Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M406367200 on October 26, 2004

J. Biol. Chem., Vol. 280, Issue 1, 564-570, January 7, 2005
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
280/1/564    most recent
M406367200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Akerman, S. E.
Right arrow Articles by Müller, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Akerman, S. E.
Right arrow Articles by Müller, S.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Peroxiredoxin-linked Detoxification of Hydroperoxides in Toxoplasma gondii*

Susan E. Akerman{ddagger}§ and Sylke Müller§||

From the {ddagger}Division of Biological Chemistry and Molecular Microbiology, School of Life Sciences, University of Dundee, Dundee DD1 5EH, United Kingdom and §Infection and Immunity, Institute of Biomedical and Life Sciences, University of Glasgow, Glasgow G12 8QQ, United Kingdom

Received for publication, June 8, 2004 , and in revised form, September 30, 2004.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
The apicomplexan parasite Toxoplasma gondii is highly susceptible to oxidative stress caused by tert-butyl-hydroperoxide, juglone, and phenazine methylsulfate with IC50 in the nanomolar range. Using dichlorofluorescein diacetate, a detector of endogenous oxidative stress, it was shown that juglone and phenazine methylsulfate are potentially toxic to the parasites without affecting the host cells. These results demonstrate that T. gondii is vulnerable to oxidative challenge that results from disruption of its redox balance and so this could be an effective approach to therapeutic intervention. This study has characterized redox active and antioxidant peroxidases belonging to the class of 1-Cys and 2-Cys peroxiredoxins that play crucial roles in maintaining redox balance. The tachyzoite stages of T. gondii express thioredoxin (TgTrx), 1-Cys peroxiredoxin (TgTrx-Px2), and a 2-Cys peroxiredoxin (TgTrx-Px1) and immunofluorescent studies revealed that all three proteins are located in the cytosol of the parasite confirming previous studies on TgTrx-Px1 (Kwok, L.Y., Schlüter, D., Clayton, C., and Soldati, D. (2004) Mol. Microbiol. 51, 47-61). TgTrx-Px1 showed Km values for H2O2 and tert-butyl hydroperoxide in the nanomolar range, emphasizing the great affinity of the protein for theses substrates. Moreover, the catalytic efficiency of TgTrx-Px1 for these substrates at 106-107 M-1 s-1 is unusually high, which qualifies the enzyme as an extremely potent antioxidant. Kinetic analyses revealed that TgTrx-Px1 is inhibited by tert-butyl hydroperoxide, and apparent inhibition constants were determined to be between 33 and 35.6 µM depending on the concentration of the non-inhibitory substrate thioredoxin. TgTrx-Px2 protected glutamine synthetase from inactivation by Fe3+/DTT, showing that it is an active peroxiredoxin.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Peroxiredoxins (Trx-Px)1 are a family of antioxidant enzymes that protect cells from oxidative damage by hydroperoxides (1, 2). The enzymes are peroxidases that exert their reductive activity via active site cysteine residues. This group of proteins can structurally be distinguished into three classes: the typical 2-Cys peroxiredoxins, the atypical 2-Cys peroxiredoxins, and the 1-Cys peroxiredoxins (2). Atypical 2-Cys peroxiredoxins have only been identified recently and they differ from typical 2-Cys peroxiredoxins by forming an intramolecular disulfide bridge during their catalytic cycle rather than an intermolecular disulfide bridge like typical peroxiredoxins (2, 3). The abundance of typical 2-Cys peroxiredoxins can be extraordinarily high, possibly compensating for their rather low catalytic efficiency when compared with other peroxidases such as catalase and glutathione-dependent peroxidases (1, 2). In addition to their protective antioxidant role, it has been suggested that 2-Cys peroxiredoxins are involved in redox signaling and other regulatory processes (2, 4-6). Thus this class of enzymes has a wide variety of functions that are vital for metabolism and cellular integrity. The role of the 1-Cys peroxiredoxins is less clear. Their catalytic mechanism has hardly been studied to date, and the nature of their endogenous reducing partner is controversial (3, 7-9).

Toxoplasma gondii causes toxoplasmosis in warm blooded animals including humans. An infection with T. gondii can be lethal in immunocompromised individuals and presents a particular threat to patients with AIDS/HIV. It is estimated that toxoplasmosis is the cause of death in 10-30% of AIDS patients (10). In addition, an infection with T. gondii in pregnant women leads to the congenital infection of the fetus (11) affecting the central nervous system and leading to a variety of severe disorders. Recently the antioxidant systems of T. gondii have started to attract attention as these might be essential for the adaptation and survival of the parasites in macrophages and other immune effector cells, which probably generate reactive oxygen species to combat the parasites (12, 13). Thus Toxoplasma needs to have effective antioxidant systems to maintain the intracellular redox homeostasis even when the parasite is under oxidant challenge. In previous studies it has been shown that T. gondii possesses a whole array of antioxidant proteins including three superoxide dismutases, catalase, and a variety of putative glutathione- and thioredoxin-dependent peroxidases of the peroxiredoxin family (13-16). The presence of catalase is unusual as other apicomplexan parasites such as Plasmodium (17), and the members of the kinetoplastida lack this protein and other antioxidants appear to compensate for its absence (18, 19). As the disruption of the catalase gene in T. gondii was found to be non-lethal, the enzyme presumably does not have a vital role in the parasite (13). It is feasible that the parasite peroxiredoxins compensate for the loss of catalase and indeed the non-essentiality of catalase suggests that this group of proteins represents the major antioxidant defense system in Toxoplasma. Indeed, it has been shown that the thioredoxin-dependent reduction of hydroperoxides is of vital importance in the related apicomplexan parasite Plasmodium falciparum as thioredoxin reductase is essential for survival of this parasite (20). In this study we have characterized the peroxiredoxin proteins of T. gondii, and the results suggest that the systems involving these proteins play key roles in protecting the parasite against oxidative damage.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Materials—FITC-labeled secondary anti-rat and anti-rabbit antibodies were obtained from Molecular Probes, Leiden, The Netherlands. Polyclonal antibodies were raised against T. gondii thioredoxin (TgTrx) in a rat, T. gondii 1-Cys peroxiredoxin (TgTrx-Px2) and 2-Cys peroxiredoxin (TgTrx-Px1) in rabbits by Eurogentec (Belgium). Genomic and cDNA libraries of T. gondii were obtained from the National Institutes of Health. [3H]Uracil (48 Ci/mmol) was purchased from Amersham Biosciences. P. falciparum thioredoxin reductase was expressed and purified according to Gilberger et al. (21). P. falciparum thioredoxin was expressed and purified according to Krnajski et al. (22). Minimal essential medium (MEM), Dulbecco's modified Eagle's medium, RPMI 1640, penicillin/streptomycin, and fetal calf serum were from Invitrogen. Glutamine synthetase from Escherichia coli was purchased from Sigma. Human foreskin fibroblasts (HFFs) were from LGC Promochem (Teddington, UK).

T. gondii Culture and Determination of IC50 of Oxidative Stressors—T. gondii tachyzoites (RH strain) were maintained on monolayers of HFFs in MEM containing 1% fetal calf serum at 37 °C in 5% CO2 according to Ref. 23. In order to determine the susceptibility of T. gondii to the oxidative stressors tert-butyl-hydroperoxide (t-BuOOH), 5-hydroxy-1,4-naphthoquinone (juglone; Fluka) and the superoxide-generating compound phenazine methylsulfate (Fluka) a monolayer of HFFs was grown in 24-well plates, infected with 1 x 105 parasites per well, and incubated with increasing concentrations of the stressors (0.1 nM to 100 µM). After 24 h, the medium was supplemented with [3H]uracil (2.5 µCi/well) and incubated for an additional 4 h. Then the cells were treated with 0.6 M trichloric acid for 1 h and subsequently washed extensively with excess water overnight. Then the cells were solubilized for 1 h with 500 µl of 0.1 M NaOH before 250 µl of each well are transferred into scintillation vials containing 3 ml of Picofluor scintillation fluid (Packard Bioscience) and the incorporation of [3H]uracil into the ribonucleic acids of the parasites determined by scintillation counting (Beckman LS6500). In a control experiment, non-infected HFFs were treated with increasing concentrations of the three stressors under the same conditions as described for the parasitized cells, and their viability was determined using a Live/Dead assay (Molecular Probes) and subsequent analysis by fluorescent microscopy with an Axiovert 200 M microscope (Zeiss).

2',7'-Dichlorodihydrofluorescein Diacetate (DCF) Assay—HFFs grown on chamber slides (Nunc) were infected with 0.5 x 104 T. gondii and after 24 h exposed to 10 µM juglone or 10 µM phenazine methylsulfate for 15 min. After washing the slides, the cells were incubated for 3-5 min with 0.5 µM DCF, washed extensively with phosphate-buffered saline (PBS), and subsequently fixed using 4% paraformaldehyde. After mounting the slides, the parasites were analyzed using an Axiovert 200 M fluorescence microscope (Zeiss) equipped with AxioCam HRC digital camera (Zeiss).

Isolation of Nucleic Acids and Proteins—In order to isolate genomic DNA and total RNA from T. gondii tachyzoites, they were grown to high density and isolated from lysed HFFs using 0.2 µm Nucleopore Track-Etch membranes (Whatman). Parasites were pelleted and either resuspended in TE buffer (10 mM Tris, pH 7.5, 1 mM EDTA) (for DNA isolation) or TRIzol (Invitrogen) for RNA isolation. In order to obtain parasite proteins, the isolated parasites were resuspended in PBS containing EDTA-free protease mixture (Roche Applied Science) and subsequently lysed by several cycles of freeze-thawing followed by sonication.

Cloning of TgTrx-Px1 (2-Cys Peroxiredoxin), TgTrx-Px2 (1-Cys Peroxiredoxin), and TgTrx—Searching the T. gondii genome data base (www.ToxoDB.org) with the translated amino acids sequences of P. falciparum Trx, PfTrx-Px1 (2-Cys peroxiredoxin) and Pf1-CysTrx-Px (1-Cys peroxiredoxin) revealed the presence of homologues of the three Plasmodium proteins. Oligonucleotides TgTrx-1sense and TgTrx-1antisense (5'-GCGCCATATGCCGGTCCATCACGTCACC-3' and 5'-GCGCGGATCCCTACAAATCCCCGAGACTGTTTGTC-3'), TgTrx-Px1-1 sense and antisense (5'-GCGCCATATGCCGGCCCCGATGGTGTCTCAG-3' and 5'-GCGCCTCGAGAATGAACGAAGGCTCTATGAGG 3') and TgTrx-Px2-1 sense and antisense (5'GCGCCATATGTTGGTCCTCGGCAGCACG3' and 5'GCGCCTCGAGCTACGCCGACGGATCCGGAGC3') were used to amplify the coding regions of the three genes with Pfu polymerase and a T. gondii cDNA library as template. The conditions for the polymerase chain reaction (PCR) were as follows: 1 cycle at 95 °C for 1 min and 30 cycles of 1 min at 95 °C, 1 min 50 to 60 °C, and 1 min at 72 °C followed by an extension cycle at 72 °C for 7 min. The PCR products were cloned into TOPO blunt (Invitrogen), and their sequences were determined by The Sequencing Service (School of Life Sciences, University of Dundee, Scotland, www.dnaseq.co.uk) using Applied Biosystems Big-Dye Ver 3.1 chemistry on an Applied Biosystems model 3730 automated capillary DNA sequencer. In order to recombinantly express the three T. gondii proteins the inserts of the TOPO clones were isolated by restriction digest using NdeI, BamHI, and XhoI as required and subcloned into pJC40 previously digested with the respective restriction enzymes. The sequence of the expression constructs pJC40-TgTrx, pJC40-TgTrx-Px1, and pJC40-TgTrx-Px2 was verified and they were subsequently transformed into E. coli BLR (DE3)-pLys (Novagen).

Recombinant Expression of TgTrx-Px1, TgTrx-Px-2, and TgTrx—Bacteria harboring the expression plasmids were used to inoculate overnight cultures in Luria-Bertani medium containing 50 µg ml-1 ampicillin. The cultures were diluted 1:50 and bacteria grown at 37 °C until their OD600 reached 0.5 before recombinant expression was induced using 1 mM isopropyl-{beta}-thio-D-galactoside. The bacteria were cooled to 27 °C after induction and grown for an additional 18 h before they were harvested at 3500 x g (Beckman J6). Bacterial pellets were resuspended in 50 mM sodium phosphate buffer pH 8.0 containing 300 mM NaCl and 10 mM imidazole (lysis buffer) and lysed by adding 50 µg ml-1 lysozyme, freeze-thawing, and by using a French Press (1000 pounds inch-2; American Instrument Company). The bacterial extract was cleared by centrifugation for 1.5 h at 50,000 x g (Beckman, Avanti, JA-25). The resulting supernatants were applied to Ni2+-agarose, and the subsequent purification of the recombinant proteins was performed in a batch procedure according to the manufacturer's instructions (Qiagen). Protein concentrations were determined using the Bradford method (24) with bovine serum albumin as standard.

Enzyme Assays for Thioredoxin—To test whether T. gondii Trx is a competent substrate of P. falciparum thioredoxin reductase (PfTrxR), the TrxR activity was determined spectrophotometrically using three different assay systems (1). In the insulin assay, the reduction of thioredoxin was coupled to the reduction of insulin as previously described (25, 26). The second assay system was performed using a fast kinetics instrument (SFA-20, Hi-Tech Scientific) connected to the spectrophotometer (Shimadzu, 2401 PC) in order to determine the initial rates of Trx reduction (27). The assay mixture contained 200 µM NADPH, 100 mM HEPES pH 7.6, 1 mM EDTA, 1 µg of PfTrxR, and increasing concentrations of TgTrx or PfTrx (1-20 µM). Time points were taken every 10 ms, and the initial rates were used to determine the steady-state kinetic parameters for the reduction of both parasite Trxs (3). The third assay system was performed in order to test whether TgTrx also reduces glutathione disulfide (GSSG) as has been previously reported for the proteins from P. falciparum and Drosophila melanogaster (28, 29). The assay conditions were as follows: 5-10 µg of PfTrxR, 1 to 10 µM TgTrx or PfTrx, and 0.025-2 mM GSSG in 100 mM HEPES pH 7.6, 1 mM EDTA, and 200 µM NADPH. The change in absorbance was monitored spectrophotometrically at 340 nm, and the results were used to calculate the second order rate constant k2 according to Equation 1.

(Eq. 1)

Further whether TgTrx and PfTrx are reduced by dihydrolipoamide dehydrogenase (LipDH) and dihydrolipoamide was tested. The assay systems contained 200 µM NADH, 5 units of dihydrolipoamide dehydrogenase (Sigma), 25 µM lipoamide, 1 mM EDTA, 100 mM Hepes pH 7.6, 10 to 50 µM of TgTrx and PfTrx, and 0.2 mg ml-1 insulin, and the change in absorbance was monitored at 340 nm on a Shimadzu 2401 PC spectrophotometer. The second order rates for the reduction of both parasite Trxs by dihydrolipoamide were calculated according to Equation 2.

(Eq. 2)

Peroxiredoxin Assays—The T. gondii 2-Cys peroxiredoxin kinetic parameters were determined according to Akerman and Müller (27) using a spectrophotometric assay employing stopped-flow fast kinetics with 15 µg of PfTrxR, 1-25 µM TgTrx, 0.2 µM TgTrx-Px1, 100 mM Hepes pH 7.6, 1 mM EDTA, 200 µM NADPH, and 0.5-15 µM hydroperoxide substrate. Steady-state kinetic parameters for the interaction TgTrx-Px1 with hydrogen peroxide and tert-butyl hydroperoxide (0.5-50 µM) were determined, and the resulting data were fitted using Grafit 5.0.

Substrates for TgTrx-Px2—To establish the catalytic activity of TgTrx-Px2 the glutamine synthetase (GS) protection assay was utilized as described by Kim et al. (30). Because the endogenous reducing partner of T. gondii 1-Cys peroxiredoxins is elusive, a number of intracellular thiols, glutathione and dihydrolipoamide and dithiol-containing peptides, thioredoxin and glutaredoxin from P. falciparum, were tested for their ability to act as a reductant for TgTrx-Px2. The assay system consisted of 1 mM GSH, 200 µM NADPH, 100 mM HEPES pH 7.6, 1 mM EDTA, 8-10 µg of P. falciparum glutathione reductase prepared according to Ref. 31, 0.5-5 µM TgTrx-Px2 and 100 µM H2O2. The glutaredoxin assay system essentially contained the same components as described above with the exception that 1-10 µM P. falciparum glutaredoxin, prepared according to Ref. 32, was included into the assay before the reaction was initiated by addition of H2O2. In the third assay system it was assessed whether lipoic acid acts as a reductant for both parasite 1-Cys peroxiredoxins using the following assay conditions, 200 µM NADH, 5-50 µM lipoamide, 5 units of dihydrolipoamide dehydrogenase (Sigma), 0.5-20 µM peroxiredoxin, and 100 µM H2O2. To test the ability of thioredoxin to act as a reducing thiol, a similar assay system as shown above with TgTrx-Px1 was performed where TgTrx-Px 1 was replaced with TgTrx-Px2.

Western Blotting—Polyclonal antibodies were raised against TgTrx in rats and against TgTrx-Px1 and TgTrx-Px2 in rabbits (Eurogentec). The antibodies were purified according to standard protocols (33) and used to detect the three proteins in Western blots of T. gondii tachyzoite protein extracts. The parasite protein extract was separated on a 4-12% SDS-PAGE (Invitrogen) and subsequently blotted onto nitrocellulose. The blots were probed with the primary anti-TgTrx rat antibody at 1:1000 dilution, the anti-TgTrx-Px1 at 1:250 dilution, and with the anti-TgTrx-Px2 antibody at 1:2000 dilution according to Sambrook et al. (33). Anti-rat or anti-rabbit horseradish peroxidase-conjugated antibodies (DaKo; Scottish Antibody Production Unit) were applied at 1:5000, and the blots were developed using the ECL+ system (Amersham Biosciences).

Immunofluorescence—HFFs grown on chamber slides were infected with 0.5 x 104 T. gondii, and after 24 h the cells were fixed with 4% paraformaldeyde for 5 min at 37 °C and then permeabilized with 0.1% Triton X-100 for 5 min at room temperature. The wells were washed twice with PBS between each stage and blocked with 3% bovine serum albumin in PBS containing 0.05% Tween-20 and incubated overnight at 4 °C in a humidity chamber. Subsequently the wells were washed three times with PBS, 0.05% Tween-20 prior to incubation with primary rat anti-TgTrx or purified rabbit anti-TgTrx-Px1 and purified rabbit anti-TgTrx-Px2 antibodies, respectively, at dilutions between 1:200 and 1:2000 for at least 1 h at room temperature. After several washes with PBS, 0.05% Tween-20 the cells were incubated with a FITC-labeled anti-rat or anti-rabbit IgG (Molecular Probes) at a dilution of 1:500, incubated for 1 h, and after several washes slides were mounted using the slowfade light antifade kit containing 1.5 µg ml-1 DAPI (Molecular Probes) to stain the nucleic acids.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
Susceptibility to Oxidative Stress—T. gondii tachyzoites were exposed to increasing concentrations of the exogenous oxidant tert-butyl hydroperoxide and inducers of oxidative stress (juglone, phenazine methylsulfate) to determine their IC50 values (concentrations that caused 50% inhibition of viability). The latter two compounds cause endogenous oxidative stress either by generating reactive oxygen species by redox cycling or by non-enzymatic generation of superoxide anions in the presence of NADH or NADPH (34, 35). T. gondii were found to be highly sensitive to all three compounds with IC50 values in the range between 100 and 500 nM (Fig. 1). They are most susceptible to tert-butyl hydroperoxide (IC50: 100 ± 8 nM) followed by juglone (IC50: 148 ± 16 nM) and phenazine methylsulfate (IC50: 406 ± 134 nM). At these concentrations, the viability of the host cells (HFFs) was not affected, as shown by incubating them by themselves under the same conditions as the parasite-infected HFFs and monitoring their viability with a Live/Dead assay system (data not shown). Indeed, the HFFs only start to show some response to the three stressors at concentrations 1 to 2 orders of magnitude higher than those affecting parasite growth.



View larger version (26K):
[in this window]
[in a new window]
  		FIG. 1.
Susceptibility of T. gondii to oxidative stress. T. gondii tachyzoites were incubated in the presence of increasing concentrations of t-BuOOH, juglone, and phenazine methylsulfate (Phen Met) and their viability tested by incorporation of [3H]uracil as described under "Experimental Procedures." The IC50 values were determined by fitting the data using Grafit 5.0. Each data point was determined in triplicate, and the data represent means ± S.D.

 
Further investigation revealed that parasite death was very likely caused by increased oxidative stress. Incubation of T. gondii-infected HFFs with the stressors and subsequent monitoring of the occurrence of oxidative stress using DCF, which enters the cell and is converted into a fluorescent compound after reaction with H2O2 (36), revealed that juglone and phenazine methylsulfate cause strong fluorescence in the parasites, whereas no fluorescence was detected in the control cells (Fig. 2). Interestingly, the host cells did not show any increased oxidative stress, suggesting that the stressors specifically affected the parasite.



View larger version (94K):
[in this window]
[in a new window]
  		FIG. 2.
Juglone and phenazine methylsulfate cause endogenous oxidative stress in T. gondii. T. gondii tachyzoites were incubated with 10 µM juglone or phenazine methylsulfate for 15 min, and subsequently the degree of oxidative stress in the parasite was detected using DCF (see "Experimental Procedures"). A, control parasites; B, tachyzoites after incubation with juglone; C, tachyzoites after incubation with phenazine methylsulfate. Phase, phase contrast image of parasites; FITC, image obtained using the FITC channel; Merge, merge of phase contrast and FITC channels. Bars, 10 µm.

 
Sequence Analyses of TgTrx-Px1, TgTrx-Px-2, and TgTrx—The genes encoding TgTrx-Px1 (2-Cys peroxiredoxin), TgTrx-Px2 (1-Cys peroxiredoxin), and TgTrx were amplified by PCR using a cDNA library as a template. The TgTrx-Px1 cDNA encodes a polypeptide of 196 amino acids and a theoretical molecular size of 21.7 kDa with 52.0% identity to P. falciparum 2-Cys peroxiredoxin PfTrx-Px1 and 55.6% identity to Trx-Px from Magnetoccocus (ZP_00043412), 53.6% identity to Trx-Px II from H. sapiens (P32119 [GenBank] ). TgTrx-Px1 contains two VCP motifs at positions 50-52 and 170-172, which is typical for the class of 2-Cys peroxiredoxins (6). In addition, the TgTrx-Px1 amino acid sequence possesses a GGIG sequence motif at positions 94-97 and a C-terminal extension containing a tyrosine residue at position 192. Both sequence motifs have been suggested to be involved in the susceptibility of eukaryotic 2-Cys peroxiredoxins to over-oxidation by hydroperoxides (6).

The TgTrx-Px2-deduced amino acid sequence encompasses 224 amino acids with a theoretical molecular size of 24.5 kDa. TgTrx-Px2 possesses one VCT motif at position 44-46 diagnostic for the class of 1-Cys peroxiredoxins. The deduced amino acid sequence shows 44.6% identity to P. falciparum 1-Cys peroxiredoxin (Pf1Cys-TrxPx).

TgTrx has the typical thioredoxin WCGPC motif, which is characteristic for this redox-active protein (37). The gene encodes a 12.1 kDa protein with a sequence identity of 47.6% to P. falciparum Trx (AJ277839 [GenBank] .1) and 43.8% identity to Saccharomyces cerevisiae Trx (NP_013144 [GenBank] ).

Recombinant Expression of TgTrx-Px1, TgTrx-Px-2, and TgTrx—The three T. gondii proteins were recombinantly expressed in E. coli BLR (DE3), purified using Ni2+-agarose, and their purity assessed by SDS-PAGE. All three proteins were expressed at yields between 50 and 100 mg liter-1 bacterial culture. The subunit molecular sizes of the (His)10-tagged TgTrx-Px1, TgTrx-Px2, and TgTrx were determined to be 24.6 kDa, 26.5 kDa, and 15.7 kDa, respectively. Gel filtration on a previously equilibrated Sephadex S 200 column revealed that TgTrx-Px1 elutes as a high molecular mass species of ~250 kDa, suggesting that the protein forms decamers as has been previously reported for 2-Cys peroxiredoxins from other organisms including P. falciparum (27). TgTrx-Px2 elutes in three peaks from the gel sizing column with a major peak corresponding to the size of the monomer of 25 kDa, and two minor peaks that correspond to molecular sizes of 52 kDa and 150 kDa; possibly representing homodimers and homohexamers of the protein. TgTrx elutes in a single peak corresponding to a monomer of 15 kDa. Antibodies were raised against the recombinant proteins and subsequently purified using standard protocols (33).

T. gondii Thioredoxin Is a Substrate for P. falciparum Thioredoxin Reductase—It was established that TgTrx is an effective substrate for PfTrxR with steady-state kinetic parameters similar to PfTrx (Table I). These results show that the two apicomplexan thioredoxins share key structural features that are distinct from the E. coli Trx, which is only a poor substrate for PfTrxR (38). Moreover, the finding that TgTrx was reduced well by PfTrxR facilitated the use of the Plasmodium reductase for this study.


View this table:
[in this window]
[in a new window]
  		TABLE I
Features of apicomplexan thioredoxins

 
In P. falciparum and insects, thioredoxin acts as redox shuttle between the thioredoxin and glutathione systems by reducing GSSG (28, 29). To assess if this could also occur in T. gondii, the second order rate constant (k2) for the reduction of GSSG by TgTrx was determined (Table I). TgTrx efficiently reduced GSSG with a second order rate of 2.5 x 102 M-1 s-1, which is 3 orders of magnitude lower than the second order rate for the reduction of insulin (25, 26) and in the same range as previously reported by Kanzok et al. (28) for the Plasmodium Trx (Table I). Interestingly, TgTrx and PfTrx not only connect the glutathione and thioredoxin redox cycles but also form a link to the dihydrolipoamide/lipoamide redox pair, as dihydrolipoamide efficiently reduces both parasite thioredoxins with second order rates of 1.0 x 104 M-1 s-1 and 1.2 x 104 M-1 s-1 for T. gondii and P. falciparum, respectively (Table I).

Steady-state Kinetic Parameters of TgTrx-Px1—TgTrx-Px1 displays ping-pong kinetics similar to the PfTrx-Px1 (27), with Km values for Trx and hydrogen peroxide of 4.2 ± 0.9 µM and 0.38 ± 0.03 µM, respectively (Table II). In addition the kinetic parameters for the reduction of t-BuOOH were determined, and it was found that at higher concentrations the peroxide substrate caused severe inhibition of the Toxoplasma enzyme, which is detectable even during the first 5 s of our kinetic assay. Substrate inhibition in a bisubstrate reaction can be analyzed by varying the non-inhibitory substrate (in this case Trx) at different concentrations of the inhibitory substrate (in this case t-BuOOH) (39, 40) and fitting the data to Equation 3.

(Eq. 3)


View this table:
[in this window]
[in a new window]
  		TABLE II
Features of T. gondii 2-Cys peroxiredoxins

 
This equation can be transformed into Equation 4 by division with S.

(Eq. 4)

Linear substrate inhibition, which results from dead-end interaction of the substrate with a non-productive form of the enzyme will result in Equation 4 where K'mapp represents the apparent Km and KiS the apparent Ki for the variable substrate (in this case tert-butyl hydroperoxide). V' and K'm are written with primes because they are not real Michaelis-Menten parameters; however if KiS is large compared with K'm (in this case KiS is 33-35.6 µM with a K'm of 0.040 µM) the hyperbole created by a 1/V versus a 1/S plot is straight enough from low substrate values for V' and K'm to be estimated in the usual way. The fits obtained using Equation 4 were very convincing, and the K'm value of 0.040 ± 0.040 µM was determined for the TgTrx-Px1 (Fig. 3 and Table II). The catalytic efficiency for the reduction of t-BuOOH by TgTrx-Px1 is extremely high at 5.0 to 7.0 x 107 M-1 s-1 (dashed lines in Fig. 3, A and B). This is 2-3 orders of magnitude higher than previously reported for peroxiredoxins of other organisms. These results clearly qualify the apicomplexan peroxiredoxin as a highly efficient antioxidant.



View larger version (23K):
[in this window]
[in a new window]
  		FIG. 3.
High substrate inhibition of TgTrx-Px1 by t-BuOOH. A, Michaelis-Menten plot of kinetic studies of TgTrx-Px1 (0.2 µM) with varying concentrations of t-BuOOH (0.5-50 µM) at constant TgTrx concentration of 2 and 5 µM that were carried out as described under "Experimental Procedures." Every data point represents the mean of 3-5 independent measurements ± S.D. B, Lineweaver-Burk plot, the results were fitted to the high substrate inhibition equation (Equation 4) and Kmapp, kcat, and KiS were determined (see Table II).

 
Protection of Glutamine Synthetase by TgTrx-Px1 and TgTrx-Px2—It is well established that 1-Cys and 2-Cys peroxiredoxins can protect GS from inactivation by the Fe3+/DTT system (30, 41, 42). Therefore the catalytic activities of TgTrx-Px1 and TgTrx-Px2 were ascertained in the GS protection assay system, to confirm that both proteins function as peroxiredoxins that efficiently reduce hydrogen peroxide. 1.75 µM TgTrx-Px2 and 2 µM TgTrx-Px1 conferred 50% protection of GS activity (Fig. 4).



View larger version (21K):
[in this window]
[in a new window]
  		FIG. 4.
Protection of glutamine synthetase from E. coli by TgTrx-Px1 and TgTrx-Px2. E. coli glutamine synthetase was incubated with Fe3+/dithiothreitol in the presence of increasing concentrations of TgTrx-Px1 and TgTrx-Px2 according to Kim et al. (30). The peroxiredoxins protected GS from inactivation by reactive oxygen species, confirming both proteins as efficient antioxidants. Every data point represents the mean of three independent measurements ± S.D.

 
Potential Reducers of TgTrx-Px2—In our assay systems using PfTrxR/TgTrx, PfGR/GSH, or PfGR/GSH/PfGrx and E. coli dihydrolipoamide dehydrogenase/dihydrolipoamide as potential redox systems that might interact with TgTrx-Px2, none of glutathione, Trx, glutaredoxin, or lipoic acid reduced the recombinant TgTrx-Px2 protein. Thus, the endogenous, natural reductant for TgTrx-Px2 remains to be discovered.

Western Blotting and Immunofluorescence—The expression of the two peroxiredoxins and thioredoxin in the tachyzoite stages of T. gondii was analyzed by Western blotting. The results showed that they are all expressed in these parasite stages (Fig. 5). The antibodies were also used to determine the subcellular localization of TgTrx-Px1, TgTrx-Px2, and TgTrx by immunofluorescence. All three proteins are clearly located in the cytosol of the parasite (Fig. 6).



View larger version (25K):
[in this window]
[in a new window]
  		FIG. 5.
Tachyzoites express TgTrx, TgTrx-Px1, and TgTrx-Px2. T. gondii tachyzoite protein extract (15 µg/lane) was separated by SDS-PAGE, blotted onto nitrocellulose, and subsequently probed with rat anti-TgTrx antibodies at 1: 2000 (lane 1) or with rabbit anti-TgTrx-Px2 or rabbit anti-TgTrx-Px1 antibodies at 1:2000 (lanes 2 and 3, respectively).

 



View larger version (57K):
[in this window]
[in a new window]
  		FIG. 6.
TgTrx, TgTrx-Px1, and TgTrx-Px2 are all cytosolic. T. gondii peroxiredoxins and thioredoxin were detected using polyclonal antibodies as described under "Experimental Procedures." A, TgTrx-Px2; B, TgTrx-Px1; C, TgTrx. Phase, phase contrast image; FITC, FITC channel; Merged, merge of phase contrast and FITC channel. Bar, 10 µm.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
It has been suggested that apicomplexan parasites such as T. gondii need efficient antioxidant systems in order to maintain the crucial balance between antioxidants and pro-oxidants to ensure the survival in their host cells (13). A number of antioxidant enzymes have been identified in T. gondii including superoxide dismutases and peroxiredoxins (13, 16, 43, 44). T. gondii possesses three peroxiredoxins, one 1-Cys peroxiredoxin and two 2-Cys peroxiredoxins (13). It seemed likely that these peroxiredoxins are important to Toxoplasma, especially as the parasite is able to survive the knockout of catalase (13). In this study, we have biochemically characterized and determined the subcellular localization of the parasite 1-Cys peroxiredoxin TgTrx-Px2 and the 2-Cys peroxiredoxin TgTrx-Px1.

To analyze the antioxidant capacity of T. gondii thioredoxin-linked redox system, the biochemical parameters of TgTrx and TgTrx-Px1 were determined. It was established that TgTrx is a competent substrate for P. falciparum thioredoxin reductase, which emphasizes the structural similarity of the apicomplexan thioredoxins. Moreover, this similarity facilitated this study in that it allowed the use of PfTrxR. Additionally TgTrx is reduced by the dihydrolipoamide dehydrogenase/dihydrolipoamide redox pair with a k2 of 1 x 104 M-1 s-1, linking the thioredoxin redox to the lipoamide redox cycle. Although the thioredoxin under investigation is clearly a cytosolic protein the interaction with dihydrolipoamide could play a role in the detoxification of hydroperoxides in the parasite organelles. Here lipoic acid is covalently attached to the {alpha}-keto acid dehydrogenase complexes and possibly can act as a reductant for a mitochondrial thioredoxin/peroxiredoxin-linked antioxidant defense system. This role has previously been suggested by Bunik (45) and Byrk et al. (46) and might also be relevant for T. gondii. TgTrx is also capable of reducing glutathione, with a k2 of 2.5 x 102 M-1 s-1, similar to the value for PfTrx (28). Thus the different redox systems of T. gondii are highly integrated, which potentially is of great relevance in situations when the parasites are under enhanced oxidative stress.

TgTrx-Px1 has very low Km values for hydrogen peroxide and t-BuOOH suggesting that in vivo the enzyme is likely to be crucially involved in the reduction of these hydroperoxides. Notably, the catalytic efficiencies determined for the reduction of both hydroperoxides were between 2.2 x 106 M-1 s-1 and 7.0 x 107 M-1 s-1, which is 2-3 orders of magnitude higher than the catalytic efficiencies of peroxiredoxins of other organisms including trypanosomatids (1, 2, 47). They are, in fact, similar to those of catalases (2) and qualify the apicomplexan peroxiredoxin as an extremely efficient antioxidant. However, this high measured efficiency might be deceptive because TgTrx-Px1 is prone to substrate inhibition, probably by over-oxidation of its active site cysteine residue. TgTrx-Px1 has amino acid motifs GGIG at positions 94-97 and a tyrosine residue at position 192 that have been shown for other peroxiredoxins to be responsible for this susceptibility to overoxidation (6). This feature of eukaryotic 2-Cys peroxiredoxins expands their physiological roles beyond their peroxidase function and it has been suggested that they play an important part in redox signaling (4, 6, 48, 49). Possibly TgTrx-Px1 may well have such a role too.

The second class of the peroxiredoxin superfamily, the 1-Cys peroxiredoxins, are not as well studied as the 2-Cys peroxiredoxins. Only a small number of members of this protein class have been described and it is unclear what their precise role is in the antioxidant defense (3). The functionality of TgTrx-Px2 as thiol-specific-antioxidant was established using the GS protection assay (Fig. 4), which confirmed that the protein is a highly active peroxidase in the presence of dithiothreitol. However it is not clear what its endogenous reducing partner is. A number of low molecular weight thiols and proteins including glutathione, glutaredoxin and cyclophilin have been suggested and recently interactions of 1-Cys peroxiredoxin with glutathione S-transferases and glutathione have been described (8, 9, 50). In this study, we tested the ability of glutathione, lipoic acid, thioredoxin, and glutaredoxin to reduce the TgTrx-Px2, but all four of them failed to act as electron donors for the protein. Therefore the question remains as to the role of this abundantly expressed protein and if it does reduce peroxides in vivo, as we have shown it can do in vitro, how does the cell return the protein to its reduced and active form?

Thus the data presented show that peroxiredoxin-linked detoxification of reactive oxygen species is a powerful cytosolic antioxidant system in T. gondii, helping the parasite to cope with the oxidative stress it encounters during its intracellular life. However, despite the array of antioxidants, T. gondii tachyzoites are highly susceptible to exogenous and endogenous oxidative stress, with IC50 values for t-BuOOH, juglone, and phenazine methylsulfate in the nanomolar range (Fig. 1), and the strong DCF-fluorescence of oxidatively stressed T. gondii (Fig. 2). This suggests that minor changes in the redox balance of the parasites lead to destruction of their oxidant homeostasis and parasite death. Interestingly, the stressors appear to specifically affect the parasite and had no effect on the host cell. Thus interfering with the action of the peroxiredoxins might be a new avenue for the development of novel therapies against T. gondii and possibly also apicomplexan parasites in general.


   FOOTNOTES
 
* The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

Funded by a Wellcome Trust Prize Studentship. Back

|| A Wellcome Trust Senior Fellow in Basic Biomedical Science. To whom correspondence should be addressed: Infection and Immunity, Institute of Biomedical and Life Sciences, Joseph Black Building, University of Glasgow, Glasgow G12 8QQ, UK. Tel.: 44-141-330-2383; Fax: 44-141-330-4600; E-mail: s.muller{at}bio.gla.ac.uk.

1 The abbreviations used are: Trx-Px, peroxiredoxin; DCF, 2',7'-dichlorodihydrofluorescein diacetate; GS, glutamine synthetase; GSSG, glutathione disulfide; HFFs, human foreskin fibroblasts; PBS, phosphate-buffered saline; PfTrxR, P. falciparum thioredoxin reductase; t-BuOOH, tert-butyl hydroperoxide; TgTrx, T. gondii thioredoxin; TgTrx-Px1, T. gondii 2-Cys peroxiredoxin; TgTrx-Px2, Toxoplasma gondii 1-Cys peroxiredoxin; Trx, thioredoxin, TrxR, thioredoxin reductase; FITC, fluorescein isothiocyanate. Back



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Hofmann, B., Hecht, H. J., and Flohe, L. (2002) Biol. Chem. 383, 347-364[CrossRef][Medline] [Order article via Infotrieve]
  2. Wood, Z. A., Schröder, E., Robin Harris, J., and Poole, L.B. (2003) Trends Biochem. Sci. 28, 32-40[CrossRef][Medline] [Order article via Infotrieve]
  3. Choi, H. J., Kang, S. W., Yang, C. H., Rhee, S. G., and Ryu, S.E. (1998) Nat. Struct. Biol. 5, 400-406[CrossRef][Medline] [Order article via Infotrieve]
  4. Delaunay, A., Pflieger, D., Barrault, M. B., Vinh, J., and Toledano, M. B. (2002) Cell 111, 471-481[CrossRef][Medline] [Order article via Infotrieve]
  5. Georgiou, G. (2002) Cell 111, 607-610[CrossRef][Medline] [Order article via Infotrieve]
  6. Wood, Z. A., Poole, L. B., and Karplus, P. A. (2003) Science 300, 650-653[Abstract/Free Full Text]
  7. Chen, J. W., Dodia, C., Feinstein, S. I., Jain, M. K., and Fisher, A. B. (2000) J. Biol. Chem. 275, 28421-28427[Abstract/Free Full Text]
  8. Lee, S. P., Hwang, Y. S., Kim, Y. J., Kwon, K. S., Kim, H. J., Kim, K., and Chae, H. Z. (2001) J. Biol. Chem. 276, 29826-29832[Abstract/Free Full Text]
  9. Manevich, Y., Feinstein, S. I., and Fisher, A. B. (2004) Proc. Natl. Acad. Sci. U. S. A. 101, 3780-3785[Abstract/Free Full Text]
  10. Luft, B. J., and Remington, J. S. (1992) Clin. Infect. Dis. 15, 211-222[Medline] [Order article via Infotrieve]
  11. Desmonts, G., and Couvreur, J. (1974) N. Engl. J. Med. 290, 1110-1116[Medline] [Order article via Infotrieve]
  12. Denkers, E. Y., Kim, L., and Butcher, B. A. (2003) Cell. Microbiol. 5, 75-83[CrossRef][Medline] [Order article via Infotrieve]
  13. Kwok, L. Y., Schluter, D., Clayton, C., and Soldati. D. (2004) Mol. Microbiol. 51, 47-61[CrossRef][Medline] [Order article via Infotrieve]
  14. Kaasch, A. J., and Joiner, K. A. (2000) J. Biol. Chem. 275, 1112-1118[Abstract/Free Full Text]
  15. Ding, M., Clayton, C., and Soldati, D. (2000) J. Cell Sci. 113, 2409-2419[Abstract]
  16. Brydges, S. D., and Carruthers, V. B. (2003) J. Cell Sci. 116, 4675-4685[Abstract/Free Full Text]
  17. Gardner, M. J., Hall, N., Fung, E., White, O., Berriman, M., Hyman, R. W., Carlton, J. M., Pain, A., Nelson, K. E., Bowman, S., Paulsen, I. T., James, K., Eisen, J. A., Rutherford, K., Salzberg, S. L., Craig, A., Kyes, S., Chan, M. S., Nene, V., Shallom, S. J., Suh, B., Peterson, J., Angiuoli, S., Pertea, M., Allen, J., Selengut, J., Haft, D., Mather, M. W., Vaidya, A. B., Martin, D. M., Fairlamb, A. H., Fraunholz, M. J., Roos, D. S., Ralph, S. A., McFadden, G. I., Cummings, L. M., Subramanian, G. M., Mungall, C., Venter, J. C., Carucci, D. J., Hoffman, S. L., Newbold, C., Davis, R. W., Fraser, C. M., and Barrell, B. (2002) Nature 419, 498-511[CrossRef][Medline] [Order article via Infotrieve]
  18. Müller, S., Liebau, E., Walter, R. D., and Krauth-Siegel, R. L. (2003) Trends Parasitol. 19, 320-328[CrossRef][Medline] [Order article via Infotrieve]
  19. Müller, S. (2004) Mol. Microbiol. 53, 1291-1305[CrossRef][Medline] [Order article via Infotrieve]
  20. Krnajski, Z., Gilberger, T. W., Walter, R. D., Cowman, A. F., and Müller, S. (2002) J. Biol. Chem. 277, 25970-25975[Abstract/Free Full Text]
  21. Gilberger, T. W., Walter, R. D., and Müller, S. (1997) J. Biol. Chem. 272, 29584-29589[Abstract/Free Full Text]
  22. Krnajski, Z., Gilberger, T. W., Walter, R. D., and Müller S. (2001) Mol. Biochem. Parasitol. 112, 219-228[CrossRef][Medline] [Order article via Infotrieve]
  23. Roos, D. S., Donald, R. G. K., Morrissette, N. S., and Moulton, L. C. (1994) Methods Cell Biol. 45, 27-63[Medline] [Order article via Infotrieve]
  24. Bradford, M. M. (1976) Anal. Biochem. 72, 248-254[CrossRef][Medline] [Order article via Infotrieve]
  25. Holmgren, A. (1979) J. Biol. Chem. 254, 9627-9632[Abstract/Free Full Text]
  26. Luthman, M., and Holmgren, A. (1982) Biochemistry 21, 6628-6633[CrossRef][Medline] [Order article via Infotrieve]
  27. Akerman, S. E., and Müller, S. (2003) Mol. Biochem. Parasitol. 130, 75-81[CrossRef][Medline] [Order article via Infotrieve]
  28. Kanzok, S. M., Schirmer, R. H., Turbachova, I., Iozef, R., and Becker, K. (2000) J. Biol. Chem. 275, 40180-40186[Abstract/Free Full Text]
  29. Kanzok, S. M., Fechner, A., Bauer, H., Ulschmid, J. K., Müller, H. M., Botella-Munoz, J., Schneuwly, S., Schirmer, R., and Becker, K. (2001) Science 291, 643-646[Abstract/Free Full Text]
  30. Kim, K., Kim, I. H., Lee, K. Y., Rhee, S. G., and Stadtman, E. R. (1988) J. Biol. Chem. 263, 4704-4711[Abstract/Free Full Text]
  31. Gilberger, T. W., Schirmer, R. H., Walter, R. D., and Müller, S. (2000) Mol. Biochem. Parasitol. 107, 169-179[CrossRef][Medline] [Order article via Infotrieve]
  32. Rahlfs, S., Fischer, M., and Becker, K. (2001) J. Biol. Chem. 276, 37133-37140[Abstract/Free Full Text]
  33. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
  34. Hebbel, R. P., Leung, A., and Mohandas, N. (1990) Blood 76, 1015-1020[Abstract/Free Full Text]
  35. Kampkötter, A., Volkmann, T. E., de Castro, S. H., Leiers, B., Klotz, L. O., Johnson, T. E., Link, C. D., and Henkle-Dührsen, K. (2003) J. Mol. Biol. 325, 25-37[CrossRef][Medline] [Order article via Infotrieve]
  36. Jakubowski, W., and Bartosz, G. (2000) Cell Biol. Int. 24, 757-760[CrossRef][Medline] [Order article via Infotrieve]
  37. Holmgren, A. (2000) Antioxid. Redox Signal 2, 811-820[Medline] [Order article via Infotrieve]
  38. Müller, S., Gilberger, T. W., Färber, P. M., Becker, K., Schirmer, R. H., and Walter, R. D. (1996) Mol. Biochem. Parasitol. 80, 215-219[CrossRef][Medline] [Order article via Infotrieve]
  39. Lescovac, V. (2003) Comprehensive Enzyme Kinetics, 2nd Ed., pp. 191-207, Kluwer Academic/Plenum Publishers, New York
  40. Cornish-Bowden, A. (2004) Fundamentals of Enzyme Kinetics, 3rd Ed., pp. 137-144, Portland Press, London
  41. Kim, K., Rhee, S. G., and Stadtman, E. R. (1985) J. Biol. Chem. 260, 15394-15397[Abstract/Free Full Text]
  42. Netto, L. E. S., Chae, H. Z., Kang, S. W., Rhee, S. G., and Stadtman, E. R. (1996) J. Biol. Chem. 271, 15315-15321[Abstract/Free Full Text]
  43. Odberg-Ferragut, C., Renault, J. P., Viscogliosi, E., Toursel, C., Briche, I., Engels, A., Lepage, G., Morgenstern-Badarau, I., Camus, D., Tomavo, S., and Dive, D. (2000) Mol. Biochem. Parasitol. 106, 121-129[CrossRef][Medline] [Order article via Infotrieve]
  44. Gratepanche, S., Menage, S., Touati, D., Wintjens, R., Delplace, P., Fontecave, M., Masset, A., Camus, D., and Dive, D. (2002) Mol. Biochem. Parasitol. 120, 237-246[CrossRef][Medline] [Order article via Infotrieve]
  45. Bunik, V. I. (2003) Eur. J. Biochem. 270, 1036-1042[Medline] [Order article via Infotrieve]
  46. Bryk, R., Lima, C. D., Erdjument-Bromage, H., Tempst, P., and Nathan, C. (2002) Science 295, 1073-1077[Abstract/Free Full Text]
  47. Hillebrand, H., Schmidt, A., and Krauth-Siegel, R. L. (2003) J. Biol. Chem. 278, 6809-6815[Abstract/Free Full Text]
  48. Fujii, J., and Ikeda, Y. (2002) Redox Rep. 7, 123-130[CrossRef][Medline] [Order article via Infotrieve]
  49. Claiborne, A., Yeh, J. I., Mallett, T. C., Luba, J., Crane, E. J., 3rd, Charrier, V., and Parsonage, D. (1999) Biochemistry 38, 15407-15416[CrossRef][Medline] [Order article via Infotrieve]
  50. Pauwels, F., Vergauwen, B., Vanrobaeys, F., Devreese, B., and Van Beeumen, J. J. (2003) J. Biol. Chem. 278, 16658-16666[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 Proc. Natl. Acad. Sci. USAHome page
D. Parsonage, P. A. Karplus, and L. B. Poole
Reactive Oxygen Species Special Feature: Substrate specificity and redox potential of AhpC, a bacterial peroxiredoxin
PNAS, June 17, 2008; 105(24): 8209 - 8214.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
280/1/564    most recent
M406367200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Akerman, S. E.
Right arrow Articles by Müller, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Akerman, S. E.
Right arrow Articles by Müller, S.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2005 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement