Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M411223200 on November 1, 2004

J. Biol. Chem., Vol. 280, Issue 1, 277-283, January 7, 2005
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
280/1/277    most recent
M411223200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Aksoy, E.
Right arrow Articles by Trottein, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Aksoy, E.
Right arrow Articles by Trottein, F.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Double-stranded RNAs from the Helminth Parasite Schistosoma Activate TLR3 in Dendritic Cells*{boxs}

Ezra Aksoy{ddagger}§, Claudia S. Zouain{ddagger}||, François Vanhoutte{ddagger}, Josette Fontaine{ddagger}, Norman Pavelka**, Nathalie Thieblemont{ddagger}{ddagger}, Fabienne Willems§, Paola Ricciardi-Castagnoli**, Michel Goldman§, Monique Capron{ddagger}, Bernard Ryffel§§, and François Trottein{ddagger}¶¶

From the {ddagger}INSERM U547, Institut Pasteur de Lille, Lille, 59019 France, §Institute for Medical Immunology, Université Libre de Bruxelles, B-1070 Brussels, Belgium, **Department of Biotechnology and Bioscience, University of Milano-Bicocca, 20126 Milan, Italy, {ddagger}{ddagger}CNRS, 8147 and Université Paris V, Hôpital Necker, 75743 Paris, France, and §§Laboratoire de Génétique Expérimentale et Moléculaire (GEM2358), CNRS, 41500 Orléans, France

Received for publication, September 30, 2004


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Stimulation of dendritic cells (DCs) by the egg stage of the helminth parasite Schistosoma mansoni activates a signaling pathway resulting in type I interferon (IFN) and IFN-stimulated gene (ISG) expression. Here, we demonstrate that S. mansoni eggs disjointedly activate myeloid differentiation factor 88 (MyD88)-dependent and MyD88-independent pathways in DCs. Inflammatory cytokine expression and NF-{kappa}B activation in DCs from MyD88-deficient mice were impaired, whereas signaling transducer activator of transcription (STAT) 1(Tyr701) phosphorylation and ISG expression were intact in MyD88 or Toll-like receptor (TLR)4-deficient counterparts. Accordingly, we analyzed distinct TLR members for their ability to respond to schistosome eggs and established that TLR3 resulted in the activation of NF-{kappa}B and the positive regulatory domain III-I site from IFN-{beta} promoter. Unexpectedly, egg-derived RNA possessed RNase A-resistant and RNase III-sensitive structures capable of triggering TLR3 activation, suggesting the involvement of double-stranded (ds) structures. Moreover, DCs from TLR3-deficient mice displayed a complete loss of signaling transducer activator of transcription 1 phosphorylation and ISG expression in response to egg-derived dsRNA. Finally, TLR3-deficient DCs showed a reduced response to schistosome eggs relative to wild-type cells. Collectively, our data suggest for the first time that dsRNA from a non-viral pathogen may act as an inducer of the innate immune system through TLR3.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
DCs1 are antigen-presenting cells that establish an intimate link between innate and adaptive immune responses (1, 2). During a microbial invasion, DCs play a central role in detecting foreign entities in their environment through a wide array of innate pattern recognition receptors and in modulating the succeeding immune/inflammatory responses by polarizing type 1 or type 2 responses or conversely by inducing tolerance to foreign and/or environmental antigen (3).

Pathogenic organisms express evolutionarily conserved unique motifs that are recognized by distinct pattern recognition receptor families including Toll-like receptors (TLRs) (4). Activation of almost all TLRs results in signaling cascades that utilize a Toll/IL-1 receptor domain-containing adapter molecule myeloid differentiation factor 88 (MyD88)-dependent pathway which converges on the activation of the transcription factor NF-{kappa}B and mitogen-activated protein kinases (5). However, activation of TLR3 engages a MyD88-independent pathway, resulting in the expression of a subset of primary response genes. These include type I interferon (IFN)-{beta}, induced by IFN regulatory factor-3 (6–9) downstream of Toll/IL-1 receptor domain-containing adaptor, inducing IFN-{beta} (termed as TRIF) and also NF-{kappa}B activation (10–13). TLR4 uses a similar type of pathway along with MyD88 (11, 12). Upon TLR-4/TLR-3 triggering, secreted IFN-{beta} instigates an autocrine/paracrine loop and leads to the phosphorylation of signaling transducer activator of transcription (STAT)1 at the Tyr701 residue (14) and the expression of a set of IFN-stimulated genes (ISGs) including members of the glucocorticoid-attenuated response gene (GARG) family and co-stimulatory molecules (such as CD40 and CD86) (7, 15).

Relative to viruses, bacteria, and intracellular parasites, only a limited amount of work has been done on the role of TLRs in DC activation in response to extracellular pathogens, including helminths. Using high density oligonucleotide microarrays, we have recently demonstrated that the egg stage of the metazoan parasite Schistosoma mansoni activates the transcription of many genes in myeloid DCs including those encoding cell surface markers (CD40 and CD86), inflammatory (TNF-{alpha}), and immunoregulatory (IL-12p40) cytokines as well as ISGs (16). This signature is highly evocative of a TLR dependence. Although the effects of Schistosoma live eggs on TLR activation have not been studied so far, recent studies have reported the involvement of distinct TLRs in DC activation in response to certain egg components. Indeed, two egg-derived components, the glycolipid lysophosphatidylserine and the carbohydrate determinant lacto-N-fucopentaose III, have been shown to activate TLR2 and TLR4, respectively, in myeloid DCs (17, 18).

In the present work we aimed to investigate the involvement of TLRs in DC activation in response to live eggs. We showed that schistosome eggs activate a MyD88-dependent and a MyD88-independent pathway in DCs. Screening of distinct TLR members by transfection assays confirmed TLR2 (but not TLR4) activation but also demonstrated that TLR3, a TLR member known to recognize double-stranded (ds) RNA, is activated in response to eggs. In support of this hypothesis we show evidence that egg-derived, RNase A-resistant and RNase III-sensitive RNA structures activate TLR3-expressing cells. Finally, we found that egg dsRNA elicited STAT1 phosphorylation and ISG production in DCs via TLR3 engagement.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Reagents and Plasmids—Lipopolysaccharide (LPS) (from Escherichia coli serotype 055:B5) was from Sigma-Aldrich. Pam3CSK4 (S-[2.3-bis(palmitoyloxy)-(2-RS)-propyl]-N-palmitoyl-(R)-Cys-(S)-Ser-Lys4-OH) trihydrochloride was from EMC Microcollections (Tuebingen, Germany), polyinosine-polycytidylic acid (p(I:C)) was from Amersham Biosciences), R848 was from Cayla (Toulouse, France), CpG-A oligonucleotides were from Tib Molbiol (Berlin, Germany), and flagellin was kindly provided by J. C. Sirard (Institut Pasteur de Lille). N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium methyl sulfate (DOTAP) was purchased from Roche Diagnostics. The reporter constructs for multimerized NF-{kappa}B and the positive regulatory domain (PRD) III-I site from the IFN-{beta} promoter have been described. Plasmids encoding human TLR2, TLR3, and TLR4 were gifts from Y. Delneste (INSERM U564, Angers), TLR5 was from J. C. Sirard, and TLR7, TLR8, and TLR9 were gifts from H. Wagner (Institute of Medical Microbiology, Munich, Germany).

Mice—Female C57BL/6 mice were purchased from Iffa-Credo (l'Arbesle, France). The generation of MyD88-, TLR2-, TLR3-, and TLR4-deficient C57BL/6 mice has been described earlier (19–21). Mice strains were bred in an animal facility (Centre de développement des Techniques avancées pour l'expérimentation animale, Orléans, France) in pathogen-free conditions. All experiments were performed according to institutional guidelines of the animal ethics committee of the Pasteur Institute, Lille, France.

Bone Marrow-Dendritic Cell (BM-DC) Generation—DCs were generated from the BMs of wild-type (WT) or knock-out C57BL/6 mice as described previously (22). Cells were cultured in RPMI 1640 medium supplemented with 10% fetal calf serum and 1% of supernatant from a granulocyte-macrophage colony-stimulating factor-expressing cell line (J558-GM-CSF). DCs were used on day 14 of culture (95% pure, as assessed by fluorescence-activated cell sorter analysis).

Preparation of Live Eggs and Egg-derived RNA—S. mansoni eggs were obtained from the liver of infected golden hamsters after portal vein perfusion. The absence of contaminating hamster tissue fragments in the egg preparation was verified by microscopic analysis. The absence of endotoxin (below 0.015 enzyme units/ml) in the parasite preparations (1 x 105 parasites/ml) was analyzed by a Limulus test (Sigma-Aldrich). Total RNA from whole eggs was isolated according to manufacturer's specification (RNAPlus 3, Qbiogen) and was routinely pretreated with RNase-free DNase I (50 units of DNase I/100 µg of RNA) (Roche Applied Science) at 25 °C for 2 h. Total RNA was either pretreated with RNase A (1 µg/µg of RNA) or with RNase III (1 unit/µg of RNA) (New England Biolabs, Leusden, The Netherlands) in the buffer containing 150 mM NaCl, 10 mM Tris-HCl, pH 7.9, 10 mM MgCl2, and 1 mM dithiothreitol for 2 h at 37 °C (final volume, 50 µl). As a control, total RNA was also treated with RNase A in low salt condition (RNase-free H2O). Enzymatic activities were stopped by heat deactivation at 55 °C for 30 min after each treatment.

Cellular Activation Assays—BM-DC (1 x 106 cells/ml) were stimulated with live eggs (1/200 cells), Pam3CSK4 (0.5 µg/ml), p(I:C) (10 µg/ml), or LPS (100 ng/ml) or were left untreated. The conditions for RNA-DOTAP complexation were previously described (23) with a minor modification as 5 x 105 human embryonic kidney (HEK) 293T cells were stimulated in 500 µl of complete medium. As controls, DOTAP or p(I:C)-DOTAP complexes were included as described above. After 18–20 h, culture supernatants were collected, and IL-12p40 and TNF-{alpha} concentrations were measured by enzyme-linked immunosorbent assay (R&D Systems, Abingdon, UK). Cell death was assessed by trypan blue exclusion.

Transfection Assays—HEK 293T parental cell line or cells stably expressing either TLR2, TLR3, or TLR4/MD2 were previously described (11, 24). Cells were seeded in 48-well plates at a density of 5 x 105/ml overnight. The following day cells were transfected with 1 µg of indicated luciferase reporter plasmids or along with the indicated plasmids encoding a specific TLR using FuGENETM 6 (Roche Applied Science) according to the manufacturer's specification. All transfections included 40 ng of Renilla luciferase DNA in pRLTK vector (Promega, Leiden, the Netherlands) as an internal control. After cellular activation assays, cells were harvested, and promoter activities were analyzed using the dual luciferase reporter assay system (Promega) in a Packard Topcount NXT (Packard Instrument Co.). Promoter activities were normalized to Renilla luciferase activities. Data are expressed as the mean relative stimulation ± S.D.

Real-time Quantitative RT-PCR—Total RNA from BM-DCs (1 x 106 cells/ml) was isolated, and cDNA was synthesized from 1 µg of total RNA with random hexamer primers and Superscript reverse transcriptase (Invitrogen) using standard procedures. For real-time RT-PCR, cDNAs were used as templates for PCR amplification using the SYBR® Green PCR Master Mix (Molecular Probes, Leiden, The Netherlands) and the ABI PRISM 7700 sequence detector (Applied Biosystems, Foster City, CA). Primers specific for glyceraldehyde-3-phosphate dehydrogenase, IFI204, and GARG39 (glyceraldehyde-3-phosphate dehydrogenase forward, TGCCCAGAACATCATCCCTG, and reverse, TCAGATCCACGACGGACACA; IFI204 forward, TGGCAGCTGAGGTCTGTAAGG, and reverse, CCAGAGAGGTTCTCCCGACTG; GARG39 forward, GCCATTGCGAACTACCGTCT, and reverse, ACCGCGTCAAGCTTCAGTG, respectively) were designed by the Primer Express Program (Applied Biosystems) and were used for amplification in triplicate assays. PCR amplification of glyceraldehyde-3-phosphate dehydrogenase was performed to control for sample loading and to allow normalization between samples. Data are expressed as -fold increase compared with the expression level in unstimulated cells.

Immunoblotting—BM-DCs (1 x 106 cells/ml) were collected and directly lysed in Laemmli sample buffer. An equal volume of the total cell lysate from each condition was resolved by 10% SDS-PAGE and immunoblotted. Membranes were probed with a monoclonal anti-phospho-STAT1(Tyr701) antibody (Zymed Laboratories Inc., San Francisco, CA). To verify loading, immunoblots were reprobed with an antibody that recognizes nonphosphorylated STAT1 (Santa Cruz Biotechnologies, Boechout, Belgium). Immunoreactive bands were revealed using the ECL detection method (Amersham Biosciences).

Electrophoretic Mobility Shift Assay —Nuclear extracts from BM-DCs (1 x 106/ml cells) were prepared as described earlier (25). The double-stranded binding oligonucleotides for consensus NF-{kappa}B were from Promega. The electrophoretic mobility shift assay for NF-{kappa}B was carried out as reported previously (26).

Statistical Analysis—The statistical significance of differences between experimental groups was calculated using Student's t test. p < 0.05 was considered as significant.

Online Supplemental Material—Supplemental Fig. S1 shows egg-derived RNA fractions do not activate TLR2 or TLR4 stably expressing HEK 293T cells.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
MyD88 Is in Part Involved in DC Activation in Response to S. mansoni Eggs—The kinetic global gene expression analysis of mouse DCs suggested that S. mansoni live eggs activate DCs through TLR engagement (16). We first aimed to analyze the contribution of MyD88, a critical adaptor molecule used by all TLRs (with the exception of TLR3) (27, 28) in the egg-induced DC activation. In addition, we investigated the role of TLR2 and TLR4, two TLR members recently described to be involved in the response to distinct S. mansoni egg components (17, 18).

For this purpose, BM-DCs generated from WT, TLR2-, TLR4-, or MyD88-deficient (-/-) mice were exposed to live eggs, and the production of IL-12p40 and TNF-{alpha}, two classical cytokines described to be produced in response to TLR engagement, was quantified. As depicted in Fig. 1A, LPS (a potent TLR4 agonist), Pam3CSK4 (a potent TLR2 agonist), and live eggs induce the secretion of both IL-12p40 and TNF-{alpha}. As previously demonstrated, compared with WT DCs, IL-12p40 and TNF-{alpha} production was abolished in TLR4-/- and TLR2-/- DCs in response to their cognate ligands. Similarly, LPS and Pam3CSK4 failed to induce IL-12p40 and TNF-{alpha} production in MyD88-/- DCs. In response to eggs, compared with WT DCs, the production of IL-12p40 and TNF-{alpha} by TLR2-/- DCs was not significantly modified, whereas MyD88 deficiency resulted in ~75% decreased IL-12p40 and TNF-{alpha} production. In contrast, TLR4 deficiency did not influence the egg-induced production of these cytokines.



View larger version (20K):
[in this window]
[in a new window]
  		FIG. 1.
Effects of TLR2, TLR4, and MyD88 deficiency on BM-DC activation in response to S. mansoni live eggs. A–B, BM-DCs from WT, TLR4-/-, TLR2-/-, or MyD88-/- mice were stimulated with LPS (100 ng/ml), Pam3CSK4 (0.5 µg/ml), or S. mansoni eggs (1/200 cells). A, after 20 h IL-12p40 and TNF-{alpha} levels in culture supernatants were analyzed by enzyme-linked immunosorbent assay. Data represent the means ± S.E. of five independent experiments. p < 0.05 (*) or p < 0.005 (**) as compared with cytokine production from WT DCs stimulated by corresponding TLR agonist or live eggs. B, at the indicated time intervals, cells were collected and washed, and nuclear extracts were prepared. Ten µg of nuclear extract from each condition was analyzed by electrophoretic mobility shift assay for NF-{kappa}B DNA binding activity. Arrows indicate NF-{kappa}B complexes. One representative experiment of four is shown.

 
We next analyzed the activation of NF-{kappa}B (29) since it represents a common signaling pathway shared by all TLR members (27). As depicted in Fig. 1B, LPS, Pam3CSK4 and live eggs induce NF-{kappa}B nuclear translocation in WT DCs within 1 h post-stimulation. In comparison to their WT counterparts, NF-{kappa}B activation was abolished in TLR4-/- and TLR2-/- DCs in response to LPS and Pam3CSK4, respectively. In contrast, the lack of TLR2 or TLR4 in DCs did not modify NF-{kappa}B DNA binding mediated by schistosome eggs (Fig. 1B). In MyD88-/- DCs, LPS activated NF-{kappa}B, albeit with delayed kinetics, whereas Pam3CSK4-mediated NF-{kappa}B activation was abolished. After schistosome egg stimulation, NF-{kappa}B activation was strongly down-regulated at 1 h, but a substantial activation was still observed at 2 h in MyD88-/- DCs. As a whole, these data revealed that MyD88 is in part involved in the egg-induced NF-{kappa}B activation and IL-12p40 and TNF-{alpha} production by DCs.

S. mansoni eggs Activate a MyD88-independent Pathway in DCs—We have previously reported that DC activation by schistosome egg exposure is characterized by a rapid production of bioactive IFN-{beta} (16), a key mediator necessary for DC maturation in response to certain TLRs including TLR3 and TLR4 (by a MyD88-independent pathway) and TLR7-9 (by a MyD88-dependent pathway) (27). We have also demonstrated that IFN-{beta} production in response to eggs efficiently triggered the type I IFN receptor expressed on DC causing phosphorylation of STAT1 (Tyr701) with the consequent up-regulation of ISGs. Therefore, we investigated the contribution of MyD88 and TLR4 in STAT1 phosphorylation and ISG expression upon egg exposure.

First, we analyzed the phosphorylation state of STAT1 in WT, MyD88-/-, TLR2-/-, and TLR4-/- DCs upon egg stimulation. As represented in Fig. 2A, eggs and LPS induced STAT1 phosphorylation in WT DCs, whereas, as previously demonstrated, Pam3CSK4 was ineffective (not shown). Although TLR2 and MyD88 deficiency did not modify the level of STAT1 phosphorylation induced by either eggs or LPS, TLR4-/- cells failed to trigger STAT1 phosphorylation in response to LPS, but not in response to eggs. Thus, the egg-mediated STAT1 phosphorylation does not involve TLR4- and MyD88-dependent pathways.



View larger version (28K):
[in this window]
[in a new window]
  		FIG. 2.
Effects of TLR4 or MyD88 deficiency on STAT1 phosphorylation and ISG synthesis by BM-DC in responses to live eggs. A, BM-DC from WT, TLR4-/-, TLR2-/-, and MyD88-/- mice were activated by LPS (100 ng/ml) or S. mansoni eggs (1/200 cells). At the indicated time intervals, cells were collected and lysed in Laemmli buffer. Protein extracts were analyzed by direct Western blotting with a specific antibody directed against the phosphorylated form of STAT1(Tyr701). Protein loading was controlled by reprobing the membrane with an Ab directed against unphosphorylated STAT1. One experiment representative of three is shown. B, quantification of IFI204 and GARG39 mRNA expression. RNA was harvested after 4 h of stimulation, and IFI204 and GARG39 mRNA accumulation were measured by real-time RT-PCR. The level of IFI204 and GARG39 mRNA is given as a -fold increase relative to the mRNA levels in unstimulated cells. p < 0.05 (*) or p < 0.005 (**) as compared with mRNA fold induction from WT DCs stimulated by LPS or live eggs.

 
Next, we examined the role of MyD88 and TLR4 in the egg-induced expression of two typical ISGs by real-time RT-PCR. As shown in Fig. 2B, relative to untreated WT DCs, IFI204 and GARG39 mRNA levels were markedly increased 4 h after LPS or egg stimulation. In contrast, LPS failed to induce IFI204 and GARG39 mRNA synthesis in TLR4-/- but not in MyD88-/- DCs. Upon egg stimulation, DCs from either mouse strain were able to induce IFI204 and GARG39 mRNAs synthesis at a level similar to that observed in WT DCs (Fig. 2B). Taken as a whole, these data clearly demonstrate that eggs activate a MyD88-independent pathway in DCs that culminates in ISG production, independently of TLR4 engagement.

S. mansoni Eggs Activate TLR3—To characterize the potential receptor(s) involved in schistosome egg recognition, HEK 293T cells were transiently transfected with plasmids encoding either TLR2, -3, -4, -5, -7, -8, or -9, and their ability to activate an NF-{kappa}B-containing promoter in response to eggs was analyzed. As shown in Fig. 3A, stimulation of TLR-transfected cells with their cognate ligands promoted NF-{kappa}B-mediated luciferase expression. After schistosome egg exposure, a substantial NF-{kappa}B activation was detected in TLR2- and TLR3-transfected cells but not in the other tested transfectants. To confirm these results and because the efficiency of stable transfectants is higher than that of transient transfectants, stable TLR2-, TLR3- and TLR4-expressing HEK 293T cells were used. As shown in Fig. 3B (upper panel), eggs induced a strong NF-{kappa}B-dependent luciferase expression in TLR2 (15-fold)- and TLR3 (5-fold)-but not TLR4-expressing cells. In addition, the ability of eggs to activate the PRDIII-I site from type I IFN-{beta} promoter, which requires IFN regulatory factor-3 binding (30, 31), was further investigated. In accordance with the previous reports, stimulation of TLR3- and TLR4- but not TLR2-expressing cells by their cognate ligands resulted in PRDIII-I activation (Fig. 3B, lower panel). Compared with unstimulated cells, egg exposure induced a strong activation (15-fold) of the PRDIII-I element in TLR3 (but not TLR2 and TLR4)-transfected cells. These results indicate that live eggs selectively activate TLR2 and TLR3 but not the other TLR members tested.



View larger version (19K):
[in this window]
[in a new window]
  		FIG. 3.
Schistosome eggs activate TLR3. A, HEK 293T cells were transiently transfected with 1 µg of NF-{kappa}B reporter plasmid along with TLR2, -3, -4, -5, -7, -8, or -9 expression vectors. After 18 h cells were activated by the corresponding TLR ligands; Pam3CSK4 (10 µg/ml for TLR2), p(I:C) (50 µg/ml for TLR3), LPS (100 ng/ml for TLR4), flagellin (1 µg/ml for TLR5), R848 (1 or 10 µM for TLR7 or TLR8, respectively), and CpG (50 µg/ml for TLR9) or were exposed to S. mansoni eggs (1/200 cells). Luciferase reporter gene activity was measured 18 h after cellular stimulation. Data represent the mean relative stimulation ± S.D. of three independent experiments. *, p < 0.005 as compared with unstimulated cells. B, HEK 293T cells expressing TLR2, TLR3, or TLR4/MD2 were transfected with 1 µg of NF-{kappa}B (upper panel) or PRDIII-I (lower panel) reporter plasmids. After 18 h post-stimulation with cognate ligands or S. mansoni eggs (1/200 cells), luciferase reporter gene activity was measured (one triplicate representative of three experiments is shown).

 
Double-stranded RNA from S. mansoni Eggs Is a Natural Ligand for TLR3—TLR3 was originally described as a pattern recognition receptor recognizing viral dsRNA (21) and certain single-stranded mRNA structures (32, 33). Therefore, we tested the hypothesis that egg-derived RNA could activate TLR3. To do so, total DNase-treated RNA was prepared from eggs and tested for its capacity to activate NF-{kappa}B in HEK 293T cells stably expressing TLR3. Total RNA was delivered in the presence or absence of the cationic liposome DOTAP, which facilitates the uptake of RNA (23). As shown in Fig. 4A, egg RNA complexed to DOTAP dose-dependently activated NF-{kappa}B transcriptional activity with a maximal capacity at 10 µg/ml. In addition, egg RNA alone also induced TLR3-specific NF-{kappa}B reporter activity, albeit with a lesser efficiency (Fig. 4A). It should be noted that the lack of responsiveness of cells expressing either TLR2 or TLR4 confirmed that the RNA fractions were free of endotoxin and other carryover contaminations resulting during RNA isolation (Supplemental Fig. S1).



View larger version (20K):
[in this window]
[in a new window]
  		FIG. 4.
Egg-derived dsRNA is a natural ligand for TLR3. A, TLR3 mediates NF-{kappa}B activation in response to egg-derived RNA. TLR3 stably expressing HEK 293T cells were transfected with 1 µg of NF-{kappa}B reporter plasmid. After 18 h, cells were activated by graded concentrations of total egg-derived RNA complexed to DOTAP, egg RNA (10 µg/ml) alone, or were left untreated for a further 18 h. Luciferase reporter gene activity was measured (one triplicate representative of three experiments is shown). B, egg-derived RNA contains dsRNA structures that activate TLR3. HEK 293T cells expressing TLR3 were activated either with egg-derived RNA (10 µg/ml) or p(I:C) (50 µg/ml) complexed to DOTAP after pretreatments with RNase A (+salt), RNase A (-salt), or RNase III (+salt) (described under "Experimental Procedures") or were left untreated for further 18 h. Luciferase reporter gene activity was measured (one triplicate representative of three experiments is shown).

 
We next attempted to determine the nature of the RNA species responsible for TLR3 stimulatory ability by analyzing the effects of different types of RNases on total egg-derived RNA. To this end, total egg RNA was subjected to treatments either by E. coli RNase III, a dsRNA-specific enzyme homologous to Dicer that effectively cleaves and processes double strand-containing RNA structures or by RNase A, an endoribonuclease that degrades primarily single stranded RNA but can as well process dsRNA structures in low salt concentrations (34–37). Because under physiological salt conditions dsRNA is resistant to the action of RNase A (38), we have taken advantage of this phenomenon to investigate the susceptibility of egg RNA to RNases under varying salt concentrations. Treated egg RNA was next analyzed for its ability to activate NF-{kappa}B promoter in cells stably expressing TLR3. As a control, p(I:C), a synthetic mimic of dsRNA, was used. As shown in Fig. 4B, stimulation of TLR3-expressing cells with p(I:C) or p(I:C)-pretreated with RNase A (in high salt) resulted in NF-{kappa}B activation, demonstrating that this treatment conserves dsRNA structures. In contrast, RNase A (in low salt) or RNase III (in high salt) diminished the ability of p(I:C) to activate cells. Similarly, treatment with RNase A (in high salt) did not affect the ability of total egg RNA to activate TLR3-transfected cells, albeit with slightly decreased efficacy compared with total RNA. In contrast, RNase A (in low salt) or RNase III (in high salt) markedly impaired the capacity of egg RNA to activate cells. We, therefore, conclude that potential dsRNA-like structures preexisting in egg-derived RNA can activate TLR3.

S. mansoni Egg-derived dsRNA Activate DCs via TLR3—We next investigated whether S. mansoni eggs and egg-derived dsRNA structures activate DCs via TLR3. To achieve this, WT and TLR3-/- DCs were stimulated with live eggs or with egg-derived RNA treated with RNase A (in high salt) (referred as dsRNA), and the level of STAT1 phosphorylation was measured. As observed in Fig. 5A, p(I:C), eggs, and egg-derived dsRNA triggered phosphorylation of STAT1 (Tyr701) in WT DCs. In contrast, the response to p(I:C) and egg-derived dsRNA was ablated in TLR3-/- DCs. Under the same conditions, egg-mediated STAT1 phosphorylation was strongly reduced, but not fully abrogated, in TLR3-/- DCs as compared with WT counterparts.



View larger version (29K):
[in this window]
[in a new window]
  		FIG. 5.
Eggs and egg-derived dsRNA activate BM-DC via TLR3. A–C, BM-DCs from WT and TLR3-/- mice were activated by p(I:C) (50 µg/ml), egg-derived dsRNA (10 µg/ml), or live eggs (1/200 cells). A, TLR3 is required for egg and egg-derived dsRNA-mediated STAT1 phosphorylation. At the indicated time intervals, cells were collected and lysed in Laemmli buffer. Protein extracts were analyzed by direct Western blotting with antibodies directed against phosphorylated (Tyr701) or nonphosphorylated forms of STAT-1. One experiment representative of three is shown. B, egg dsRNA induces ISG expression through TLR3. At 4 h after cellular stimulation, mRNA was extracted, reverse-transcribed, and amplified by quantitative real-time PCR using primers specific for IFI204, GARG39, or glyceraldehyde-3-phosphate dehydrogenase. The level of IFI204 and GARG39 mRNA is given as a fold increase relative to the mRNA levels in unstimulated cells. One experiment representative of three is shown. p < 0.05 (*) or p < 0.005 (**) as compared with mRNA induction from WT DCs stimulated by eggs, egg-dsRNA, or p(I:C). C, TLR3 mediates cytokine production by egg dsRNA or eggs. IL-12p40 and TNF-{alpha} production in culture supernatants were analyzed by enzyme-linked immunosorbent assay. Data represent the means ± S.E. of three independent experiments. *, p < 0.05 as compared with cytokine production from WT DCs stimulated by eggs, egg-dsRNA, or p(I:C).

 
To validate this finding, IFI204 and GARG39 mRNA levels were quantified by real time RT-PCR. As represented in Fig. 5B, relative to untreated cells, p(I:C) induced a dramatic increase in IFI204 and GARG39 transcripts in DCs from WT but not from TLR3-/- mice. Similarly, levels of these mRNAs were markedly increased in WT DCs after egg dsRNA or egg exposure. Interestingly, TLR3 deficiency resulted in a complete loss of ISG mRNA up-regulation upon egg dsRNA stimulation, similar to that observed with p(I:C)-activated TLR3-/- DCs. On the other hand, IFI204 and GARG39 mRNA up-regulation was strongly reduced, but not fully abrogated, in TLR3-/- DCs in response to live eggs.

The secretion of TNF-{alpha} and IL-12p40 production was also determined in WT and TLR3-/- DCs in response to eggs and egg-derived dsRNA. As observed in Fig. 5C, IL-12p40 and TNF-{alpha} production upon p(I:C) and egg-derived dsRNA stimulation was inhibited in TLR3-/- DCs compared with WT counterparts. Under the same conditions and compared with WT cells, TLR3-/- DCs exhibited a reduced capacity to elicit TNF-{alpha} and IL-12p40 production upon egg contact. Taken as a whole, our results demonstrate that egg-derived dsRNA activates DCs through a fully TLR3-dependent pathway. Moreover, live eggs also activate DCs, in part via TLR3.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
TLR activation by pathogens is one of the main pathways through which DCs become activated during infections (39). In vivo studies clearly show that myeloid DCs become activated after encountering Schistosoma (40, 41), including egg components (42). Although this phenomenon is presumably due to innate recognition of certain schistosomal products, the molecular mechanisms leading to DC activation as well as the consequences they have in the inflammatory/immune responses are still unclear. Although until now the effects of live eggs on TLR activation have not been investigated, two independent studies have shown the implication of TLR2 and TLR4 in the recognition of certain egg components (17, 18). Recently, using a genome-wide expression study, we found that live eggs induce a transcriptional program in myeloid DCs that culminates in the production of many IFN-induced inflammatory gene products (16). In the present study, we have taken a genetic and molecular approach to identify the TLR members involved in this phenomenon. Remarkably, our data show for the first time that TLR3 can be activated by an extracellular pathogen and that double strand-containing RNA structures from the helminth parasite Schistosoma may act as an inducer of the innate immune system.

First, we showed that MyD88, an important molecule involved in TLR signaling, is implicated but not essential in DC activation by live eggs. Indeed, the kinetics of NF-{kappa}B activation was delayed but not abrogated in MyD88-/- DCs in comparison to that observed in WT counterparts. Moreover, although MyD88 deficiency did not affect the egg-induced phenotypic maturation of DCs, as assessed by CD86 or CD40 surface expression (data not shown), it reduced the production of IL-12p40 and TNF-{alpha}. This suggested that, along with MyD88, eggs might also recruit an MyD88-independent pathway in DCs. Because the MyD88-independent pathway triggered by some TLRs (TLR3 and TLR4) is important in ISG synthesis, we decided to investigate the consequences of MyD88 deficiency on the egg-induced IFN/STAT1-dependent pathway. Compared with WT DCs, egg-mediated STAT1 phosphorylation and ISG synthesis were unaffected in MyD88-/- and TLR4-/- DCs. Among TLRs able to induce ISG expression are TLR3, TLR4, and TLR7-9. Because as stated above TLR4 deficiency does not influence the egg-induced ISG synthesis and because TLR7-9 fully depends on MyD88 (27), we postulated that TLR3, a TLR known to be associated with viral dsRNA recognition, may be a good candidate. Transfection assays carried out on cells expressing distinct TLR members confirmed this hypothesis (Fig. 3). On the other hand, eggs do not activate TLR4 in HEK 293T-transfected cells nor in DCs, a finding that is not in agreement with recent data reported by Thomas et al (18). These observed differences could be attributable to a lack of accessibility of the lacto-N-fucopentaose III determinant to DCs when they are exposed to live eggs. Another possibility is that live eggs express components capable of interfering with TLR4 signaling, as recently suggested (43, 44). In accordance with van der Kleij et al (17), however, we confirmed that eggs activate TLR2 (at least in transfected cells, Fig. 3), although this pathway does not appear to account for the egg-mediated IL-12p40 and TNF-{alpha} production by murine DCs.

Therefore, TLR2 and TLR3, but not the other TLR members tested, appear to be selectively activated by live eggs. To the best of our knowledge, this is the first time that TLR3 has been described to be activated by a non-viral pathogen. Because ligands for TLR3 include single-stranded RNA (32, 33) and dsRNA (21, 27) structures, we attempted to validate our finding by testing the ability of egg-derived RNA to activate TLR3 in transfected cells. By the use of different types of RNases, we provided evidence for the existence of dsRNA structures that are necessary for activating TLR3, whereas single-stranded RNA structures appear dispensable. More importantly, we found that the exogenous addition of egg dsRNA activated not only ISG expression (at least in part via STAT1 phosphorylation) but also classical cytokines produced during DC activation through a fully TLR-dependent pathway. This indicates that other molecules known to trigger immune responses to intracellular dsRNA such as protein kinase R, a cytosolic kinase activated by autophosphorylation on binding to dsRNA (45–47) or the RNA helicase retinoic acid inducible gene I (48), are not required for this response. Our data also show that TLR3 is in part involved in DC activation (STAT1 phosphorylation, cytokine production) when DCs encounter live eggs. However, it is clear from our studies that TLR3 does not fully account for DC activation in response to live eggs since TLR3-/- DCs still produce substantial amounts of IL-12p40, TNF-{alpha}, and ISGs. The differences in TLR3 dependence observed between egg dsRNA versus whole eggs can be attributed to the engagement of additional pattern recognition receptors upon egg exposure.

There are several possibilities that may explain the occurrence of dsRNA structures in Schistosoma eggs. First, recent genome analysis (49) suggests that Schistosoma express the components of the protein machinery necessary for RNA interference, a dsRNA-dependent posttranscriptional gene silencing process known to inhibit the expression of unwanted genes (35, 50, 51). Although it is still unknown whether these helminths exploit such RNA-processing mechanisms, the effectiveness of RNA interference using exogenous dsRNA introduced to silence gene expression in S. mansoni is strongly indicative of an active posttranscriptional gene-silencing mechanism in schistosomes (52). Another possibility, among others, is the existence of transposon-derived dsRNA in Schistosoma eggs. It is indeed demonstrated that there are large numbers of repetitive elements in the S. mansoni genome, in particular the retroposon Sm{alpha}, a hammerhead ribozyme that forms transcripts with a high degree of secondary structures containing a large proportion of double-stranded regions (53, 54). Understanding how these dsRNA structures become available to DCs (in vitro and in vivo), however, requires further study.

In conclusion, we propose that eggs from the extracellular parasite S. mansoni may activate innate immunity through TLR2 and TLR3. During DC contact with eggs, TLR2 and TLR3 may act in concert and impact innate and adaptive immune responses in a cumulative manner. Therefore, future work is required to clarify the respective role of TLR2 and TLR3 on the ensuing immune response during schistosomiasis. Finally, the existence of dsRNA structures in helminths exhibiting strong immunostimulatory potential to promote DC maturation through TLR3 further implicates the adjuvanticity of dsRNA from eukaryotic pathogens in general.


   FOOTNOTES
 
* The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

{boxs} The on-line version of this article (available at http://www.jbc.org) contains Supplemental Fig. S1. Back

Supported by a Belgium Télevie grant. Back

|| Supported by a French Ministry of National Education, Research, and Technology grant. Back

¶¶ To whom correspondence should be addressed: Centre d'Immunologie et Biologie Parasitaire, INSERM U547, 1 rue du Professeur Calmette, Institut Pasteur de LILLE, 59019 Lille, France. Tel.: 33-3-20-877-885; Fax: 33-3-20-877-888; E-mail: francois.trottein{at}pasteurlille.fr.

1 The abbreviations used are: DC, dendritic cell; BM, bone marrow; TLR, Toll-like receptor; MyD88, myeloid differentiation factor 88; STAT, signaling transducer activator of transcription; INF, interferon; ISG, IFN-stimulated gene; GARG, glucocorticoid-attenuated response gene; p(I:C), polyinosine-polycytidylic acid; PRD, positive regulatory domain; ds, double-stranded; IL, interleukin; TNF, tumor necrosis factor; DOTAP, N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium methyl sulfate; WT, wild type; LPS, lipopolysaccharide; HEK cells, human embryonic kidney cells; RT, reverse transcription. Back


   ACKNOWLEDGMENTS
 
We thank Drs. S. Akira (Department of Host Defense, Osaka, Japan) and R. Flavell (Section of Immunobiology, Yale University School of Medicine, Howard Hughes Medical Institute, New Haven, CT) for the generous supply of breeding pairs of mutant mice strains. TLR4/MD2-, TLR3-, and TLR2–293T cells were gifts from Dr. D. Golenbock (Division of Infectious Disease and Immunology, University of Massachusetts Medical School, Worcester, MA), and the granulocyte-macrophage colony-stimulating factor-producing cells were from Prof. D. Gray (University of Edinburgh, Edinburgh, UK). We also thank Drs, Y. Delneste (INSERM U564, Angers), J. C. Sirard (Institut Pasteur de Lille), and H. Wagner (Institute of Medical Microbiology, Munich, Germany) for providing the plasmids encoding TLRs. C. Faveeuw, C. Vendeville, and T. Mallevaey are greatly acknowledged for their technical help and stimulatory discussions and Dr. R. Pierce for the critical reading of the manuscript. We have no conflicting financial interests.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Banchereau, J., and Steinman, R. M. (1998) Nature 392, 245-252[CrossRef][Medline] [Order article via Infotrieve]
  2. Steinman, R. M. (1991) Annu. Rev. Immunol. 9, 271-296[CrossRef][Medline] [Order article via Infotrieve]
  3. Kapsenberg, M. L. (2003) Nat. Rev. Immunol. 3, 984-993[CrossRef][Medline] [Order article via Infotrieve]
  4. Janeway, C. A., Jr. (1992) Immunol. Today 13, 11-16[CrossRef][Medline] [Order article via Infotrieve]
  5. Akira, S., and Takeda, K. (2004) Nat. Rev. Immunol. 4, 499-511[CrossRef][Medline] [Order article via Infotrieve]
  6. Kawai, T., Takeuchi, O., Fujita, T., Inoue, J., Muhlradt, P. F., Sato, S., Hoshino, K., and Akira, S. (2001) J. Immunol. 167, 5887-5894[Abstract/Free Full Text]
  7. Doyle, S., Vaidya, S., O'Connell, R., Dadgostar, H., Dempsey, P., Wu, T., Rao, G., Sun, R., Haberland, M., Modlin, R., and Cheng, G. (2002) Immunity 17, 251-263[CrossRef][Medline] [Order article via Infotrieve]
  8. Yamamoto, M., Sato, S., Mori, K., Hoshino, K., Takeuchi, O., Takeda, K., and Akira, S. (2002) J. Immunol. 169, 6668-6672[Abstract/Free Full Text]
  9. Sakaguchi, S., Negishi, H., Asagiri, M., Nakajima, C., Mizutani, T., Takaoka, A., Honda, K., and Taniguchi, T. (2003) Biochem. Biophys. Res. Commun. 306, 860-866[CrossRef][Medline] [Order article via Infotrieve]
  10. Oshiumi, H., Matsumoto, M., Funami, K., Akazawa, T., and Seya, T. (2003) Nat. Immunol. 4, 161-167[CrossRef][Medline] [Order article via Infotrieve]
  11. Fitzgerald, K. A., Rowe, D. C., Barnes, B. J., Caffrey, D. R., Visintin, A., Latz, E., Monks, B., Pitha, P. M., and Golenbock, D. T. (2003) J. Exp. Med. 198, 1043-1055[Abstract/Free Full Text]
  12. Yamamoto, M., Sato, S., Hemmi, H., Hoshino, K., Kaisho, T., Sanjo, H., Takeuchi, O., Sugiyama, M., Okabe, M., Takeda, K., and Akira, S. (2003) Science 301, 640-643[Abstract/Free Full Text]
  13. Hoebe, K., Du, X., Georgel, P., Janssen, E., Tabeta, K., Kim, S. O., Goode, J., Lin, P., Mann, N., Mudd, S., Crozat, K., Sovath, S., Han, J., and Beutler, B. (2003) Nature 424, 743-748[CrossRef][Medline] [Order article via Infotrieve]
  14. Gao, J. J., Filla, M. B., Fultz, M. J., Vogel, S. N., Russell, S. W., and Murphy, W. J. (1998) J. Immunol. 161, 4803-4810[Abstract/Free Full Text]
  15. Toshchakov, V., Jones, B. W., Perera, P. Y., Thomas, K., Cody, M. J., Zhang, S., Williams, B. R., Major, J., Hamilton, T. A., Fenton, M. J., and Vogel, S. N. (2002) Nat. Immunol. 3, 392-398[CrossRef][Medline] [Order article via Infotrieve]
  16. Trottein, F., Pavelka, N., Vizzardelli, C., Angeli, V., Zouain, C. S., Pelizzola, M., Capozzoli, M., Urbano, M., Capron, M., Belardelli, F., Granucci, F., and Ricciardi-Castagnoli, P. (2004) J. Immunol. 172, 3011-3017[Abstract/Free Full Text]
  17. van der Kleij, K. D., Latz, E., Brouwers, J. F., Kruize, Y. C., Schmitz, M., Kurt-Jones, E. A., Espevik, T., de Jong, E. C., Kapsenberg, M. L., Golenbock, D. T., Tielens, A. G., and Yazdanbakhsh, M. (2002) J. Biol. Chem. 277, 48122-48129[Abstract/Free Full Text]
  18. Thomas, P. G., Carter, M. R., Atochina, O., Da'Dara, A. A., Piskorska, D., McGuire, E., and Harn, D. A. (2003) J. Immunol. 171, 5837-5841[Abstract/Free Full Text]
  19. Kawai, T., Adachi, O., Ogawa, T., Takeda, K., and Akira, S. (1999) Immunity 11, 115-122[CrossRef][Medline] [Order article via Infotrieve]
  20. Takeuchi, O., Hoshino, K., Kawai, T., Sanjo, H., Takada, H., Ogawa, T., Takeda, K., and Akira, S. (1999) Immunity 11, 443-451[CrossRef][Medline] [Order article via Infotrieve]
  21. Alexopoulou, L., Holt, A. C., Medzhitov, R., and Flavell, R. A. (2001) Nature 413, 732-738[CrossRef][Medline] [Order article via Infotrieve]
  22. Lutz, M. B., Kukutsch, N., Ogilvie, A. L., Rossner, S., Koch, F., Romani, N., and Schuler, G. (1999) J. Immunol. Methods 223, 77-92[CrossRef][Medline] [Order article via Infotrieve]
  23. Heil, F., Hemmi, H., Hochrein, H., Ampenberger, F., Kirschning, C., Akira, S., Lipford, G., Wagner, H., and Bauer, S. (2004) Science 303, 1526-1529[Abstract/Free Full Text]
  24. Latz, E., Visintin, A., Lien, E., Fitzgerald, K. A., Monks, B. G., Kurt-Jones, E. A., Golenbock, D. T., and Espevik, T. (2002) J. Biol. Chem. 277, 47834-47843[Abstract/Free Full Text]
  25. Osborn, L., Kunkel, S., and Nabel, G. J. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 2336-2340[Abstract/Free Full Text]
  26. Van Lint, C., Amella, C. A., Emiliani, S., John, M., Jie, T., and Verdin, E. (1997) J. Virol. 71, 6113-6127[Abstract]
  27. Takeda, K., Kaisho, T., and Akira, S. (2003) Annu. Rev. Immunol. 21, 335-376[CrossRef][Medline] [Order article via Infotrieve]
  28. Yamamoto, M., Takeda, K., and Akira, S. (2004) Mol. Immunol. 40, 861-868[CrossRef][Medline] [Order article via Infotrieve]
  29. Karin, M., and Ben Neriah, Y. (2000) Annu. Rev. Immunol. 18, 621-663[CrossRef][Medline] [Order article via Infotrieve]
  30. Fitzgerald, K. A., McWhirter, S. M., Faia, K. L., Rowe, D. C., Latz, E., Golenbock, D. T., Coyle, A. J., Liao, S. M., and Maniatis, T. (2003) Nat. Immunol. 4, 491-496[CrossRef][Medline] [Order article via Infotrieve]
  31. Schafer, S. L., Lin, R., Moore, P. A., Hiscott, J., and Pitha, P. M. (1998) J. Biol. Chem. 273, 2714-2720[Abstract/Free Full Text]
  32. Kariko, K., Ni, H., Capodici, J., Lamphier, M., and Weissman, D. (2004) J. Biol. Chem. 279, 12542-12550[Abstract/Free Full Text]
  33. Kariko, K., Bhuyan, P., Capodici, J., and Weissman, D. (2004) J. Immunol. 172, 6545-6549[Abstract/Free Full Text]
  34. Danin-Kreiselman, M., Lee, C. Y., and Chanfreau, G. (2003) Mol. Cell 11, 1279-1289[CrossRef][Medline] [Order article via Infotrieve]
  35. Sijen, T., and Plasterk, R. H. (2003) Nature 426, 310-314[CrossRef][Medline] [Order article via Infotrieve]
  36. Yang, D., Buchholz, F., Huang, Z., Goga, A., Chen, C. Y., Brodsky, F. M., and Bishop, J. M. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, 9942-9947[Abstract/Free Full Text]
  37. Nicholson, A. W. (1999) FEMS Microbiol. Rev. 23, 371-390[CrossRef][Medline] [Order article via Infotrieve]
  38. Libonati, M., and Sorrentino, S. (1992) Mol. Cell. Biochem. 117, 139-151[CrossRef][Medline] [Order article via Infotrieve]
  39. Reis e Sousa, C. (2004) Curr. Opin. Immunol. 16, 21-25[CrossRef][Medline] [Order article via Infotrieve]
  40. Angeli, V., Faveeuw, C., Roye, O., Fontaine, J., Teissier, E., Capron, A., Wolowczuk, I., Capron, M., and Trottein, F. (2001) J. Exp. Med. 193, 1135-1147[Abstract/Free Full Text]
  41. Straw, A. D., MacDonald, A. S., Denkers, E. Y., and Pearce, E. J. (2003) J. Immunol. 170, 727-734[Abstract/Free Full Text]
  42. Chiu, B. C., Freeman, C. M., Stolberg, V. R., Hu, J. S., Komuniecki, E., and Chensue, S. W. (2004) Am. J. Pathol. 164, 1021-1030[Abstract/Free Full Text]
  43. Zaccone, P., Fehervari, Z., Jones, F. M., Sidobre, S., Kronenberg, M., Dunne, D. W., and Cooke, A. (2003) Eur. J. Immunol. 33, 1439-1449[CrossRef][Medline] [Order article via Infotrieve]
  44. Cervi, L., MacDonald, A. S., Kane, C., Dzierszinski, F., and Pearce, E. J. (2004) J. Immunol. 172, 2016-2020[Abstract/Free Full Text]
  45. Jacobs, B. L., and Langland, J. O. (1996) Virology 219, 339-349[CrossRef][Medline] [Order article via Infotrieve]
  46. Williams, B. R. (1999) Oncogene 18, 6112-6120[CrossRef][Medline] [Order article via Infotrieve]
  47. Balachandran, S., Roberts, P. C., Brown, L. E., Truong, H., Pattnaik, A. K., Archer, D. R., and Barber, G. N. (2000) Immunity 13, 129-141[CrossRef][Medline] [Order article via Infotrieve]
  48. Yoneyama, M., Kikuchi, M., Natsukawa, T., Shinobu, N., Imaizumi, T., Miyagishi, M., Taira, K., Akira, S., and Fujita, T. (2004) Nat. Immunol. 5, 730-737[CrossRef][Medline] [Order article via Infotrieve]
  49. Verjovski-Almeida, S., DeMarco, R., Martins, E. A., Guimaraes, P. E., Ojopi, E. P., Paquola, A. C., Piazza, J. P., Nishiyama, M. Y., Jr., Kitajima, J. P., Adamson, R. E., Ashton, P. D., Bonaldo, M. F., Coulson, P. S., Dillon, G. P., Farias, L. P., Gregorio, S. P., Ho, P. L., Leite, R. A., Malaquias, L. C., Marques, R. C., Miyasato, P. A., Nascimento, A. L., Ohlweiler, F. P., Reis, E. M., Ribeiro, M. A., Sa, R. G., Stukart, G. C., Soares, M. B., Gargioni, C., Kawano, T., Rodrigues, V., Madeira, A. M., Wilson, R. A., Menck, C. F., Setubal, J. C., Leite, L. C., and Dias-Neto, E. (2003) Nat. Genet. 35, 148-157[CrossRef][Medline] [Order article via Infotrieve]
  50. He, L., and Hannon, G. J. (2004) Nat. Rev. Genet. 5, 522-531[CrossRef][Medline] [Order article via Infotrieve]
  51. Tijsterman, M., May, R. C., Simmer, F., Okihara, K. L., and Plasterk, R. H. (2004) Curr. Biol. 14, 111-116[CrossRef][Medline] [Order article via Infotrieve]
  52. Boyle, J. P., and Yoshino, T. P. (2003) Int. J. Parasitol. 33, 1259-1268[CrossRef][Medline] [Order article via Infotrieve]
  53. Vazquez-Tello, A., Castan, P., Moreno, R., Smith, J. M., Berenguer, J., and Cedergren, R. (2002) Nucleic Acids Res. 30, 1606-1612[Abstract/Free Full Text]
  54. Ferbeyre, G., Smith, J. M., and Cedergren, R. (1998) Mol. Cell. Biol. 18, 3880-3888[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 Infect. Immun.Home page
C. M. Kane, E. Jung, and E. J. Pearce
Schistosoma mansoni Egg Antigen-Mediated Modulation of Toll-Like Receptor (TLR)-Induced Activation Occurs Independently of TLR2, TLR4, and MyD88
Infect. Immun., December 1, 2008; 76(12): 5754 - 5759.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
F. A. Marshall and E. J. Pearce
Uncoupling of Induced Protein Processing from Maturation in Dendritic Cells Exposed to a Highly Antigenic Preparation from a Helminth Parasite
J. Immunol., December 1, 2008; 181(11): 7562 - 7570.
[Abstract] [Full Text] [PDF]

Home page
 Infect. Immun.Home page
F. F. Tuon, V. S. Amato, H. A. Bacha, T. AlMusawi, M. I. Duarte, and V. Amato Neto
Toll-Like Receptors and Leishmaniasis
Infect. Immun., March 1, 2008; 76(3): 866 - 872.
[Full Text] [PDF]

Home page
 J. Leukoc. Biol.Home page
A. D. Joshi, T. Raymond, A. L. Coelho, S. L. Kunkel, and C. M. Hogaboam
A systemic granulomatous response to Schistosoma mansoni eggs alters responsiveness of bone marrow-derived macrophages to Toll-like receptor agonists
J. Leukoc. Biol., February 1, 2008; 83(2): 314 - 324.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
D. Torres, C. Paget, J. Fontaine, T. Mallevaey, T. Matsuoka, T. Maruyama, S. Narumiya, M. Capron, P. Gosset, C. Faveeuw, et al.
Prostaglandin D2 Inhibits the Production of IFN-{gamma} by Invariant NK T Cells: Consequences in the Control of B16 Melanoma
J. Immunol., January 15, 2008; 180(2): 783 - 792.
[Abstract] [Full Text] [PDF]

Home page
 Infect. Immun.Home page
L. Breuilh, F. Vanhoutte, J. Fontaine, C. M. W. van Stijn, I. Tillie-Leblond, M. Capron, C. Faveeuw, T. Jouault, I. van Die, P. Gosset, et al.
Galectin-3 Modulates Immune and Inflammatory Responses during Helminthic Infection: Impact of Galectin-3 Deficiency on the Functions of Dendritic Cells
Infect. Immun., November 1, 2007; 75(11): 5148 - 5157.
[Abstract] [Full Text] [PDF]

Home page
 Infect. Immun.Home page
T. Mallevaey, J. Fontaine, L. Breuilh, C. Paget, A. Castro-Keller, C. Vendeville, M. Capron, M. Leite-de-Moraes, F. Trottein, and C. Faveeuw
Invariant and Noninvariant Natural Killer T Cells Exert Opposite Regulatory Functions on the Immune Response during Murine Schistosomiasis
Infect. Immun., May 1, 2007; 75(5): 2171 - 2180.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
C. Sullivan, J. H. Postlethwait, C. R. Lage, P. J. Millard, and C. H. Kim
Evidence for Evolving Toll-IL-1 Receptor-Containing Adaptor Molecule Function in Vertebrates
J. Immunol., April 1, 2007; 178(7): 4517 - 4527.
[Abstract] [Full Text] [PDF]

Home page
 Hum ReprodHome page
K. Nasu, H. Itoh, A. Yuge, M. Nishida, and H. Narahara
Human oviductal epithelial cells express Toll-like receptor 3 and respond to double-stranded RNA: Fallopian tube-specific mucosal immunity against viral infection
Hum. Reprod., February 1, 2007; 22(2): 356 - 361.
[Abstract] [Full Text] [PDF]

Home page
 Infect. Immun.Home page
B. W. McConchie, H. H. Norris, V. G. Bundoc, S. Trivedi, A. Boesen, J. F. Urban Jr., and A. M. Keane-Myers
Ascaris suum-Derived Products Suppress Mucosal Allergic Inflammation in an Interleukin-10-Independent Manner via Interference with Dendritic Cell Function
Infect. Immun., December 1, 2006; 74(12): 6632 - 6641.
[Abstract] [Full Text] [PDF]

Home page
 Infect. Immun.Home page
J. J. Reece, M. C. Siracusa, and A. L. Scott
Innate Immune Responses to Lung-Stage Helminth Infection Induce Alternatively Activated Alveolar Macrophages
Infect. Immun., September 1, 2006; 74(9): 4970 - 4981.
[Abstract] [Full Text] [PDF]

Home page
 CVIHome page
Z. Wang, L. Xiang, J. Shao, and Z. Yuan
The 3' CCACCA Sequence of tRNAAla(UGC) Is the Motif That Is Important in Inducing Th1-Like Immune Response, and This Motif Can Be Recognized by Toll-Like Receptor 3.
Clin. Vaccine Immunol., July 1, 2006; 13(7): 733 - 739.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
T. Mallevaey, J. P. Zanetta, C. Faveeuw, J. Fontaine, E. Maes, F. Platt, M. Capron, M. L. de-Moraes, and F. Trottein
Activation of Invariant NKT Cells by the Helminth Parasite Schistosoma mansoni
J. Immunol., February 15, 2006; 176(4): 2476 - 2485.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
D. J. Groskreutz, M. M. Monick, L. S. Powers, T. O. Yarovinsky, D. C. Look, and G. W. Hunninghake
Respiratory Syncytial Virus Induces TLR3 Protein and Protein Kinase R, Leading to Increased Double-Stranded RNA Responsiveness in Airway Epithelial Cells
J. Immunol., February 1, 2006; 176(3): 1733 - 1740.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
O. de Bouteiller, E. Merck, U. A. Hasan, S. Hubac, B. Benguigui, G. Trinchieri, E. E. M. Bates, and C. Caux
Recognition of Double-stranded RNA by Human Toll-like Receptor 3 and Downstream Receptor Signaling Requires Multimerization and an Acidic pH
J. Biol. Chem., November 18, 2005; 280(46): 38133 - 38145.
[Abstract] [Full Text] [PDF]

Home page
 Int ImmunolHome page
S. J. Jenkins, J. P. Hewitson, S. Ferret-Bernard, and A. P. Mountford
Schistosome larvae stimulate macrophage cytokine production through TLR4-dependent and -independent pathways
Int. Immunol., November 1, 2005; 17(11): 1409 - 1418.
[Abstract] [Full Text] [PDF]

Home page
 JEMHome page
G. Gautier, M. Humbert, F. Deauvieau, M. Scuiller, J. Hiscott, E. E.M. Bates, G. Trinchieri, C. Caux, and P. Garrone
A type I interferon autocrine-paracrine loop is involved in Toll-like receptor-induced interleukin-12p70 secretion by dendritic cells
J. Exp. Med., May 2, 2005; 201(9): 1435 - 1446.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
280/1/277    most recent
M411223200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Aksoy, E.
Right arrow Articles by Trottein, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Aksoy, E.
Right arrow Articles by Trottein, F.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2005 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement