Kuestner, R. E., Moore, E. E., and Epand, R. M. (1996) Endocrinology 137, 4752-4756[Abstract]
  13. Bergwitz, C., Gardella, T. J., Flannery, M. R., Potts, J. T., Jr., Kronenberg, H. M., Goldring, S. R., and Juppner, H. (1996) J. Biol. Chem. 271, 26469-26472[Abstract/Free Full Text]
  14. Dorman, G., and Prestwich, G. D. (1994) Biochemistry 33, 5661-5673[CrossRef][Medline] [Order article via Infotrieve]
  15. Adams, A. E., Bisello, A., Chorev, M., Rosenblatt, M., and Suva, L. J. (1998) Mol. Endocrinol. 12, 1673-1683[Abstract/Free Full Text]
  16. Greenberg, Z., Bisello, A., Mierke, D. F., Rosenblatt, M., and Chorev, M. (2000) Biochemistry 39, 8142-8152[CrossRef][Medline] [Order article via Infotrieve]
  17. Gensure, R. C., Carter, P. H., Petroni, B. D., Juppner, H., and Gardella, T. J. (2001) J. Biol. Chem. 276, 42692-42699[Abstract/Free Full Text]
  18. Behar, V., Bisello, A., Bitan, G., Rosenblatt, M., and Chorev, M. (2000) J. Biol. Chem. 275, 9-17[Abstract/Free Full Text]
  19. Bisello, A., Adams, A. E., Mierke, D. F., Pellegrini, M., Rosenblatt, M., Suva, L. J., and Chorev, M. (1998) J. Biol. Chem. 273, 22498-22505[Abstract/Free Full Text]
  20. Gensure, R. C., Gardella, T. J., and Juppner, H. (2001) J. Biol. Chem. 276, 28650-28658[Abstract/Free Full Text]
  21. Mannstadt, M., Luck, M. D., Gardella, T. J., and Juppner, H. (1998) J. Biol. Chem. 273, 16890-16896[Abstract/Free Full Text]
  22. Zhou, A. T., Bessalle, R., Bisello, A., Nakamoto, C., Rosenblatt, M., Suva, L. J., and Chorev, M. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 3644-3649[Abstract/Free Full Text]
  23. Dong, M., Wang, Y., Hadac, E. M., Pinon, D. I., Holicky, E., and Miller, L. J. (1999) J. Biol. Chem. 274, 19161-19167[Abstract/Free Full Text]
  24. Dong, M., Wang, Y., Pinon, D. I., Hadac, E. M., and Miller, L. J. (1999) J. Biol. Chem. 274, 903-909[Abstract/Free Full Text]
  25. Dong, M., Asmann, Y. W., Zang, M., Pinon, D. I., and Miller, L. J. (2000) J. Biol. Chem. 275, 26032-26039[Abstract/Free Full Text]
  26. Dong, M., Zang, M., Pinon, D. I., Li, Z., Lybrand, T. P., and Miller, L. J. (2002) Mol. Endocrinol. 16, 2490-2501[Abstract/Free Full Text]
  27. Zang, M., Dong, M., Pinon, D. I., Ding, X. Q., Hadac, E. M., Li, Z., Lybrand, T. P., and Miller, L. J. (2003) Mol. Pharmacol. 63, 993-1001[Abstract/Free Full Text]
  28. Tan, Y.-V., Couvineau, A., Van Rampelbergh, J., and Laburthe, M. (2003) J. Biol. Chem. 278, 36531-36536[Abstract/Free Full Text]
  29. D'Santos, C. S., Nicholson, G. C., Moseley, J. M., Evans, T., Martin, T. J., and Kemp, B. E. (1988) Endocrinology 123, 1483-1488[Abstract/Free Full Text]
  30. Dawson, N. F., Macris, M., Tan, Y.-Y., Summers, R. J., Tregear, G. T., and Wade, J. D. (1999) J. Peptide Res. 53, 542-547[CrossRef][Medline] [Order article via Infotrieve]
  31. Tam, J. P., Wu, C.-R., Liu, W., and Zhang, J.-W. (1991) J. Am. Chem. Soc. 113, 6657-6662[CrossRef]
  32. Nicholson, G. C., Moseley, J. M., Sexton, P. M., Mendelsohn, F. A. O., and Martin, T. J. (1986) J. Clin. Invest. 78, 355-360[Medline] [Order article via Infotrieve]
  33. Sengstag, C., Stirling, C., Schekman, R., and Rine, J. (1990) Mol. Cell. Biol. 10, 672-680[Abstract/Free Full Text]
  34. Lee, C., Gardella, T. J., Abou-Samra, A. B., Nussbaum, S. R., Segre, G. V., Potts, J. T., Jr., Kronenberg, H. M., and Juppner, H. (1994) Endocrinology 135, 1488-1495[Abstract]
  35. Quiza, M., Dowton, M., Perry, K. J., and Sexton, P. M. (1997) Endocrinology 138, 530-539[Abstract/Free Full Text]
  36. Vilardaga, J. P., Di Paolo, E., Bialek, C., De Neef, P., Waelbroeck, M., Bollen, A., and Robberecht, P. (1997) Eur. J. Biochem. 246, 173-180[Medline] [Order article via Infotrieve]
  37. Asmann, Y. W., Dong, M., Ganguli, S., Hadac, E. M., and Miller, L. J. (2000) Mol. Pharmacol. 58, 911-919[Abstract/Free Full Text]
  38. Dong, M., and Miller, L. J. (2002) Receptors Channels 8, 189-200[CrossRef][Medline] [Order article via Infotrieve]
  39. Chorev, M. (2002) Receptors Channels 8, 219-242[CrossRef][Medline] [Order article via Infotrieve]
  40. Epand, R. M., Epand, R. F., and Orlowski, R. C. (1988) Biochem. Biophys. Res. Commun. 152, 203-207[Medline] [Order article via Infotrieve]
  41. Epand, R. M., Epand, R. F., and Orlowski, R. C. (1985) Int. J. Pept. Protein Res. 25, 105-111[Medline] [Order article via Infotrieve]
  42. Meadows, R. P., Nikonowicz, E. P., Jones, C. R., Bastian, J. W., and Gorenstein, D. G. (1991) Biochemistry 30, 1247-1254[CrossRef][Medline] [Order article via Infotrieve]
  43. Amodeo, P., Motta, A., Strazzullo, G., and Castiglione Morelli, M. A. (1999) J. Biomol. NMR 13, 161-174[CrossRef][Medline] [Order article via Infotrieve]
  44. Suva, L. J., Flannery, M. S., Caulfield, M. P., Findlay, D. M., Juppner, H., Goldring, S. R., Rosenblatt, M., and Chorev, M. (1997) J. Pharmacol. Exp. Ther. 283, 876-884[Abstract/Free Full Text]
  45. Servant, G., Laporte, S. A., Leduc, R., Escher, E., and Guillemette, G. (1997) J. Biol. Chem. 272, 8653-8659[Abstract/Free Full Text]
  46. Hilton, J. M., Dowton, M., Houssami, S., and Sexton, P. M. (2000) J. Endocrinol. 166, 213-226[Abstract]
  47. Gronenborn, A. M., Bovermann, G., and Clore, G. M. (1987) FEBS Lett. 215, 88-94[CrossRef][Medline] [Order article via Infotrieve]
  48. Clore, G. M., Nilges, M., Brunger, A., and Gronenborn, A. M. (1988) Eur. J. Biochem. 171, 479-484[Medline] [Order article via Infotrieve]
  49. Gelling, R. W., Wheeler, M. B., Xue, J., Gyomorey, S., Nian, C., Pederson, R. A., and McIntosh, C. H. (1997) Endocrinology 138, 2640-2643[Abstract/Free Full Text]
  50. Holtmann, M. H., Hadac, E. M., and Miller, L. J. (1995) J. Biol. Chem. 270, 14394-14398[Abstract/Free Full Text]
  51. Olde, B., Sabirsh, A., and Owman, C. (1998) J. Mol. Neurosci. 11, 127-134[Medline] [Order article via Infotrieve]
  52. Perrin, M. H., Sutton, S., Bain, D. L., Berggren, W. T., and Vale, W. W. (1998) Endocrinology 139, 566-570[Abstract/Free Full Text]
  53. Sydow, S., Flaccus, A., Fischer, A., and Spiess, J. (1999) Eur. J. Biochem. 259, 55-62[Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
EndocrinologyHome page
M. Morfis, N. Tilakaratne, S. G. B. Furness, G. Christopoulos, T. D. Werry, A. Christopoulos, and P. M. Sexton
Receptor Activity-Modifying Proteins Differentially Modulate the G Protein-Coupling Efficiency of Amylin Receptors
Endocrinology, November 1, 2008; 149(11): 5423 - 5431.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
T. Qi, G. Christopoulos, R. J. Bailey, A. Christopoulos, P. M. Sexton, and D. L. Hay
Identification of N-Terminal Receptor Activity-Modifying Protein Residues Important for Calcitonin Gene-Related Peptide, Adrenomedullin, and Amylin Receptor Function
Mol. Pharmacol., October 1, 2008; 74(4): 1059 - 1071.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
M. Dong, P. C.-H. Lam, F. Gao, K. Hosohata, D. I. Pinon, P. M. Sexton, R. Abagyan, and L. J. Miller
Molecular Approximations between Residues 21 and 23 of Secretin and Its Receptor: Development of a Model for Peptide Docking with the Amino Terminus of the Secretin Receptor
Mol. Pharmacol., August 1, 2007; 72(2): 280 - 290.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
D. L. Hay, G. Christopoulos, A. Christopoulos, and P. M. Sexton

Mol. Pharmacol., December 1, 2006; 70(6): 1984 - 1991.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
M. Udawela, G. Christopoulos, M. Morfis, A. Christopoulos, S. Ye, N. Tilakaratne, and P. M. Sexton
A Critical Role for the Short Intracellular C Terminus in Receptor Activity-Modifying Protein Function
Mol. Pharmacol., November 1, 2006; 70(5): 1750 - 1760.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
G. Andreotti, B. L. Mendez, P. Amodeo, M. A. C. Morelli, H. Nakamuta, and A. Motta
Structural Determinants of Salmon Calcitonin Bioactivity: THE ROLE OF THE LEU-BASED AMPHIPATHIC {alpha}-HELIX
J. Biol. Chem., August 25, 2006; 281(34): 24193 - 24203.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
M. Dong, D. I. Pinon, Y. W. Asmann, and L. J. Miller
Possible Endogenous Agonist Mechanism for the Activation of Secretin Family G Protein-Coupled Receptors
Mol. Pharmacol., July 1, 2006; 70(1): 206 - 213.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
M. Udawela, G. Christopoulos, N. Tilakaratne, A. Christopoulos, A. Albiston, and P. M. Sexton
Distinct Receptor Activity-Modifying Protein Domains Differentially Modulate Interaction with Calcitonin Receptors
Mol. Pharmacol., June 1, 2006; 69(6): 1984 - 1989.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
T. Dean, A. Linglart, M. J. Mahon, M. Bastepe, H. Juppner, J. T. Potts Jr., and T. J. Gardella
Mechanisms of Ligand Binding to the Parathyroid Hormone (PTH)/PTH-Related Protein Receptor: Selectivity of a Modified PTH(1-15) Radioligand for G{alpha}S-Coupled Receptor Conformations
Mol. Endocrinol., April 1, 2006; 20(4): 931 - 943.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
V. Pham, M. Dong, J. D. Wade, L. J. Miller, C. J. Morton, H.-l. Ng, M. W. Parker, and P. M. Sexton
Insights into Interactions between the {alpha}-Helical Region of the Salmon Calcitonin Antagonists and the Human Calcitonin Receptor using Photoaffinity Labeling
J. Biol. Chem., August 5, 2005; 280(31): 28610 - 28622.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
M. Dong, D. I. Pinon, and L. J. Miller
Insights into the Structure and Molecular Basis of Ligand Docking to the G Protein-Coupled Secretin Receptor Using Charge-Modified Amino-Terminal Agonist Probes
Mol. Endocrinol., July 1, 2005; 19(7): 1821 - 1836.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
D. L. Hay, G. Christopoulos, A. Christopoulos, D. R. Poyner, and P. M. Sexton
Pharmacological Discrimination of Calcitonin Receptor: Receptor Activity-Modifying Protein Complexes
Mol. Pharmacol., May 1, 2005; 67(5): 1655 - 1665.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Shimizu, T. Dean, J. C. Tsang, A. Khatri, J. T Potts Jr, and T. J. Gardella
Novel Parathyroid Hormone (PTH) Antagonists That Bind to the Juxtamembrane Portion of the PTH/PTH-related Protein Receptor
J. Biol. Chem., January 21, 2005; 280(3): 1797 - 1807.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Dong, D. I. Pinon, R. F. Cox, and L. J. Miller
Molecular Approximation between a Residue in the Amino-terminal Region of Calcitonin and the Third Extracellular Loop of the Class B G Protein-coupled Calcitonin Receptor
J. Biol. Chem., July 23, 2004; 279(30): 31177 - 31182.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
279/8/6720    most recent
M307214200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pham, V.
Right arrow Articles by Sexton, P. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pham, V.
Right arrow Articles by Sexton, P. M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2004 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement