Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M409920200 on October 28, 2004

J. Biol. Chem., Vol. 280, Issue 1, 261-269, January 7, 2005
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
280/1/261    most recent
M409920200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Buck, T. M.
Right arrow Articles by Skach, W. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Buck, T. M.
Right arrow Articles by Skach, W. R.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Differential Stability of Biogenesis Intermediates Reveals a Common Pathway for Aquaporin-1 Topological Maturation*

Teresa M. Buck and William R. Skach{ddagger}

From the Molecular Medicine Division, Department of Medicine, Oregon Health Sciences University, Portland, Oregon 97201

Received for publication, August 30, 2004 , and in revised form, October 27, 2004.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Topological studies of multi-spanning membrane proteins commonly use sequentially truncated proteins fused to a C-terminal translocation reporter to deduce transmembrane (TM) segment orientation and key biogenesis events. Because these truncated proteins represent an incomplete stage of synthesis, they transiently populate intermediate folding states that may or may not reflect topology of the mature protein. For example, in Xenopus oocytes, the aquaporin-1 (AQP1) water channel is cotranslationally directed into a four membrane-spanning intermediate, which matures into the six membrane-spanning topology at a late stage of synthesis (Skach, W. R., Shi, L. B., Calayag, M. C., Frigeri, A., Lingappa, V. R., and Verkman, A. S. (1994) J. Cell Biol. 125, 803–815 and Lu, Y., Turnbull, I. R., Bragin, A., Carveth, K., Verkman, A. S., and Skach, W. R. (2000) Mol. Biol. Cell 11, 2973–2985). The hallmark of this process is that TM3 initially acquires an Nexo/Ccyto (Type I) topology and must rotate 180° to acquire its mature orientation. In contrast, recent studies in HEK-293 cells have suggested that TM3 acquires its mature topology cotranslationally without the need for reorientation (Dohke, Y., and Turner, R. J. (2002) J. Biol. Chem. 277, 15215–15219). Here we re-examine AQP1 biogenesis and show that irrespective of the reporter or fusion site used, oocytes and mammalian cells yielded similar topologic results. AQP1 intermediates containing the first three TM segments generated two distinct cohorts of polypeptides in which TM3 spanned the ER membrane in either an Ncyto/Cexo (mature) or Nexo/Ccyto (immature) topology. Pulse-chase analyses revealed that the immature form was predominant immediately after synthesis but that it was rapidly degraded via the proteasome-mediated endoplasmic reticulum associated degradation (ERAD) pathway with a half-life of less than 25 min in HEK cells. As a result, the mature topology predominated at later time points. We conclude that (i) differential stability of biogenesis intermediates is an important factor for in vivo topological analysis of truncated chimeric proteins and (ii) cotranslational events of AQP1 biogenesis reflect a common AQP1 folding pathway in diverse expression systems.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Polytopic membrane proteins are synthesized and oriented in the endoplasmic reticulum (ER)1 by the ribosome and Sec61 translocon complex (1–3). In the simplest model, topology of each transmembrane (TM) segment is established in a vectoral and sequential manner (N to C termini) (4) as independent signal anchor and stop transfer sequences alternately gate the translocon and the ribosome-translocon junction and direct TM segment integration into the lipid bilayer (cotranslational model) (5–7). However, a growing body of evidence has demonstrated that the final topology of many native proteins is not necessarily established cotranslationally but rather through cooperative interactions between topogenic determinants (TM segments) located within different regions of the polypeptide (post-translational model) (8–16).

One example of the post-translational model occurs during the biogenesis of aquaporin-1 (AQP1), a hydrophobic membrane protein of ~29 kDa that exists as a homo-tetramer in cell membranes. AQP1 is a member of the MIP (major intrinsic protein) family (17, 18). In its mature form it exhibits a characteristic topology with six TM segments and two additional short helical regions flanked by conserved NPA motifs that fold inward within the plane of the membrane to form a monomeric, water-selective pore (19, 20). AQP1 is expressed in diverse cell types and is localized in the kidney to the proximal tubule and descending limb of the loop of Henle where it plays a major role in renal water reabsorption (18, 21).

Early biogenesis studies of AQP1 in cell-free systems and microinjected Xenopus oocytes revealed a novel mechanism in which only four of its six transmembrane segments cotranslationally acquired a membrane spanning topology (22). This four-spanning intermediate later matures in the ER membrane to form the final six-spanning structure (23, 24). AQP1 biogenesis differs from the cotranslational pathway utilized by a close homolog, AQP4 (25), in part because hydrophilic residues within the N terminus of TM2 (Asn49 and Lys51) disrupt stop transfer sequence and allow TM2 to transiently pass through the translocon and into the ER lumen (24). As a result, when TM3 emerges from the ribosome, it acts as a stop transfer sequence to terminate translocation and cotranslationally adopt an Nexo/Ccyto (Type I) topology. A four-spanning intermediate is synthesized because TM4 does not reinitiate translocation, and TM5 and TM6 act as signal and stop transfer sequences, respectively (see Fig. 1A). The defining feature of this folding intermediate is that TM3 is initially oriented with its C terminus positioned in the cytosol. In Xenopus oocytes, TM3 topology is "corrected," because it rotates 180° about the plane of the membrane to acquire its mature topology during a later stage or following the completion of AQP1 synthesis (23).



View larger version (27K):
[in this window]
[in a new window]
  		FIG. 1.
Two models for AQP1 biogenesis. Topology of reporter fusion sites used for experiments in Xenopus oocytes (A) and HEK-293 cells (B) are indicated. Fusion sites in which topology differs between these systems are shown in black, whereas fusion sites with the same topology are shown in gray. In oocytes AQP1 is initially synthesized as a four-spanning intermediate that is converted into the mature six-spanning form. In HEK-293 cells the reporter did not identify the immature topology (26).

 
Recent work has suggested that the AQP1 biogenesis pathway may be dependent on cell type (26). A study by the Turner group (26) examined the topology of truncated constructs in which variable numbers of AQP1 TM segments were placed into a chimeric protein containing N- and C-terminal reporter domains derived from EGFP and the {beta}-subunit of the H/K-ATPase, respectively. The topology of TM segments was inferred by N-linked glycosylation of the C-terminal reporter in intact HEK-293 cells. In contrast to results in oocytes, the Turner group found that TM3 had already acquired its mature Ncyt/Cexo topology (e.g. the reporter was glycosylated) in constructs containing only the first three AQP1 TM segments and concluded that AQP1 biogenesis therefore occurs in a cotranslational fashion without reorientation from a four-spanning intermediate.

These studies have lead to several unanswered questions regarding AQP1 biogenesis. Different reporter domains (prolactin versus H/K-ATPase {beta}-subunit derivatives), translocation assays (protease protection versus glycosylation) and fusion sites could potentially account for the different apparent topology observed for TM3. Because C-terminal reporters are routinely used to study polytopic protein biogenesis, these factors are of more than just academic interest. In addition, although truncated proteins provide important structural information at a relatively defined point of synthesis, they lack C-terminal sequence information and therefore must be viewed as populating intermediate folding states. As such they are potential candidates for recognition by ER quality control machinery. Consistent with this we had previously observed that certain AQP1 fusion proteins are relatively unstable in oocytes (27). A final possibility proposed by the Turner group is that oocytes and mammalian cells handle topological information in fundamentally different ways. If true, this would have major implications for protein biogenesis.

Xenopus oocytes efficiently express diverse aquaporins and have been extensively used to study AQP biosynthesis, trafficking, and function (28–32). However, a direct comparison of biosynthetic mechanisms in oocyte and mammalian cells has not previously been carried out. We therefore systematically examined AQP1 fusion proteins containing two, three, or four TM segments in both Xenopus oocytes and HEK-293 cells to determine the origin of previous discrepancies. We now show that irrespective of the reporter or fusion site examined, both systems yielded similar topologic results. AQP1 intermediates containing the first three TM segments gave rise to two distinct cohorts of polypeptides in which TM3 spanned the ER membrane in either an Ncyto/Cexo (mature) or Nexo/Ccyto (immature) topology. Careful pulse-chase analyses revealed that the immature form predominated immediately after synthesis in both cell types but that it was rapidly degraded via the proteasome-mediated ERAD pathway. As a result, the mature topology predominated 1–2 h after synthesis in HEK cells. We conclude that differential stability of biogenesis intermediates is an important factor for in vivo analysis of truncated chimeric proteins and that cotranslational events of AQP1 biogenesis are conserved in diverse expression systems.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
cDNA Construction—Plasmids AQP1P77.P, AQP1L139.P, and AQP1P169.P are described previously as clones 3, 6, and 7 (22); AQP1S66.P, AQP1T120.P, and AQP1L164.P were generated using the same strategy by PCR amplification of AQP coding region using antisense oligonucleotides: S66, GCTGATGGTCACCCCACTCTGCGCCAGCGTGGC; T120, AAGCGAGGTCACCGTCAGGGAGGAGGTGAT; and L164, GGGGGCGGTCACCCCAAGGTCACGGCGCCTCCG. The resulting constructs contain AQP1 residues 1–66, 1–77, 1–120, 1–139, 1–164, or 1–169 followed by the C-terminal 142 amino acids of bovine prolactin, a passive translocation reporter (5). Plasmid pEGFP. AQP1T120.{beta} was kindly provided by R. James Turner and is derived from pEGFP-C3 (Clontech, Palo Alto, CA) (26). It contains AQP1 codons 1–120 fused between EGFP and the C-terminal 177 amino acids of the H/K-ATPase {beta}-subunit. pEGFP.AQP1S66.{beta}, pEGFP.AQP1P77.{beta}, pEGFP.AQP1L139.{beta}, pEGFP.AQP1L164.{beta}, and pEGFP.AQP1P169.{beta} were generated by PCR amplification of AQP1 cDNA using a sense oligonucleotide (TGAGTAGATCTCATGGCCAGCGAGTTCAAG) and corresponding antisense oligonucleotides S66 (TGAGTAAGCTTCCACTCTGCGCCAGCGTC), P77C (AGTGTGAAGCTTCCCGGGTTGAGGTGGGCCCG), L139 (ATCTCGAAGCTTCCCAGGCCCTGGCCCGAGTTC), L164 (TGAGTAAGCTTCCAAGGTCACGGCGCCT), and P169 (CCGATGAAGCTTCCGGGGGCTGAGCCACCAAGG) encoding BglII (sense) and HindIII (antisense) restrictions sites that were used to ligate DNA fragments into the EGFP-{beta} subunit cassette. The constructs encode AQP1 residues 1–66, 1–77, 1–139, 1–164, or 1–169 flanked by EGFP and {beta}-subunit. The full-length AQP1 construct was generated by ligating AQP1 cDNA into the mammalian expression vector pEGFP-N3 (Clontech) between the HindIII and NotI restriction sites resulting in a full-length AQP1 construct without an EGFP tag. The sequence of all PCR-amplified DNA was verified by automated DNA sequencing.

Xenopus laevis Expression—mRNA was transcribed in vitro with SP6 RNA polymerase (New England Biolabs, Beverly, MA) using 2 µg of plasmid DNA in a 10-µl volume at 40 °C for 1 h as previously described (22). The aliquots were used immediately or frozen in liquid nitrogen and stored at -80 °C. 2 µl of transcript was mixed with 50 µCi of [35S]methionine (0.5 µl of a 10x concentrated Tran35S-label; ICN Pharmaceuticals, Irvine, CA), and 50 nl was injected into stage VI X. laevis oocytes (50 nl/oocyte) on an ice-cold stage. The oocytes were incubated at 18 °C in MBSH (88 mM NaCl, 1 mM KCl, 24 mM NaHCO3, 0.82 mM MgSO4, 0.33 mM Ca(NO3)2, 0.41 mM CaCl2, 10 mM HEPES, pH 7.4, 50 µg/ml gentamicin, 100 units/ml penicillin, and 100 µg/ml streptomycin sulfate).

Protease Protection and Pulse-Chase Assays in Oocytes—The oocytes were injected as described above, incubated at 18 °C for 3 h, and homogenized by hand in 3 volumes of 0.25 M sucrose, 50 mM KAc, 5 mM MgAc2, 1.0 mM dithiothreitol, 50 mM Tris-Cl, pH 7.5. The homogenates were divided into three 10-µl aliquots on ice. Proteinase K (Roche Applied Science) was added (final concentration, 0.2 mg/ml) in the presence or absence of 1% Triton X-100. The reactions were incubated on ice for 1 h and rapidly mixed with phenylmethylsulfonyl fluoride (10 mM) and boiled in 10 volumes of 1% SDS, 0.1 M Tris-HCl, pH 8.0, for 5 min. The samples were then diluted in 10 volumes of buffer A (100 mM Tris, pH 8.0, 100 mM NaCl, 1% Triton X-100, 2 mM EDTA), incubated at 4 °C for 15 min, and centrifuged at 16,000 x g for 10 min at 4 °C to remove insoluble debris. Efficiency of the assay was regularly assessed using a known secretory control protein and was >80%. For pulse-chase assays oocytes were injected as described and incubated at 18 °C for 2 h, and the medium was then replaced with fresh MBSH containing 2 mM methionine. The oocytes were harvested at the specified time points and processed as above.

HEK-293 Pulse-Chase Studies—HEK-293 cells were cultured in Dulbecco's modified essential medium (Fisher) supplemented with 100 units/ml penicillin, 100 µg/ml streptomycin sulfate, and 10% heat-inactivated fetal bovine serum (Invitrogen). The cells were grown on plastic in a humidified incubator at 37 °C and 5% CO2 and were passaged every 3–4 days. The cells were transfected at 50–60% confluence with TransIT-LT transfection reagent (Mirus, Madison, WI) according to the manufacturer's instructions (3 µg of cDNA and 12 µl of TransIT-LT reagent/60-mm plate). Transfection efficiencies were ~40% as determined by EGFP fluorescence. 48 h after transfection media was replaced with 1 ml of methionine-cysteine-free medium for 30 min. The cells were then pulse-labeled with 80 µCi of [35S]methionine for 15 min, and the medium was removed and replaced with fresh complete medium for the indicated duration of the chase. The cells were lysed on ice with 1 ml of radioimmune precipitation assay buffer (0.1% SDS, 1% Triton X-100, 1% dexoycholate, 150 mM NaCl, 10 mM Tris-Cl, pH 8.0, 2.5 mM MgCl2,1x protease inhibitors III (CalBiochem, San Diego, CA), and 1 mM phenylmethylsulfonyl fluoride) for 30 min on ice and passed through a 26-gauge needle three times. The samples were then clarified at 16,000 x g for 12 min.

Immunoprecipitation—Clarified oocyte or HEK cell homogenates were incubated with anti-prolactin antisera (ICN Biomedicals, Costa Mesa, CA) at 1:2000 dilution, polyclonal anti-EGFP antibody (Molecular Probes, Eugene, OR) at 1:2000 dilution, or polyclonal rabbit anti-AQP1 antisera raised against purified AQP1 protein (generously provided by A. Verkman, UCSF, San Francisco, CA) at 1:1000 dilution and 5.0 µl of protein-A Affigel (Bio-Rad). The samples were rotated for 10 h at 4 °C (oocyte homogenates) and 4 h (HEK cells) prior to washing three times with solubilization buffer and twice with 100 mM NaCl, 100 mM Tris-Cl, pH 8.0. The samples were boiled in protein SDS loading buffer (33) and analyzed by SDS-PAGE, EN3HANCE (PerkinElmer Life Sciences) fluorography. The intensity of recovered bands was quantitated using a Bio-Rad personal Molecular PhosphorImager Fx (Kodak screens, Quantity-1 software).

PNGase F Digests—Beads from immunoprecipitations were resuspended after the final wash in 15 µl of 0.1 M Tris-Cl, pH 7.5, and 0.3 µl of PNGase F (New England Biolabs, Beverly, MA), and incubated at 37 °C for 3 h. The samples were then analyzed by SDS-PAGE as described above.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
C-terminal translocation reporters placed after connecting peptide loops have been widely used to study membrane protein topology and biogenesis (6, 12, 13, 22, 34–39). The rationale for this approach is that topology of TM segments and their connecting loops is controlled by the action of topogenic determinants encoded within the nascent polypeptide. TM segments that function as signal (anchor) sequences open the Sec61 translocon channel and initiate translocation of polypeptide into the ER lumen. All else being equal, translocation will continue until a second TM segment is synthesized that functions as a stop transfer sequence to close the translocon, relax the ribosome-translocon junction, and allow the next peptide loop to enter the cytosol. In this manner, topology is determined cotranslationally as the nascent polypeptide emerges from the ribosome. A passive reporter domain (i.e. one containing no intrinsic topogenic information) fused to a peptide loop downstream of a signal sequence will therefore follow the loop into the ER lumen, whereas a reporter located downstream of a stop transfer will, in turn, remain in the cytosol.

Two variations on this strategy have been employed to map the cotranslational topology of AQP1. In the first approach, a C-terminal reporter domain derived from the secretory protein prolactin was fused to each AQP1 peptide loop, and topology was determined in vitro and in microinjected Xenopus oocytes using a protease protection assay (22). The second approach used a different chimeric cassette containing an N-terminal EGFP domain and a C-terminal reporter derived from the {beta}-subunit of the H/K-ATPase. Topology of the {beta}-subunit was then determined in HEK-293 cells based on N-linked glycosylation, which occurs exclusively in the ER lumen (26, 40, 41). Key differences between these studies are summarized in Fig. 1. In oocytes, reporters fused to the TM2–3 loop (residue Pro77) or the TM3–4 loop (Leu139) were located in the ER lumen and cytosol, respectively (Fig. 1A) (22). Surprisingly this was different from their expected topology in the mature protein. Two subsequent studies confirmed these results and demonstrated that AQP1 TM segments 2–4 cotranslationally acquire an immature topology that is subsequently converted to the mature topology by an internal 180° rotation of TM3 (23, 24). In contrast, glycosylation patterns of the {beta}-subunit domain lead to the conclusion that the TM2–3 and TM3–4 loops acquire their proper topology cotranslationally in the ER of mammalian cells and therefore do not undergo a topological reorientation (Fig. 1B).

Although similar in many ways, these studies differed in several important aspects including the location of fusion sites, the reporter domain used, and the cell expression system. We therefore undertook a systematic comparison of AQP1 biogenesis in oocytes and mammalian cells using similar truncation sites and reporters to resolve these discrepancies. Because the major differences involved the initial orientation of TM3 (Type I in oocytes and Type II in HEK cells), we focused our attention primarily on the topology of TM3 and its immediate flanking residues. Topology of other regions such as the N and C termini and TM5–6 are well established and were therefore not retested here (Fig. 1).

Reporter Fusion Site Does Not Affect Outcome of Early Biogenesis Experiments in Oocytes—We first addressed whether topological differences might arise from the use of different fusion sites. In particular, up to 10–15 flanking residues can influence topogenic activities of TM segments (42). Thus fusion sites very close to the TM C terminus such as those used in the EGFP-{beta}-subunit chimeras might delete potentially important topogenic information. Alternatively, the fusion site might introduce new flanking residues (from the {beta}-subunit) that could inadvertently alter TM2 behavior. AQP1 fusion sites were therefore tested head-to-head by placing the prolactin reporter at both truncations sites downstream of TM2 (Ser66 and Pro77), TM3 (Thr120 and Leu139), and TM4 (Leu164 and Leu169 (Fig. 2A). Topology was determined by protease protection as described under "Materials and Methods." Consistent with our previous results, fusion to the TM2–3 peptide loop at either truncation Ser66 or Pro77 resulted in similar translocation of the reporter (80–83%; Fig. 2B, lanes 1–6). Similarly, the {beta}-subunit-TM2 fusion site used by Dohke et al. (46) had only a modest effect on translocation of the P-reporter, decreasing translocation by 5–10% (data not shown). In contrast, when the reporter was placed in the TM3–4 loop (truncations Thr120 and Leu139) or the TM4–5 loop (truncations Leu164 and Leu169), it was ~85–90% and >95% cytosolic, respectively (Fig. 2B, lanes 7–18). As was observed previously, ~50% of fusion proteins truncated after TM3 (TM3.P and TM4.P) underwent N-linked glycosylation at residue Asn42, which resulted in a 3-kDa shift in migration (22).



View larger version (48K):
[in this window]
[in a new window]
  		FIG. 2.
Location of fusion sites does not affect early AQP1 biogenesis events in oocytes. A, diagram of AQP1 fusion proteins showing TM segments (black rectangles) and prolactin-derived (P) reporter (gray rectangles). B, constructs in A were expressed in oocytes, and reporter topology was determined by proteinase K (PK) digestion in the presence or absence of Triton X-100 (Tx-100). Shown is a representative autoradiogram of prolactin reactive immunoprecipitated products. The percentage of reporter protected from proteinase K digestion was normalized to a control secretory protein. Topology of fusion sites are illustrated under autoradiogram. The data show average of three or more experiments ± S.E.M.

 
These results thus support previous topological findings in Xenopus oocytes and demonstrate that different topological orientations obtained for TM2 and TM3 (shown in Fig. 1) were not likely caused by subtle modification of downstream flanking residues due to different fusion sites. In all cases, TM2 did not function as an efficient stop transfer sequence to terminate translocation, and TM3 initially spanned the membrane with its C-terminal flanking residues oriented toward the cytosol.

Truncated AQP1 Constructs Generate Multiple Biogenesis Intermediates with Differential Stability in Oocytes—One limitation to all topology mapping studies is that results are often not absolute. For example, variable degrees of glycosylation were observed for several EGFP-AQP-{beta}-subunit chimeras in HEK cells, particularly for fusion sites in the TM2–3 and TM3–4 loops (26). Similarly, in our original analysis we used a cut-off of ~80% protease protection to define whether a peptide loop segment was translocated into the ER lumen (22). As shown in Fig. 2B, the majority of the reporter fused to residues Thr120 or Leu139 was accessible to cytosolic protease. However, a small fraction (10–15%) appeared to be resistant to digestion. Although this could potentially be caused by subtle variations in reporter folding and efficiency of proteolysis, this minor fraction was completely degraded in the presence of nondenaturing detergent (Fig. 2B, lanes 9 and 12). This raised the possibility that nascent polypeptides with protected versus accessible reporters might represent separate cohorts of proteins with different topological structures.

We therefore used pulse-chase metabolic labeling to test the topology of AQP1 fusion proteins truncated after TM3 at residues Thr120 and Leu139. Oocytes were simultaneously injected with mRNA and [35S]methionine to initiate rapid radiolabeling of newly synthesized protein. Labeling gradually tapers off after several hours because of dilution by medium and oocyte methionine stores (Ref. 43 and data not shown). In some cases the chase was performed in the presence of excess unlabeled methionine, but this had little effect given the long time course used (data not shown). Incubation times were chosen based on previous studies demonstrating that processing and transport proteins out of the oocyte ER is significantly slower than mammalian cells and occurs over the time frame of many hours (43, 44). At the end of the incubation, reporter topology of remaining polypeptides was determined by protease protection. Two important results were obtained from these experiments. First, both constructs, regardless of the fusion site, were quite unstable and underwent significant degradation during the chase period (Fig 3A, compare lanes 1, 4, and 7 with lanes 10, 13, and 16). After 24 h the amount of protein remaining had decreased by 60–80% (Fig. 3B). In contrast, there was little or no decrease in the amount of protein that yielded a protease protected reporter. This resulted in a 3–4-fold increase in the fraction of remaining chains in which TM3 C-terminal residues appeared to reside in the ER lumen (Fig. 3, C and D).



View larger version (37K):
[in this window]
[in a new window]
  		FIG. 3.
Differential stability of biogenesis isoforms truncated following TM3. A, autoradiogram of AQP1 truncated in the TM3–4 loop and fused to the prolactin-derived reporter at residues Thr120 and Leu139 as indicated. The constructs were expressed in oocytes for the times indicated and homogenates were digested with proteinase K in the presence or absence of Triton X-100 (TX-100). B, results from A were quantitated, and the percentage of reporter protected at each time point was plotted. The results show the averaged values from three independent experiments ± S.E.M. C, model of isoform profile. At early points the two-spanning isoform predominates, whereas the proportion of three-spanning isoform increases ~3-fold over the time course of the experiment.

 
Although not conclusive in themselves, these results suggested a scenario in which synthesis of the first three AQP1 TM segments provides insufficient topogenic information to efficiently direct TM segments into their proper topology. Most polypeptides, (~85% in oocytes) can only achieve a two-spanning topology in which TM2 does not yet stably span the membrane and in which TM3 is oriented in an Nexo/Ccyto topology. However, in a relatively small fraction of polypeptides, TM3 does acquire its proper Ncyt/Cexo topology, which is reflected by translocation of the TM3–4 loop and its attached reporter (Fig. 3C). Thus two different isoforms appear to be generated in oocytes when synthesis of TM3 and TM4 is completed, and synthesis of TM5–6 has not yet begun. Whereas the two-spanning topology initially predominates, selective degradation of this isoform leads to a relative increase in the more stable three-spanning isoform over time.

AQP1 Fusion Proteins Generate Multiple Topological Isoforms in Mammalian Cells—If truncated AQP1 constructs gave rise to multiple topological isoforms in mammalian cells, then differential stability might explain some of the topological discrepancies demonstrated in Fig. 1. We therefore re-evaluated chimeric fusion proteins previously used by the Turner group to better define AQP1 biogenesis in mammalian cells. AQP1 fragments were inserted into the EGFP-{beta} subunit chimera described previously at two different truncation sites after TM2, TM3, and TM4 (26). As shown in Fig. 4A, the {beta}-subunit contains five potential N-linked glycosylation sites that provide a read-out for translocation into the ER lumen. Constructs were transiently expressed in HEK-293 cells and pulse-labeled with [35S]methionine for 2 h, and EGFP reactive proteins were immunoprecipitated and analyzed by SDS-PAGE before and after removal of N-linked sugars by PNGase F. When AQP1 was truncated at residues Ser66 and Pro77, 64 and 57% of EGFP-reactive protein was present in a glycosylated form (Fig. 4B, lanes 1–4). This is consistent with previous reports that found >50% glycosylation in the identical Ser66 construct at steady state. However, in contrast to the previous conclusions that TM2 spanned the membrane cotranslationally, we would argue that TM2 does not efficiently terminate translocation in HEK cells. Rather its C-terminal residues pass into the ER lumen in a major fraction of nascent polypeptides.



View larger version (32K):
[in this window]
[in a new window]
  		FIG. 4.
2-h labeling of HEK-293 cells shows results consistent with previous studies. A, diagram of chimeric proteins transfected into HEK-293 cells. The open circles represent N-linked glycosylation sites on AQP1 and {beta}-subunit. EGFP and {beta}-subunit domains and AQP1 TM segments are indicated. B, autoradiogram of 2-h pulse-labeled HEK-293 cells immunoprecipitated with GFP antisera prior to and after PNGase F digestion. The downward arrows indicate glycosylated proteins as documented by PNGase F digestion. The upward arrows indicate nonglycosylated protein. The percentage of glycosylation of constructs is indicated under autoradiogram. C, diagram of the topological isoforms deduced from the Thr120 and Leu139 chimeric proteins.

 
The {beta}-subunit reporter was also predominantly glycosylated when fused to residues Thr120 or Leu139. Most recovered protein (75–82%) migrated at a size of ~62–65 kDa, whereas only faint bands were observed at ~50–53 kDa (Fig. 4B, lanes 5–8). PNGase F digestion confirmed that the larger bands represented glycosylated forms of the 50-kDa chimeric protein. These results are consistent with steady state immunoblots (26) of the Thr120 truncation in which the {beta}-subunit reporter was glycosylated in ~80% of polypeptides. The simplest explanation for these results is that TM3 is indeed predominantly oriented in its mature Ncyt/Cexo topology. However, a small proportion of nonglycosylated protein was also isolated (Fig. 4B, upward arrows). Although it is possible that this might reflect inefficient glycosylation of the reporter (45), this seems unlikely because of the large number of consensus sites available in the {beta}-subunit. Indeed, lack of glycosylation of this reporter has been used as a direct readout for its cytosolic location (26, 38, 46). Polypeptides with nonglycosylated reporters therefore more likely represent a minor cohort of AQP1 that exhibits an alternate topology in which the reporter remains in the cytosol. Thus, like oocytes, mammalian cells appear to generate two different isoforms from constructs containing the first three AQP1 TM segments, but the relative proportion of two- and three-spanning isoforms would appear to be reversed (Fig. 4C).

Differential Stability of AQP1 Topological Intermediates in HEK-293 Cells—Based on our observations in oocytes, we further investigated the relationship between glycosylated and unglycosylated (three-spanning versus two-spanning) AQP1 fusion proteins by pulse-chase labeling in HEK cells. Because of rapid processing, very short pulse times (15 min) were used to capture AQP1 chimeras as close to the completion of synthesis as possible. These experiments revealed that immediately after synthesis, AQP1 chimeras containing the first three TM segments (truncations Thr120 or Leu139) were glycosylated in less than 50% of total protein (Fig. 5). Glycosylated proteins were initially present as a series of bands between 53 and 65 kDa in size that became fully glycosylated within 1 h. Remarkably, 50–60% of both chimeras were initially present as nonglycosylated protein that rapidly disappeared with a half-life of <25 min. Thus within 1 h of synthesis, >80% of remaining protein contained a glycosylated reporter.



View larger version (49K):
[in this window]
[in a new window]
  		FIG. 5.
Differential stability of AQP1 isoforms in HEK-293 cells. A, cells were transfected with constructs (Fig. 4), labeled with [35S]methionine for 15 min, chased with complete media for the indicated times, lysed, and subjected to SDS-PAGE and autoradiography. Nonglycosylated (-g) and glycosylated (+g) proteins are indicated. B, at time = 0, ~50% of protein was recovered as a 50-kDa nonglycosylated band that rapidly disappeared during the chase period. At later time points the three-spanning (glycosylated) protein predominated. Half-lives of the two-spanning (nonglycosylated) and three-spanning (glycosylated) isoforms were ~25 min and >120 min, respectively. The data show the averages of three or more experiments ± S.E.M.

 
Although it is possible that the reporter might have undergone a delayed glycosylation after reaching the ER lumen, we do not believe this is the case because the total amount of glycosylated protein did not change significantly during the chase period when all glycosylated bands were quantitated (data not shown; see also Fig. 6). Rather our data indicate that a significant fraction of these chimeras is synthesized in a two-spanning topology where TM3 is cotranslationally oriented in an Nexo/Ccyt topology. Just as in oocytes, this topological isoform is very unstable and selectively degraded, leaving the minor isoform to predominate at later time points. Because of its very short half-life, it is likely that some of the two-spanning isoform is degraded during the pulse period and that the protein present at time = 0 represents an underestimate of the actual fraction of the two-spanning isoform (Fig. 6). These data are therefore very similar to the results obtained in oocytes and demonstrate that regardless of the reporter, oocytes and mammalian cells both seem to handle AQP1 cotranslational biogenesis in a similar fashion.



View larger version (44K):
[in this window]
[in a new window]
  		FIG. 6.
MG132 blocks selective degradation of nonglycosylated isoforms. A and C, EGFP-{beta} subunit chimeras truncations 120 and 139 (see Fig. 4) were expressed in HEK-293 cells. Pulse-chase labeling was performed in the presence of 20 µM MG132 as described in "Materials and Methods." Glycosylated (+g) and nonglycosylated (-g) proteins are indicated. B and D, percentage of protein in the three-spanning (glycosylated) topology was quantitated for experiments carried out with (dark gray) or without (light gray) MG132. The data show the averages of three experiments ± S.E.M.

 
Selective Degradation of AQP1 Biogenesis Intermediates Occurs via the Proteasome-mediated ERAD Pathway—Misfolded proteins in the ER membrane are usually recognized by quality control machinery and degraded by the ubiquitin-proteasome (ERAD) pathway. We therefore tested whether selective degradation of the two-spanning isoform of AQP1 occurred via the proteasome. Pulse-chase studies performed in the presence of the proteasome inhibitor MG132 revealed that nonglycosylated (two-spanning) isoforms were dramatically stabilized upon proteasome inhibition (Fig. 6, A and C). Similar results were observed using another proteasome inhibitor N-acetyl-leucyl-leucyl-norleucinal (data not shown). The relative fraction of the two-spanning isoforms was increased to ~70% at initial time points, likely as a result of blocking degradation that took place even during the pulse period as mentioned above. In addition, the ratio of two- and three-spanning isoforms remained nearly constant in the presence of MG132 because selective degradation of the two-spanning isoform was reduced (Fig. 6, B and D). Importantly, no conversion of the nonglycosylated protein to the glycosylated form was observed. Therefore the predominance of the three-spanning topology observed at late time points does not result from delayed glycosylation of a translocated {beta}-subunit reporter. We conclude that the changes observed in the topological profiles of AQP1 chimeras containing the first three TM segments result from selective degradation of the two-spanning, relative to the three-spanning, isoform.

Full-length AQP1 Is Stable in HEK-293 Cells—We previously showed that in Xenopus oocytes, completion of AQP1 synthesis provides additional folding information that converts TM3 from its immature to its mature conformation (23). Thus in the full-length protein, the six-spanning topology is not a result of selective degradation but is derived from a rearrangement of TMs 2–4. However, it remained theoretically possible that in mammalian cells, full-length AQP1 could be synthesized as a four-spanning intermediate that was rapidly degraded and that this could result in the predominant mature six-spanning topology. Because the majority of AQP1 is initially synthesized with TM3 in reverse orientation (Fig. 6), we would expect >50% of the protein to be rapidly degraded by the proteasome-ERAD pathway. To test this hypothesis, the stability of full-length AQP1 was examined by pulse-chase analysis in HEK cells. The results in Fig. 7 clearly demonstrate that in contrast to truncated constructs, full-length AQP1 was very stable throughout the chase period. Moreover, no significant differences in expression level or stability were observed in the presence of MG132 under our conditions during the time course expected for topological maturation in the ER. Given the very short pulse labeling period used in our study, it is extremely unlikely that degradation of the unstable four-spanning isoform could account for these findings. Thus we conclude that protein initially synthesized with TM3 in the reverse orientation is converted into a more stable structure as additional folding information is provided by synthesis of C terminus residues.



View larger version (27K):
[in this window]
[in a new window]
  		FIG. 7.
Full-length AQP1 is stable in mammalian cells. Full-length AQP1 was expressed in HEK-293 cells. Pulse-chase labeling was performed in the absence or presence of 20 µM MG132 as described under "Materials and Methods." Proteins glycosylated (+g) or nonglycoslated (-g) at Asn42 are indicated.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
Previous studies proposed two different pathways by which AQP1 acquires its mature six-spanning topology in cells. In Xenopus oocytes, biogenesis proceeds from a four-spanning intermediate into a mature six-spanning topology during late stages of synthesis (22–24). The hallmark of this unusual folding pathway is that TM3 is initially oriented in an Nexo/Ccyt topology and must rotate 180° to acquire its proper topology and position TM2 and TM4 within the membrane. In contrast, a recent study failed to observe this intermediate TM3 orientation and concluded that mammalian cells utilize a fundamentally different biogenesis mechanism in which the mature AQP1 topology is established directly by cotranslational events (26). The current study now reconciles these differences by directly comparing early AQP1 biogenesis events in oocytes and mammalian cells using systematically truncated fusion proteins and two different C-terminal reporter domains.

Our results demonstrate a high degree of conservation in the unique features of AQP1 topogenesis that was independent of the fusion site, reporter domain, topological assay, or expression system utilized. Specifically, as the second TM segment emerges from the ribosome, it failed to efficiently terminate translocation of its C terminus flanking residues in at least 50% of nascent polypeptides in both Xenopus oocytes and mammalian cells. As a result, TM3 subsequently functions as a stop transfer sequence to adopt an Nexo/Ccyt topology in which its C terminus is transiently oriented in the cytosol. This sequence of events gives rise to an intermediate topological state in which only two of the first three AQP1 TM segments synthesized and cotranslationally acquired a membrane-spanning conformation (shown in Fig. 1).

A second finding was that several AQP1 topogenic events are not carried out with absolute fidelity in either expression system. Fusion proteins containing only the first three AQP1 TM segments generated two different topological isoforms, a major two-spanning isoform in which TM3 C-terminal flanking residues resided in the cytosol and a minor three-spanning isoform with the TM3 C terminus in the ER lumen. Pulse-chase metabolic labeling studies carried out in the presence and absence of MG132 further demonstrated that these isoforms are differentially recognized and degraded by the proteasome-mediated ERAD pathway. Selective degradation of the two-spanning isoform therefore resulted in a progressive increase in the percentage of remaining polypeptides in the three-spanning (mature) topology. This phenomenon was particularly apparent in HEK cells where very short pulse labeling times were required to confirm the presence of the predominant two-spanning isoform. Its very short half-life of <25 min explains why the Turner group was unable to observe this species at steady state and after a 1-h cyclohexamide chase (26). At these longer time points we too found that the three-spanning isoform predominated. Although selective degradation also occurred in oocytes, the time scale of degradation (T1/2 > 15 h) was much slower relative to the time course of the experiments. Thus the two-spanning isoform was easily observed. Importantly, our results are completely compatible with data reported by the Turner group; however, we have reached different conclusions. The previous discrepancies in AQP1 biogenesis are primarily due to the relative rates of protein synthesis and degradation in oocytes versus mammalian cells rather than fundamentally different behavior of ER translocation machinery.

The findings that truncated fusion proteins can give rise to multiple topological isoforms has several important implications for our understanding of how polytopic protein topology is cotranslationally established by the ribosome translocon complex. Given the rate of protein synthesis (~5 amino acids/s) in mammalian cells (48) and the length of the ribosome exit tunnel (100 Å) (49), TM segments and short connecting loops would normally reside within the ribosome only for a few seconds before entering the translocon. Cotranslational topogenesis of small polytopic proteins such as AQP1 therefore requires that the translocon rapidly recognize topogenic determinants and dynamically direct regions of peptide into their proper cellular compartment (50). In the case of AQP1 fusion proteins, the C-terminal reporter should theoretically reflect the last triage decision of the translocon and follow the peptide loop into its appropriate compartment. This assumption serves as the basis for a large number of studies in which C-terminal reporters have been used to determine protein topology (5, 11, 13, 38, 51). Our findings that different reporter domains and AQP1 truncation sites yield similar topological outcomes in very different cell types support the argument that choice of the translocation pathway (either cytosolic or lumenal) is strongly determined by TM segments present within the ribosome translocon complex. At the same time, however, certain truncations appear to provide the reporter access to both the ER lumen and cytosol (albeit at different efficiencies) as evidenced by the different topologic isoforms generated. This indicates that the translocation pathway is not gated absolutely in one direction or another at all time points during AQP1 synthesis. Rather, the translocon appears to provide a certain degree of ambiguity in which TM segments and their flanking residues may transiently sample multiple topological configurations as the nascent chain extends from the ribosome. This finding is consistent with recent studies demonstrating that N-terminal signal sequences can regulate cytosolic accessibility of translocating proteins (and hence translocation efficiency) in a graded manner (52–54).

The substitution of large reporters such as the prolactin domain or the {beta}-subunit in lieu of the native TM segments likely forces the translocon to make a decision as to where the polypeptide should be directed based on the limited topogenic information available up to the particular truncation site. We do not yet know how flexible the environment is within the ribosome-translocon complex nor how long a TM segment may be allowed to sample different topological spaces. However, in the case of AQP1, the relative proportion of different isoforms may be viewed as reflecting relative accessibility of the reporter to ER and cytosolic compartments. Such flexibility in translocon function might also facilitate proper reorientation of TM3 at later stages of synthesis as more folding information is provided. This is precisely what we observed using small epitope tags inserted into the TM2–3 and TM3–4 peptide loops. TM3 topology gradually changed into its mature orientation as additional TM segments and C-terminal folding information were synthesized (12, 23). Similar results have been reported for other polytopic proteins in which TM segment reorientation may take place within the translocon (16).

One question that arises from these studies is why do different AQP1 topological isoforms exhibit such markedly different stabilities. Because exposed hydrophobic patches can act as signals for ERAD (55), the two-spanning isoform could be degraded because TM2 is exposed to the ER lumen (see Fig. 1A). In contrast, topology of the three-spanning isoform would more closely resemble the mature protein. The ERAD machinery could therefore provide an efficient mechanism for removing proteins that exhibit abnormal topology in the ER membrane. Alternatively, stability may also be influenced by the reporter. Both reporters used here are normally expressed in ER lumen, and localization to the cytosol might therefore disrupt specific folding requirements such as disulfide bond formation (prolactin) or glycosylation ({beta}-subunit). Although we do not know the extent to which this occurs, the choice of a seemingly "inert" reporter may have significant implications when topologic studies are carried out in intact cells with active ERAD pathways and particularly when the reporter resides in both ER and cytosolic compartments. Our results demonstrate the importance of considering protein stability when performing topology studies with truncated intermediates because failure to examine topology at early time points can lead to erroneous conclusions when multiple isoforms are generated.

This study provides the first direct comparison between the early biogenesis mechanisms of oocytes and mammalian cells using a unique membrane protein substrate. Because oocytes provide a useful and convenient system for heterologous expression of many biologically important proteins (56), it is reassuring that early biogenesis events concur with those in mammalian cells. Indeed, when differences in protein stability are taken into account, the translocation efficiency and relative proportion of different isoforms for all three truncations examined here were in remarkably good agreement. This observation held even when different reporters, reporter readouts, and fusion sites were compared. In addition, the topology of all other regions of AQP1 was essentially identical (22, 23). Our findings are therefore consistent with the strong conservation of ER translocation machinery (57–59) and indicate that the unusual biogenesis mechanism utilized by AQP1 reflects a well conserved pathway of protein folding.

In this regard, we previously established that in Xenopus oocytes, once AQP1 synthesis is completed and all six TM segments are present, the protein acquires a stable conformation because of reorientation of TMs2–4 and repositioning of the TM2–3 and TM3–4 connecting loops (23). Selective degradation is therefore observed only for truncated fusion proteins that lack C-terminal folding information and are therefore trapped in an unstable topology. Importantly, we also found this to be the case in mammalian cells. In contrast to constructs containing only three TMs where the major isoform was degraded with a T1/2 of ~25 min, full-length AQP1 protein was remarkably stable. Yet our data show that TM3 was cotranslationally directed into the unstable Nexo/Ccyt topology in 70% of these polypeptides. Thus generation of stable AQP1 protein in mammalian cells, as in oocytes, is not achieved by selective degradation of an unstable four-spanning intermediate. Instead, synthesis of C-terminal residues is able to confer stability on a protein region that is initially inserted into the membrane in an incorrect conformation. Given that mammalian cells and oocytes synthesize and process AQP1 into functional water channels with six TM segments (20, 60, 61) and that AQP1 TM segments are cotranslationally directed into the same immature topology in both systems, it seems reasonable to speculate that mammalian cells also have the capacity to complete AQP1 folding by facilitating topological reorientation of TMs 2–4 in the ER.

We should point out, however, that the purpose of our study was primarily to compare cotranslational translocation events and does not address the mechanism(s) by which AQP1 ultimately acquires its mature six-spanning topology. Specifically, our studies do not address the efficiency of late trafficking events but rather they examine stability of protein during early maturation in the ER which is where the six-spanning topology is initially achieved (23). In this regard, our results contrast with previous findings by Leitch et al. (47) that showed that AQP1 degradation can be decreased by MG132 (and hypertonic stress) over longer time intervals. Additional work is therefore required to determine conclusively if and how AQP1 reorientation takes place in mammalian cells. The extent to which this unusual AQP biogenesis pathway is utilized by other proteins and the mechanism by which this process is carried out within the ribosome translocon complex also represent important future challenges for unraveling the complex process of membrane protein biogenesis.


   FOOTNOTES
 
* This work was supported by National Institutes of Health Grants GM53457 and DK51818, an American Heart Association Established Investigator Grant (to W. R. S.), and National Institutes of Health Grant HL007781 (to T. M. B.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

{ddagger} To whom correspondence should be addressed: Division of Molecular Medicine, Oregon Health Sciences University, 3181 SW Sam Jackson Park Rd., Portland, OR 97201. Tel.: 503-494-7322; Fax: 503-494-7368; E-mail: skachw{at}ohsu.edu.

1 The abbreviations used are: ER, endoplasmic reticulum; AQP, aquaporin; TM, transmembrane; spanning, membrane-spanning; EGFP, enhanced green fluorescent protein; ERAD, endoplasmic reticulum associated degradation; PNGase F, N-glycosidase F. Back


   ACKNOWLEDGMENTS
 
We thank J. Eledge for excellent technical assistance, Dr. R. J. Turner for generously providing the plasmid pEGFP.AQP1T120.{beta}, Dr. A. S. Verkman for supplying AQP1 antisera, and members of the Skach lab for helpful comments.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Alder, N. N., and Johnson, A. E. (2004) J. Biol. Chem. 279, 22787-22790[Free Full Text]
  2. Turner, R. J. (2003) J. Membr. Biol. 192, 149-157[CrossRef][Medline] [Order article via Infotrieve]
  3. Sadlish, H., and Skach, W. (2004) J. Membr. Biol., in press
  4. Blobel, G. (1980) Proc. Natl. Acad. Sci. U. S. A. 77, 1496-1500[Abstract/Free Full Text]
  5. Rothman, R. E., Andrews, D. W., Calayag, M. C., and Lingappa, V. R. (1988) J. Biol. Chem. 263, 10470-10480[Abstract/Free Full Text]
  6. Lipp, J., Flint, N., Haeuptle, M. T., and Dobberstein, B. (1989) J. Cell Biol. 109, 2013-2022[Abstract/Free Full Text]
  7. Wessels, H. P., and Spiess, M. (1988) Cell 55, 61-70[CrossRef][Medline] [Order article via Infotrieve]
  8. Moss, K., Helm, A., Lu, Y., Bragin, A., and Skach, W. R. (1998) Mol. Biol. Cell 9, 2681-2697[Abstract/Free Full Text]
  9. Skach, W. R., and Lingappa, V. R. (1994) Cancer Res. 54, 3202-3209[Abstract/Free Full Text]
  10. Carveth, K., Buck, T., Anthony, V., and Skach, W. R. (2002) J. Biol. Chem. 277, 39507-39514[Abstract/Free Full Text]
  11. Lin, J., and Addison, R. (1995) J. Biol. Chem. 270, 6942-6948[Abstract/Free Full Text]
  12. Wilkinson, B. M., Critchley, A. J., and Stirling, C. J. (1996) J. Biol. Chem. 271, 25590-25597[Abstract/Free Full Text]
  13. Xie, Y., Langhans-Rajasekaran, S. A., Bellovino, D., and Morimoto, T. (1996) J. Biol. Chem. 271, 2563-2573[Abstract/Free Full Text]
  14. Beguin, P., Hasler, U., Beggah, A., Horisberger, J. D., and Geering, K. (1998) J. Biol. Chem. 273, 24921-24931[Abstract/Free Full Text]
  15. Beguin, P., Hasler, U., Staub, O., and Geering, K. (2000) Mol. Biol. Cell 11, 1657-1672[Abstract/Free Full Text]
  16. Goder, V., Bieri, C., and Spiess, M. (1999) J. Cell Biol. 147, 257-266[Abstract/Free Full Text]
  17. Fujiyoshi, Y., Mitsuoka, K., de Groot, B. L., Philippsen, A., Grubmèuller, H., Agre, P., and Engel, A. (2002) Curr. Opin. Struct. Biol. 12, 509-515[CrossRef][Medline] [Order article via Infotrieve]
  18. Agre, P., King, L. S., Yasui, M., Guggino, W. B., Ottersen, O. P., Fujiyoshi, Y., Engel, A., and Nielsen, S. (2002) J. Physiol. 542, 3-16[Abstract/Free Full Text]
  19. Fu, D., Libson, A., Miercke, L. J., Weitzman, C., Nollert, P., Krucinski, J., and Stroud, R. M. (2000) Science 290, 481-486[Abstract/Free Full Text]
  20. Sui, H., Han, B. G., Lee, J. K., Walian, P., and Jap, B. K. (2001) Nature 414, 872-878[CrossRef][Medline] [Order article via Infotrieve]
  21. Schnermann, J., Chou, C. L., Ma, T., Traynor, T., Knepper, M. A., and Verkman, A. S. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 9660-9664[Abstract/Free Full Text]
  22. Skach, W. R., Shi, L. B., Calayag, M. C., Frigeri, A., Lingappa, V. R., and Verkman, A. S. (1994) J. Cell Biol. 125, 803-815[Abstract/Free Full Text]
  23. Lu, Y., Turnbull, I. R., Bragin, A., Carveth, K., Verkman, A. S., and Skach, W. R. (2000) Mol. Biol. Cell 11, 2973-2985[Abstract/Free Full Text]
  24. Foster, W., Helm, A., Turnbull, I., Gulati, H., Yang, B., Verkman, A. S., and Skach, W. R. (2000) J. Biol. Chem. 275, 34157-34165[Abstract/Free Full Text]
  25. Shi, L. B., Skach, W. R., Ma, T., and Verkman, A. S. (1995) Biochemistry 34, 8250-8256[CrossRef][Medline] [Order article via Infotrieve]
  26. Dohke, Y., and Turner, R. J. (2002) J. Biol. Chem. 277, 15215-15219[Abstract/Free Full Text]
  27. Skach, W. R., and Verkman, A. S. (1995) Biophysical J. 68, A334 (abstr.)
  28. Tamarappoo, B. K., and Verkman, A. S. (1998) J. Clin. Investig. 101, 2257-2267[Medline] [Order article via Infotrieve]
  29. Sasaki, S., Fushimi, K., Saito, H., Saito, F., Uchida, S., Ishibashi, K., Kuwahara, M., Ikeuchi, T., Inui, K., Nakajima, K., Watanabe, T., and Marumo, F. (1994) J. Clin. Investig. 93, 1250-1256[Medline] [Order article via Infotrieve]
  30. Mulders, S. M., Knoers, N. V., Van Lieburg, A. F., Monnens, L. A., Leumann, E., Wèuhl, E., Schober, E., Rijss, J. P., Van Os, C. H., and Deen, P. M. (1997) J. Am. Soc. Nephrol. 8, 242-248[Abstract]
  31. Deen, P. M., Croes, H., van Aubel, R. A., Ginsel, L. A., and van Os, C. H. (1995) J. Clin. Investig. 95, 2291-2296[Medline] [Order article via Infotrieve]
  32. Deen, P. M., Verdijk, M. A., Knoers, N. V., Wieringa, B., Monnens, L. A., van Os, C. H., and van Oost, B. A. (1994) Science 264, 92-95[Abstract/Free Full Text]
  33. Laemmli, U. K. (1970) Nature 227, 680-685[CrossRef][Medline] [Order article via Infotrieve]
  34. San Millan, J. L., Boyd, D., Dalbey, R., Wickner, W., and Beckwith, J. (1989) J. Bacteriol. 171, 5536-5541[Abstract/Free Full Text]
  35. Boyd, D., Traxler, B., and Beckwith, J. (1993) J. Bacteriol. 175, 553-556[Abstract/Free Full Text]
  36. Skach, W. R., Calayag, M. C., and Lingappa, V. R. (1993) J. Biol. Chem. 268, 6903-6908[Abstract/Free Full Text]
  37. Tector, M., and Hartl, F. U. (1999) EMBO J. 18, 6290-6298[CrossRef][Medline] [Order article via Infotrieve]
  38. Bayle, D., Weeks, D., and Sachs, G. (1997) J. Biol. Chem. 272, 19697-19707[Abstract/Free Full Text]
  39. Ota, K., Sakaguchi, M., von Heijne, G., Hamasaki, N., and Mihara, K. (1998) Mol. Cell 2, 495-503[CrossRef][Medline] [Order article via Infotrieve]
  40. Hubbard, S. C., and Ivatt, R. J. (1981) Annu. Rev. Biochem. 50, 555-583[CrossRef][Medline] [Order article via Infotrieve]
  41. Kaplan, H. A., Welply, J. K., and Lennarz, W. J. (1987) Biochim. Biophys. Acta 906, 161-173[Medline] [Order article via Infotrieve]
  42. Hartmann, E., Rapoport, T. A., and Lodish, H. F. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 5786-5790[Abstract/Free Full Text]
  43. Xiong, X., Bragin, A., Widdicombe, J. H., Cohn, J., and Skach, W. R. (1997) J. Clin. Investig. 100, 1079-1088[Medline] [Order article via Infotrieve]
  44. Buck, T. M., Eledge, J., and Skach, W. R. (2004) Am. J. Physiol. 287, C1291-C1299
  45. Nilsson, I., and von Heijne, G. (2000) J. Biol. Chem. 275, 17338-17343[Abstract/Free Full Text]
  46. Dohke, Y., Oh, Y. S., Ambudkar, I. S., and Turner, R. J. (2004) J. Biol. Chem. 279, 12242-12248[Abstract/Free Full Text]
  47. Leitch, V., Agre, P., and King, L. S. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 2894-2898[Abstract/Free Full Text]
  48. Braakman, I., Hoover-Litty, H., Wagner, K. R., and Helenius, A. (1991) J. Cell Biol. 114, 401-411[Abstract/Free Full Text]
  49. Ban, N., Freeborn, B., Nissen, P., Penczek, P., Grassucci, R. A., Sweet, R., Frank, J., Moore, P. B., and Steitz, T. A. (1998) Cell 93, 1105-1115[CrossRef][Medline] [Order article via Infotrieve]
  50. Johnson, A. E., and van Waes, M. A. (1999) Annu. Rev. Cell Dev. Biol. 15, 799-842[CrossRef][Medline] [Order article via Infotrieve]
  51. Manoil, C., Mekalanos, J. J., and Beckwith, J. (1990) J. Bacteriol. 172, 515-518[Abstract/Free Full Text]
  52. Fons, R. D., Bogert, B. A., and Hegde, R. S. (2003) J. Cell Biol. 160, 529-539[Abstract/Free Full Text]
  53. Kim, S. J., and Hegde, R. S. (2002) Mol. Biol. Cell 13, 3775-3786[Abstract/Free Full Text]
  54. Kim, S. J., Mitra, D., Salerno, J. R., and Hegde, R. S. (2002) Dev. Cell 2, 207-217[CrossRef][Medline] [Order article via Infotrieve]
  55. McCracken, A. A., and Brodsky, J. L. (2003) Bioessays 25, 868-877[CrossRef][Medline] [Order article via Infotrieve]
  56. Wagner, C. A., Friedrich, B., Setiawan, I., Lang, F., and Broer, S. (2000) Cell Physiol. Biochem. 10, 1-12[Medline] [Order article via Infotrieve]
  57. Matlack, K. E., Mothes, W., and Rapoport, T. A. (1998) Cell 92, 381-390[CrossRef][Medline] [Order article via Infotrieve]
  58. Eichler, J., and Duong, F. (2004) Trends Biochem. Sci. 29, 221-223[CrossRef][Medline] [Order article via Infotrieve]
  59. Van den Berg, B., Clemons, W. M., Jr., Collinson, I., Modis, Y., Hartmann, E., Harrison, S. C., and Rapoport, T. A. (2004) Nature 427, 36-44[CrossRef][Medline] [Order article via Infotrieve]
  60. Katsura, T., Verbavatz, J. M., Farinas, J., Ma, T., Ausiello, D. A., Verkman, A. S., and Brown, D. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 7212-7216[Abstract/Free Full Text]
  61. Toriano, R., Ford, P., Rivarola, V., Tamarappoo, B. K., Verkman, A. S., and Parisi, M. (1998) J. Membr. Biol. 161, 141-149[CrossRef][Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
C. J. Daniel, B. Conti, A. E. Johnson, and W. R. Skach
Control of Translocation through the Sec61 Translocon by Nascent Polypeptide Structure within the Ribosome
J. Biol. Chem., July 25, 2008; 283(30): 20864 - 20873.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
280/1/261    most recent
M409920200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Buck, T. M.
Right arrow Articles by Skach, W. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Buck, T. M.
Right arrow Articles by Skach, W. R.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2005 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement