Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M413949200 on December 28, 2004

J. Biol. Chem., Vol. 280, Issue 10, 8651-8659, March 11, 2005
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
280/10/8651    most recent
M413949200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ramakrishnan, S. N.
Right arrow Articles by Muscat, G. E. O.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ramakrishnan, S. N.
Right arrow Articles by Muscat, G. E. O.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Rev-erb{beta} Regulates the Expression of Genes Involved in Lipid Absorption in Skeletal Muscle Cells

EVIDENCE FOR CROSS-TALK BETWEEN ORPHAN NUCLEAR RECEPTORS AND MYOKINES*

Sathiya N. Ramakrishnan, Patrick Lau, Les J. Burke, and George E. O. Muscat{ddagger}

From the Institute for Molecular Bioscience, Division of Molecular Genetics and Development, University of Queensland, St. Lucia, Queensland 4072, Australia

Received for publication, December 13, 2004 , and in revised form, December 20, 2004.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Rev-erb{beta} is an orphan nuclear receptor that selectively blocks trans-activation mediated by the retinoic acid-related orphan receptor-{alpha} (ROR{alpha}). ROR{alpha} has been implicated in the regulation of high density lipoprotein cholesterol, lipid homeostasis, and inflammation. Reverb{beta} and ROR{alpha} are expressed in similar tissues, including skeletal muscle; however, the pathophysiological function of Rev-erb{beta} has remained obscure. We hypothesize from the similar expression patterns, target genes, and overlapping cognate sequences of these nuclear receptors that Rev-erb{beta} regulates lipid metabolism in skeletal muscle. This lean tissue accounts for >30% of total body weight and 50% of energy expenditure. Moreover, this metabolically demanding tissue is a primary site of glucose disposal, fatty acid oxidation, and cholesterol efflux. Consequently, muscle has a significant role in insulin sensitivity, obesity, and the blood-lipid profile. We utilize ectopic expression in skeletal muscle cells to understand the regulatory role of Rev-erb{beta} in this major mass peripheral tissue. Exogenous expression of a dominant negative version of mouse Rev-erb{beta} decreases the expression of many genes involved in fatty acid/lipid absorption (including Cd36, and Fabp-3 and -4). Interestingly, we observed a robust induction (>15-fold) in mRNA expression of interleukin-6, an "exercise-induced myokine" that regulates energy expenditure and inflammation. Furthermore, we observed the dramatic repression (>20-fold) of myostatin mRNA, another myokine that is a negative regulator of muscle hypertrophy and hyperplasia that impacts on body fat accumulation. This study implicates Rev-erb{beta} in the control of lipid and energy homoeostasis in skeletal muscle. In conclusion, we speculate that selective modulators of Rev-erb{beta} may have therapeutic utility in the treatment of dyslipidemia and regulation of muscle growth.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Members of the nuclear receptor (NR)1 superfamily bind to specific DNA elements and function as transcriptional regulators (1, 2). In addition to the ligand-activated NRs, many members within this superfamily have no known ligand, and are referred to as "orphan NRs" (3). The orphan receptor Rev-erb{beta} (NR1D2, also known as Rev-erb{alpha}-related receptor, RVR) belongs to the family of "Reverbs" that also contain Rev-erb{alpha} (4, 5). The primary structure of these two receptors together with retinoic acid-related orphan receptor-{alpha} (ROR{alpha}) and the Drosophila orphan receptor, E75A, is very similar especially in the DNA-binding domain and the putative ligand-binding domain (6).

Two Rev-erb{beta} genes have been identified; Rev-erb{beta}1 and Rev-erb{beta}2, which are alternatively spliced products of the Rev-erb{beta} gene (7). The mRNA expression data shows that Rev-erb{beta} is abundantly expressed in most tissues, although higher levels of expression are observed in skeletal muscle, brain, kidney, and liver (Refs. 4 and 8 and references therein).

Rev-erb{alpha}, Rev-erb{beta}, and ROR bind as monomers to the nuclear receptor half-site motif, PuGGTCA flanked 5' by an AT-rich sequence ((A/T)6PuGGTCA). Although these receptors are closely related, and bind to the same motif, they function in an opposing manner. Whereas ROR activates gene transcription, Rev-erb{alpha} and Rev-erb{beta} mediate transcriptional repression, and can repress trans-activation mediated by ROR (6, 9–12). The inter-relationship between these nuclear receptors is underscored by the evidence that demonstrates ROR{alpha} trans-activates the Rev-erb{alpha} promoter (13).

Loss of function studies in cell culture and in animal models has demonstrated a role of ROR{alpha} in lipid metabolism. ROR{alpha}-deficient staggerer mice are predisposed to the development of atherosclerosis. The staggerer mice possess an aberrant blood-lipid profile with low circulating levels of major lipoproteins such as HDL cholesterol, apolipoprotein (apo) C-III, and plasma triglycerides. Furthermore, decreases in specific apolipoprotein compartments, namely Apoa-I, the major constituent of HDL, and Apoa-II that lead to hypo-{alpha}-lipoproteinemia have been reported in staggerer mice (15). Moreover, our recent studies demonstrate that ROR{alpha} regulates the expression of genes involved in lipid homeostasis and energy balance in skeletal muscle cells (16).

Several reports have demonstrated the role of Rev-erb{alpha} in lipid metabolism and inflammation. In the context of lipid metabolism, Rev-erb{alpha}, together with peroxisome proliferator activated receptor-{alpha} (PPAR-{alpha}) has been shown to regulate the expression of ApoA1 in a species-specific manner (17). Apoa1 has an important role in the formation of nascent HDL particles and apolipoprotein-mediated cholesterol efflux in mice (18, 19). Furthermore, Rev-erb{alpha} has also been shown to regulate the expression of the ApoC-III gene that plays a key role in maintaining serum triglyceride levels (20, 21). The inter-relationship between Rev-erb{beta} and lipid metabolism has not been investigated. Within inflammatory pathways, Rev-erb{alpha} and ROR act opposingly on the NF{kappa}B pathway. ROR{alpha} has been shown to directly up-regulate the expression of I{kappa}B{alpha}, the major inhibitor of the NF{kappa}B signaling pathway by binding to the I{kappa}B{alpha} promoter (22). The functional role of Rev-erb{beta} in NF{kappa}B-mediated inflammation still remains obscure.

Rev-erb{beta} is abundantly expressed in skeletal muscle and brown fat. Skeletal muscle is one of the most metabolically demanding major mass peripheral tissues that accounts for 50% of energy expenditure. Moreover, this lean tissue relies heavily on fatty acids as an energy source, accounts for 75% of glucose disposal, and is involved in cholesterol efflux. Consequently, muscle has a significant role in insulin sensitivity and the blood-lipid profile. However, the role of Rev-erb{beta} in skeletal muscle lipid and energy homeostasis has not been well studied.

The C2C12 in vitro cell culture model system has been used to investigate the regulation of lipid metabolism and cholesterol homeostasis by nuclear receptors such as LXR (23), PPAR{alpha}, -{beta}/{delta}, -{gamma} (24–28), and ROR{alpha} (16). Selective and synthetic agonists to these nuclear receptors induce similar effects on mRNAs encoding Abca1/g1, ApoE, sterol regulatory element-binding protein (Srebp)-1c, Scd-1, Fabp3, fatty acid synthase, lipoprotein lipase, Glut5, Ucp-2, and Ucp-3 in differentiated C2C12-myotubes and Mus musculus skeletal muscle tissue (23–25). The physiological validation of the cell culture model with respect to lipid homeostasis in the mouse corroborates the utility of this model system. This cell culture model provides an ideal platform to identify the Rev-erb{beta}-dependent regulation of genes involved in metabolism.

We have examined the regulation of gene expression involved in lipid homeostasis by Rev-erb{beta} "loss of function" in skeletal muscle cell culture model. Our investigation demonstrates that Rev-erb{beta} controls the expression of genes involved in lipid absorption. Moreover, we observed the regulation of genes encoding critical myokines that influence energy expenditure and inflammation.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Cell Culture—Mouse myogenic C2C12 cells were cultured in growth medium (Dulbecco's modified Eagle's medium supplemented with 10% heat-inactivated Serum Supreme (BioWhittaker, Edward Keller Pty. Ltd., Hallam, Victoria, Australia)) in 6% CO2. Myoblasts were differentiated into post-mitotic multinucleated myotubes by 4 days of serum withdrawal (i.e. cultured in Dulbecco's modified Eagle's medium supplemented with 1% fetal calf serum + 1% serum supreme). Cells were harvested 96 h (4 days) after mitogen withdrawal.

C2C12 Transfections—Each well of a 24-well plate of C2C12 cells (~50% confluence) was transfected with DNA using the liposome-mediated transfection procedure as described previously (16). Cells were transfected using a DOTAP and Metafectene (Biontex Laboratories GmbH, Munich, Germany) liposome mixture in 1x HBS (HEPES-buffered saline (42 mM HEPES, 275 mM NaCl, 10 mM KCl, 0.4 mM Na2HPO4, 11 mM dextrose (pH 7.1)). The DNA/DOTAP/Metafectene mixture was added to the cells in 0.6 ml of Dulbecco's modified Eagle's medium supplemented with 5% fetal calf serum for experiments with ROR{alpha} or 10% serum supreme. After 16–24 h, the culture medium was changed and after a further 24 h the cells were harvested for the assay of luciferase activity. Luciferase activity was measured as described previously (16).

C2:Rev-erb{beta}{Delta}E Stably Transfected Cell Line—The transfection of pSG5-Rev-erb{beta}{Delta}E into mouse myogenic C2C12 cells and the selection of stably transfected polyclonal cells using G418 has been described previously (29). The cells were cultured in growth medium with G418, and differentiated into post-mitotic multinucleated myotubes by 4 days of serum withdrawal.

RNA Extraction and cDNA Synthesis—Total RNA was extracted from C2C12 cells using Tri-Reagent (Sigma) according to the manufacturer's protocol. After treatment with 2 units of Turbo DNase (Ambion, Austin, TX) for 60 min, DNase was inactivated by heating to 75 °C for 10 min. RNA for quantitative real time (Q-RT)-PCR was further purified using the RNeasy RNA extraction kit (Qiagen, Clifton Hill, Victoria, Australia) according to the manufacturer's instructions.

Q-RT-PCR—RNA was normalized using UV spectrometry and agarose gel electrophoresis. Complementary DNA was synthesized from 3 µg of total RNA using Superscript III Reverse Transcriptase (Invitrogen Australia Pty. Ltd., Mulgrave, Victoria, Australia) and random hexamers according to the manufacturer's instructions. Target cDNA levels were analyzed by Q-RT-PCR in 25-µl reactions containing either SYBR green (ABI, Warrington, UK) or Taqman PCR master mix (ABI, Branchburg, NJ), 200 nM each of forward and reverse primers or Assays-on-Demand Taqman primers (ABI, Foster City, CA), and cDNA (derived from 50 nanograms of RNA) by using an ABI Prism 7000 Sequence Detector system. PCR was conducted over 45 cycles at 95 °C for 15 s and 60 °C for a 1-min two-step thermal cycling preceded by an initial 95 °C for 10 min for activation of Amplitaq Gold DNA polymerase.

Primers—Primers used for the Q-RT-PCR analysis of the mRNA populations have been described in detail (16), with the exception of primers designed for the detection of Rev-erb{beta}{Delta}E (pSG5-RVR-F, TGGGCAACGTGCTGGTTA; pSG5-RVR-R, CCATGGTGGGATCCGAATT), Mcad (MCAD-F, CAGCCAATGATGTGTGCTTACTG; MCAD-R, ATAACATACTCGTCACCCTTCTTCTCT), Err{alpha} (ERR{alpha}-F, CTCTGGCTACCACTACGGTGTG; ERR{alpha}-R, AGCTGTACTCGATGCTCCCCT), IL-6 (IL-6-F, AGCCAGAGTCCTTCAGA; IL-6-R, GGTCCTTAGCCACTCCT) using SYBR green. Rev-erb{beta}, Fabp4, NF{kappa}B (relA), I{kappa}B{alpha}, Cox-2, IL-15, and myostatin were detected using Assay-on-demand primer/probe sets.

Plasmids—pSG5, pSG5-Rev-erb{beta}, and pSG5-Rev-erb{beta}{Delta}E have been described previously (29). The reporters containing the human Rev-erbA{alpha} promoter (pRev-erbA{alpha}WT) or four copies of the mouse Purkinje cell protein-2 RORE (mPCP-2tk LUC) linked to the luciferase gene have been described previously (9, 16).


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Rev-erb{beta} mRNA Is Expressed in Skeletal Muscle Cells and Repressed during Myogenic Differentiation—Many studies indicate that the C2C12 cell line is an excellent cell culture model to investigate myogenesis, and the NR-mediated regulation of lipid homeostasis in skeletal muscle (23–26). In this culture system, proliferating C2C12 myoblasts can be induced to biochemically and morphologically differentiate into post-mitotic multinucleated myotubes by serum withdrawal in culture over a 48–96-h period. This transition from a non-muscle phenotype to a contractile phenotype is associated with activation/expression of a structurally diverse group of genes responsible for contraction and the extreme metabolic demands on this tissue.

Initially, total RNA was isolated from proliferating myoblasts and post-mitotic myotubes after 4 days of serum withdrawal, converted to cDNA for the analysis of mRNA expression by Q-RT-PCR. We utilized the GenBankTM sequences of mouse Rev-erb{beta} to design specific primers for detection of mouse Rev-erb{beta} by Q-RT-PCR.

We observed that Rev-erb{beta} is expressed in proliferating myoblasts and the transcript was decreased 2–3-fold as the cells exit the cell cycle and form differentiated multinucleated myotubes (Fig. 1A). Concomitant with this decrease in Rev-erb{beta} mRNA was the striking induction of expression of mRNA that encodes the slow (type I, Tnni1) and fast (type II, Tnni2) isoforms of the contractile protein, troponin I, and myogenin that encodes the hierarchical basic helix loop helix regulator (Fig. 1, B–D). These data confirmed that these cells had terminally differentiated and had acquired a contractile phenotype.



View larger version (22K):
[in this window]
[in a new window]
  		FIG. 1.
Q-RT-PCR analysis of mRNA expression during skeletal muscle myogenesis. Total RNA from wild type C2C12 proliferating myoblasts (PMB), and myotubes after 4 days of serum withdrawal (MT4) was reverse transcribed to cDNA and analyzed by Q-RT-PCR. Gene-specific primers were used to examine the expression of: A, Reverb{beta}; B, Tnni1; C, Tnni2; D, myogenin; E, lipoprotein lipase; F, ROR{alpha}; G, Fat/Cd36; H, Fabp3; I, Fabp4; J, Scd-1; K, Ucp-3; L, Ucp-2; M, Srebp1c; and N, AdipoR2. Normalized expression is relative to the expression of 18S rRNA determined with the same cDNA then multiplied by 10,000. All reactions were performed in triplicate and results are shown as average ± S.D.

 
Furthermore, we analyzed the expression of several genes that encode major metabolic enzymes and regulators that are involved in the regulation of energy expenditure and lipid homeostasis (as described in Table I). Acquisition of the muscle-specific phenotype saw an increase in expression of mRNAs encoding lipoprotein lipase (Fig. 1E), ROR{alpha} (Fig. 1F), fatty acid translocase/CD36 (Fat/Cd36, Fig. 1G), fatty acid binding proteins 3 and 4 (Fig. 1, H and I), and the uncoupling proteins (Ucp2 and -3, Fig. 1, K and L). Finally, there was no change in the expression of the mRNAs encoding Srebp-1c (Fig. 1M), stearoyl-CoA desaturase 1 (Scd-1, Fig. 1J), and adiponectin receptor 2 (adipoR2, Fig. 1N).


View this table:
[in this window]
[in a new window]
  		TABLE I
Key target genes in this study

 
In summary, these data demonstrate that the mRNA transcript encoding Rev-erb{beta} was expressed during myogenesis. Second, during the acquisition of a contractile and metabolic phenotype (consistent with the increased utilization of lipids in skeletal muscle) we observed an ~2.5-fold repression of this orphan NR. However, we note that Rev-erb{beta} is still expressed at a significant level in differentiated cells, in concordance with the expression of this orphan NR in adult muscle tissue.

Deletion of the Rev-erb{beta} Ligand Binding Domain Compromises Its Ability to Repress ROR{alpha}-mediated Trans-activation—To understand the metabolic role of Rev-erb{beta} in skeletal muscle lipid and energy homeostasis, and to identify target genes of this orphan receptor in muscle cells, we examined the effect of perturbing Rev-erb{beta} function. To disrupt Rev-erb{beta}-mediated trans-repression of gene expression, we utilized Rev-erb{beta}{Delta}E, that encodes amino acids 1–394 but lacks the entire E region that encodes the putative ligand binding domain of Rev-erb{beta}. Deletion of this region has been reported to have a dominant negative effect on Rev-erb{beta}-mediated trans-repression of gene expression (29). Moreover, this region has been implicated in associating with the nuclear receptor co-repressors (30). In transient transfection assays in C2C12 skeletal muscle cells, deletion of the E region ablated the ability of Rev-erb{beta} to trans-repress the human Rev-erbA{alpha} promoter (Fig. 2A). Moreover, the capacity of Rev-erb{beta} to repress ROR{alpha}-mediated transcription is diminished when the E region is absent (Fig. 2, B and C). This demonstrates that deletion of the E-region that encodes the ligand binding domain of Rev-erb{beta} compromises the capacity of this orphan NR to trans-repress the Rev-erb{alpha} promoter, and to attenuate ROR{alpha}-mediated trans-activation.



View larger version (12K):
[in this window]
[in a new window]
  		FIG. 2.
Deletion of the E region of Rev-erb{beta} compromises its trans-repression activity. A, C2C12 cells were co-transfected with 0.5 µg of the reporter, pRev-erbA{alpha}WT, and 0.16 µg each of pSG5, pSG5-Rev-erb{beta}, and pSG5-Rev-erb{beta}{Delta}E. -Fold repression is expressed relative to luciferase activity obtained after co-transfection of the reporter and pSG5 vector only, arbitrarily set at 1. All transfections comprised six replicates and results are shown as average ± S.D. B, C2C12 cells were co-transfected with 0.33 µg of the ROR{alpha} responsive reporter, mPCP-2tk-LUC, and 0.48 µg of pSG5 or 0.16 µg of pSG5-ROR{alpha} and increasing amounts (0.05, 0.1, and 0.2 µg) of pSG5-Rev-erb{beta} or pSG5-Rev-erb{beta}{Delta}E. pSG5 was added to normalize the final amount of DNA transfected to 0.63 µg in each well. All transfections comprised six replicates and results are shown as average ± S.D. C, data from B are represented in terms of -fold repression. -Fold repression is expressed relative to luciferase activity obtained after co-transfection of the reporter and pSG5-ROR{alpha}, arbitrarily set at 1.

 
Ectopic Dominant Negative (Rev-erb{beta}{Delta}E) Expression Induces Precocious Differentiation and ROR{alpha} mRNA Expression—The stable C2C12 cell line expressing Rev-erb{beta}{Delta}E (C2:Rev-erb{beta}{Delta}E) has been described previously (29). Prior to more extensive analysis of this cell line, we decided to ascertain the Rev-erb{beta} status of this cell line. We designed a SYBR green-mediated Q-RT-PCR assay to selectively detect the ectopically expressed Rev-erb{beta}{Delta}E transcript. We observed that the C2:Rev-erb{beta}{Delta}E cell line specifically expresses the ectopically introduced mRNA in myoblasts and myotubes (Fig. 3, A and B). The expression of the exogenous transcript is constitutive (Fig. 3, A and B) in contrast to the endogenous transcript that is down-regulated during differentiation of proliferating myoblasts to postmitotic myotubes (Fig. 1A). Moreover, the steady state levels of myogenin mRNA were elevated in myotubes from the C2:Rev-erb{beta}{Delta}E cell line relative to wild-type C2C12 cells (Fig. 3C). This is consistent with the previously reported precocious biochemical and morphological differentiation of the C2:Reverb{beta}{Delta}E cell line relative to wild-type C2C12 cells (29). For example, Burke et al. (29) reported induction of differentiation upon serum withdrawal leads to accelerated activation and expression of the myogenin, and p21Cip-1/Waf-1 mRNAs. Moreover, reduced expression of cyclin D1 was observed, which correlated with the increased expression of the cdk inhibitor, p21 (29). In addition, the levels of the non-muscle cytoskeletal {beta}-actin are repressed in the C2:Rev-erb{beta}{Delta}E cell line, relative to wild-type C2C12 cells (Fig. 3D) in concordance with the elevated myogenin mRNA and precocious differentiative capacity of this cell line (29).



View larger version (21K):
[in this window]
[in a new window]
  		FIG. 3.
Ectopic expression of the dominant negative Rev-erb{beta}{Delta}E accelerates myogenesis and induces expression of ROR{alpha}. Total RNA was extracted from the wild type (C2C12) and the dominant negative (C2:Rev-erb{beta}{Delta}E) cell lines from proliferating myoblasts (PMB), and myotubes after 4 days of serum withdrawal (MT4), reverse transcribed to cDNA, and analyzed by Q-RT-PCR. Gene-specific primers were used to examine the expression of: A and B, Rev-erb{beta}{Delta}E; C, myogenin; D, {beta}-actin E, Rev-erb{alpha}; F, ROR{alpha}. Normalized expression is calculated relative to the expression of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) RNA (B) or 18 S rRNA (A, C–F) determined with the same cDNA. All reactions were performed in triplicate and results are shown as average ± S.D.

 
We used Q-RT-PCR with an ABI Taqman primer set that does not discriminate between ectopic Rev-erb{beta}{Delta}E and endogenous Rev-erb{beta} mRNA expression to determine the total quantity of Rev-erb{beta} mRNA in the stable cell line. We observed that the total pool of Rev-erb{beta} mRNA is increased by ~20–30% in myotubes from the C2:Rev-erb{beta}{Delta}E cell line relative to wild type C2C12s (data not shown). Considering the efficient expression of the exogenous Rev-erb{beta}{Delta}E mRNA transcript (Fig. 3, A and B), this data suggests that the endogenous transcript expression is reduced, in concordance with the previous analysis of this cell line (29). The down-regulation of the endogenous transcript is not surprising. During myogenesis, mRNA pool sizes in muscle tissue are under strict control (31) and mechanisms in skeletal muscle exist that sense total output from exogenous and endogenous genes (32). Furthermore, exogenous expression of a number of different contractile protein transgenes in the mouse (e.g. myosin light chain 2, troponin I fast, skeletal and cardiac actin) results in the decline of the expression of the corresponding endogenous gene (32–36).

Ectopic Rev-erb{beta}{Delta}E mRNA expression does not affect the mRNA expression level of the other member of the Rev-erb family, Rev-erbA{alpha} (Fig. 3E). Interestingly, the closely related but opposingly acting orphan receptor, ROR{alpha}, was dramatically increased ~6-fold (Fig. 3F) in the C2:Rev-erb{beta}{Delta}E cell line. However, the levels of ROR-{gamma} remain unchanged (see Table IV). These data indicate that there is cross-talk between these two related, but opposingly acting, orphan receptors in skeletal muscle cells.


View this table:
[in this window]
[in a new window]
  		TABLE IV
Relative changes in the expression of the nuclear hormone receptors in skeletal muscle cells constitutively expressing Rev-erb{beta}{Delta}E

 
Dominant Negative Rev-erb{beta} Regulates the Expression of Genes Involved in Lipid Absorption and Energy Expenditure— The expression of many metabolic markers is altered during skeletal muscle differentiation and acquisition of the muscle-specific and contractile phenotype (Fig. 1). We therefore analyzed the expression of the genes involved in differentiation and skeletal muscle metabolism in the C2:Rev-erb{beta}{Delta}E cell line, relative to wild-type C2C12 cells (see Table I and II). Before analysis of the mRNAs encoding the metabolic enzymes we first characterized the key markers of differentiation in the C2:Rev-erb{beta}{Delta}E cell line to determine a threshold of significance with which to assess putative changes in a relevant context.


View this table:
[in this window]
[in a new window]
  		TABLE II
Relative changes in the expression of genes involved in lipid metabolism in skeletal muscle cells constitutively expressing Rev-erb{beta}{Delta}E

 
We observed that after mitogen withdrawal, the C2:Rev-erb{beta}{Delta}E cells formed post-mitotic multinucleated myotubes and thus had morphologically differentiated. The induction and activation of myogenin (Fig. 3C) demonstrated that the cells had also acquired a muscle-specific phenotype. Transcripts for the contractile proteins troponin I slow ((Tnni1) Fig. 4A), and troponin I fast ((Tnni2) (Fig. 4B)) were also induced after serum withdrawal demonstrating that the C2:Rev-erb{beta}{Delta}E cell line had acquired a contractile phenotype and was biochemically differentiated. Analysis of the relative expression of these biochemical markers in wild type C2C12 versus C2:Rev-erb{beta}{Delta}E myotubes after 4 days of serum withdrawal revealed that myogenin (Fig. 3C) and fast type II (Tnni2) mRNA expression (Fig. 4, C and D) were increased ~1.5–2-fold. The TNNI1 mRNA encoding the slow type I isoform was actually slightly reduced.



View larger version (17K):
[in this window]
[in a new window]
  		FIG. 4.
The C2:Rev-erb{beta}{Delta}E cell line acquires contractile markers of skeletal muscle. A and B, expression of troponin I type I (slow; Tnni1) and II (fast; Tnni2) mRNA levels, respectively, in the C2:Rev-erb{beta}{Delta}E cell line. Total RNA was extracted from proliferating myoblasts (PMB) or myotubes were harvested after 4 days of serum withdrawal (MT4), reverse transcribed to cDNA, and analyzed by Q-RT-PCR. Gene-specific primers were used to examine the expression of Tnni1 (A) and Tnni2 (B). C and D, total RNA was extracted from wild type (C2C12) and dominant negative (C2:Rev-erb{beta}{Delta}E) cell lines from myotubes after 4 days of serum withdrawal, reverse transcribed to cDNA, and analyzed by Q-RT-PCR. Gene-specific primers were used to examine the expression of Tnni1 (C) and Tnni2 (D). Normalized expression was calculated relative to the expression of 18S rRNA determined with the same cDNA. All reactions were performed in triplicate and results are shown as average ± S.D.

 
This indicated that any major changes in the expression of metabolic markers were not because of compromised morphological and/or biochemical differentiation. Moreover, these data provide a threshold of significance whereby altered expression of genes involved in skeletal muscle metabolism would only be considered to be of importance if it varied more than 2-fold.

Analysis of the expression of the genes involved in skeletal muscle metabolism in these cell lines revealed that attenuation of Rev-erb{beta} had a number of significant effects in C2C12 cells (Table II). In the context of lipid and fatty acid absorption we observed repression of the mRNAs encoding Fabp-3 and -4 (~5 and ~24-fold) and Fat/Cd36 (~5-fold) (Fig. 5, A–C). Analysis of genes involved in the regulation of energy expenditure and lipid utilization showed that the expression of Ucp3 mRNA (Fig. 5D) was significantly repressed (~7.5-fold). In contrast, Ucp2 mRNA showed minimum changes in the cell line overexpressing Rev-erb{beta}{Delta}E, relative to the ~2-fold changes observed in the markers of differentiation (Table II). Moreover, the mRNA encoding Ampk{gamma}3 (preferentially expressed in glycolytic fast twitch muscle fibers), a regulator of glucose uptake, and energy balance was unchanged by Rev-erb{beta}{Delta}E expression. The expression of Scd-1, a key enzyme involved in adiposity, is repressed ~4-fold in the cell line overexpressing Rev-erb{beta}{Delta}E (Fig. 5E). In contrast, the expression of mRNA encoding the Scd-2 was relatively unaffected. Surprisingly, Srebp-1c mRNA expression increased 2.8-fold (Fig. 5F, Table II).



View larger version (25K):
[in this window]
[in a new window]
  		FIG. 5.
Rev-erb{beta} controls genes that regulate lipid metabolism and energy expenditure. Total RNA was extracted from wild type (C2C12) and dominant negative (C2:Rev-erb{beta}{Delta}E) cell lines from myotubes after 4 days of serum withdrawal, reverse transcribed to cDNA, and analyzed by Q-RT-PCR. Gene-specific primers were used to examine the expression of: A, Fabp-3; B, Fabp-4; C, Cd36; D, Ucp-3; E, Scd-1; and F, Srebp1c. Relative expression is shown as -fold repression and -fold activation calculated relative to the expression in the wild type C2C12 cell line, which was arbitrarily set at 1. All reactions were performed in triplicate and results are shown as average ± S.D.

 
The expression of the transcripts encoding Cpt1, Mcad, and Acs-4 that are involved in lipid catabolism and preferential fuel utilization were not affected in the Rev-erb{beta}{Delta}E expressing cell line (Table II). Additionally, we did not observe any changes in the expression of mRNAs encoding ABCA1, ABCA8/G1, apoE, Cav-3, and ADRP, which are involved in cholesterol homeostasis and lipid storage (Table II). Analysis of the expression of many other nuclear hormone receptors that have been demonstrated to regulate lipid and carbohydrate metabolism, including ERR{alpha}, PPAR-{alpha}, -{beta}/{delta}, and -{gamma}, LXR{alpha} and -{beta}, Rev-erb{alpha}, and Nur77 demonstrated that Rev-erb{beta}{Delta}E expression did not affect the expression of the mRNAs encoding these NRs (see Table IV).

Rev-erb{beta} Modulates Myokine Expression—Muscle cytokines (myokines) include IL-6, IL-15, and myostatin control inflammation, energy expenditure, muscle growth, and fat deposition (see Table I). The Rev-erb{alpha} nuclear receptor has been implicated in the control of inflammation, and the modulation of the NF{kappa}B-dependent pathway. Therefore, we decided to investigate the expression of several myokines and inflammatory markers/regulators in the wild-type and C2C12 cells expressing Rev-erb{beta}{Delta}E.

Initially, we examined the expression of IL-6, IL-15, myostatin, and I{kappa}B{alpha} (the regulator of NF{kappa}B) during differentiation of native C2C12 cells. We isolated total RNA from wild type C2C12 proliferating myoblasts, and post-mitotic multinucleated myotubes after 4 days of serum withdrawal, and analyzed the expression levels of mRNAs by Q-RT-PCR. First, we observed that these myokines, and modulators of the inflammatory process, were expressed in wild type C2C12 cells (Fig. 6). Second, we observed that IL-15 and myostatin were induced (~31- and 25-fold, respectively), whereas I{kappa}B{alpha} and IL-6 were repressed (~2.5- and 5.5-fold, respectively) during myogenic differentiation (Fig. 6, A–D).



View larger version (24K):
[in this window]
[in a new window]
  		FIG. 6.
Rev-erb{beta} regulates myokine expression. Total RNA was isolated from wild type C2C12 proliferating myoblasts (PMB) and post-mitotic multinucleated myotubes after 4 days of serum withdrawal (MT4), A–D, or wild type (C2C12) and dominant negative (C2:Rev-erb{beta}{Delta}E) cell lines from myotubes after 4 days of serum withdrawal (E–H). RNA was reverse transcribed to cDNA and analyzed by Q-RT-PCR. Gene-specific primers were used to examine the expression of: A and E, I{kappa}B{alpha}; B and F, IL-6; C and G, IL-15; and D and H, myostatin. Relative expression is shown as -fold repression and -fold activation calculated relative to the expression in the wild type C2C12 cell line that was arbitrarily set at 1. All reactions were performed with at least triplicates and results are shown as average ± S.D.

 
Subsequently, we examined the effect of Rev-erb{beta}{Delta}E on the expression of the myokines, and inflammatory regulators in C2:Rev-erb{beta}{Delta}E cells after 4 days of serum withdrawal, relative to similarly differentiated native C2C12 cells by Q-RT-PCR (see Table III). Interestingly, we observed that ectopic expression of Rev-erb{beta}{Delta}E leads to an induction in the inhibitor of NF{kappa}B-mediated gene expression, I{kappa}B{alpha} (Fig. 6E). Consistent with increased expression of I{kappa}B{alpha}, mRNAs encoding the NF{kappa}B and tumor necrosis factor target genes IL-15 (Fig. 6G) and Cox-2 (Table III) were not induced in cells expressing Rev-erb{beta}{Delta}E.


View this table:
[in this window]
[in a new window]
  		TABLE III
Relative changes in the expression of genes encoding myokines and inflammatory markers in skeletal muscle cells constitutively expressing Rev-erb{beta}{Delta}E

 
Curiously, we found that IL-6 mRNA is robustly increased (~15-fold; Fig. 6F), and myostatin mRNA is dramatically reduced (~24-fold; Fig. 6H) in the cells expressing Rev-erb{beta}{Delta}E, concordant with the precocious differentiation of the C2:Rev-erb{beta}{Delta}E cell line. In summary, this demonstrates that Rev-erb{beta} regulates myokine expression, and as such is a critical modulator of muscle growth and inflammation in this tissue.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
We have utilized the C2C12 in vitro cell culture model system and ectopic overexpression of dominant negative Rev-erb{beta} to investigate the role of this orphan receptor in skeletal muscle lipid, and energy homeostasis. Here we report that perturbation of Rev-erb{beta} function decreases the expression of genes involved in lipid absorption. Additionally, we observed dramatic induction and repression of two myokines, IL-6, and myostatin, respectively, which are involved in energy expenditure, inflammation, muscle hypertrophy and hyperplasia, and the accumulation of body fat.

These observations are consistent with genetic and molecular studies that demonstrate that the NR1D subfamily of nuclear receptors (Reverbs) has a direct role in lipid homeostasis. For example, the NR1D subfamily of orphan receptors regulate the expression of ApoC-III (20, 21), a major component of triglyceride-rich remnant lipoprotein and associated with hypertriglyceridemia (37). In addition, Rev-erb{alpha} –/– mice have elevated levels of ApoC-III and very low density lipoprotein triglycerides. Moreover, Rev-erb{alpha} regulates ApoA1 gene expression in rodents treated with the hypolipidemic fibrate drugs. Finally, Rev-erb{alpha} is preferentially expressed in fast twitch/type IIB glycolytic, and intermediate type IIA oxidative fibers and null mutations lead to a transition to type I fibers (38). This suggests that this orphan NR subgroup regulates muscle fiber type, which can influence insulin sensitivity and the utilization of aerobic/anaerobic metabolism for the generation of ATP.

Specifically, we demonstrated that attenuation of Rev-erb{beta}-mediated gene expression suppresses the expression of a subgroup of genes that include Fabp-3 and -4, Cd36, Ucp-3, and Scd-1 that are involved in lipid absorption and utilization. In this context, it is interesting to note that mice with a targeted disruption of SCD-1, a key target for Rev-erb{beta}, had lower levels of very low density lipoprotein, impaired triglyceride and cholesterol ester biosynthesis, and a lean phenotype (39). The Scd-1 –/– phenotype is very similar to the natural mutation called staggerer (ROR{alpha}sg/sg) in an obese mouse strain, which leads to a functional knockout of ROR{alpha}. The staggerer mice exhibit an aberrant blood-lipid profile with lower circulating plasma levels of HDL-C, apoC-III, and plasma triglycerides. It should be noted that a dominant negative ROR{alpha} represses both Rev-erb{alpha} and -{beta} mRNA expression in skeletal muscle (16). Moreover, lack of Fabp4, a key target for Rev-erb{beta} in our model, protected the mice deficient in ApoE against atherosclerosis (40).

Interestingly, we observed a suppression in the expression of genes involved in lipid absorption, and in Scd-1 that is involved in the formation of cholesterol esters. Moreover the activity of Scd-1 has also been linked to adiposity. Curiously, we observed an increase in Srebp-1c expression, the master regulator of fatty acid metabolism. This apparent contradiction is in concordance with several reports in the literature. For example, Raspe et al. (15), showed that staggerer mice have reduced plasma triglycerides, and Lau et al. (16) demonstrated that a dominant negative ROR{alpha} expression in muscle reduced Srebp-1c mRNA expression. The increase in SREBP-1c expression correlates with the >5-fold increase in ROR{alpha} mRNA expression in the C2:Rev-erb{beta}{Delta}E cell line. Second, in most tissues SREBP-1c and SCD-1 mRNA are coordinately expressed and regulated. However, it has been previously reported in skeletal muscle cells, and tissue treated with LXR agonists, that Srebp-1c and Scd-1 mRNA expression are uncoupled, and not co-ordinately regulated (23).

Our studies also demonstrate that Rev-erb{beta} has a crucial role in regulating UCP3. Abundant expression of this gene correlates with preferential lipid utilization, and increased energy expenditure. The role of uncoupling proteins in regulating energy balance have been extensively investigated through transgenic mice and cell culture studies (41–43). Repression of UCP3 mRNA also correlates with the decreased expression of genes involved in lipid absorption and utilization, in concordance with the observations derived from this study.

Recent studies (22, 44, 45) have demonstrated a role of ROR{alpha} in the inflammation process. For example, ROR{alpha} has an anti-inflammatory role by inhibiting tumor necrosis factor-{alpha}-induced gene expression (22). The molecular basis of this modulation involves the direct induction of I{kappa}B{alpha} transcription, thereby inhibiting the NF{kappa}B signaling cascade. Conversely, Rev-erb{alpha} induces the NF{kappa}B-mediated activation of the inflammatory cascade, for example, Cox-2 (44). Our studies show that attenuation of Rev-erb{beta}-mediated gene regulation leads to elevated ROR{alpha} and I{kappa}B{alpha} expression in skeletal muscle cells. This correlates with no change in expression of the NF{kappa}B/tumor necrosis factor target genes, Cox-2 and IL-15.

Surprisingly, these studies have revealed a dramatic induction (~15-fold) of interleukin-6, in the presence of increased I{kappa}B{alpha} expression. However, IL-6 is an exercised induced myokine that induces lipolysis in adipose tissue, and suppresses tumor necrosis factor production. The increased expression of IL-6 is consistent with decreased myostatin expression. For example, it has been reported that IL-6 deficiency leads to late-onset obesity (46), whereas myostatin deficiency leads to the reduced accumulation of body fat (47). Therefore, the inverse correlation between IL-6 and myostatin expression in our Rev-erb{beta} cell line is in concordance with the phenotypic effects of these myokines on metabolism (48–50). The study has implicated Rev-erb{beta} in the regulatory cascade controlling genes involved in lipid homeostasis. Furthermore, the significant impact on myokine expression that regulates inflammation, lipolysis, muscle growth, and the accumulation of body fat underscores the potential therapeutic utility of Rev-erb modulation by inverse agonists/antagonists. However, identification of small molecule regulators will be hindered by the lack of a significant pocket in the ligand binding domain in the Rev-erb/NR1D subgroup of orphan nuclear receptors (51).

It is becoming increasingly apparent that skeletal muscle is a critical target tissue in the fight against metabolic disorders associated with diet, lifestyle, and metabolism. For example, LXR, PPAR{alpha}, -{beta}/{delta}, and -{gamma} in skeletal muscle have been shown to be involved in enhancing the insulin-stimulated glucose disposal rate, decreasing triglycerides, increasing energy expenditure, and increasing lipid catabolism, cholesterol efflux, and plasma HDL-C levels (14, 23–28).

Activation of these NRs in muscle has lead to increased insulin sensitivity, resistance to diet-induced obesity, and atherosclerosis. Hence, orphan nuclear receptors (for example, Rev-erb{beta}) that regulate lipid homeostasis and inflammation in skeletal muscle have enormous homeostatic ramifications. As discussed, skeletal muscle is a major mass peripheral tissue, and this lean tissue accounts for ~40% of the total body mass (36% for females, and 42% for males) and 30–50% of the energy expenditure. These results indicate significant homeostatic interrelationships between the muscular and other body systems including the cardiovascular, endocrine, and lymphatic networks for the treatment of dyslipidemia, syndrome X, and inflammation. In conclusion, we suggest that in skeletal muscle cells, Rev-erb{beta} programs a cascade of gene expression that controls the regulatory cross-talk between lipid metabolism and inflammation.


   FOOTNOTES
 
* This work was supported by a National Health and Medical Research Council of Australia (NHMRC) project grant. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

{ddagger} Principal Research Fellow of the NHMRC. To whom correspondence should be addressed. Tel.: 61-7-3346-2039; E-mail: g.muscat{at}imb.uq.edu.au.

1 The abbreviations used are: NR, nuclear receptor; DOTAP, N-(1-(2,3-dioleoyloxy)propyl)-N,N,N-trimethylammonium methylsulfate; ROR, retinoic acid-related orphan receptor; HDL, high density lipoprotein; PPAR, peroxisome proliferator-activated receptor; Q-RT, quantitative real time; IL, interleukin; SREBP, sterol regulatory element-binding protein. Back


   ACKNOWLEDGMENTS
 
We thank Rachel Burow and Shayama Wijedasa for technical assistance with cell culture and plasmid preparation.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Evans, R. M. (1988) Science 240, 889–895[Abstract/Free Full Text]
  2. Nuclear Receptors Nomenclature Committee (1999) Cell 97, 161–163[CrossRef][Medline] [Order article via Infotrieve]
  3. Giguere, V. (1999) Endocr. Rev. 20, 689–725[Abstract/Free Full Text]
  4. Enmark, E., Kainu, T., Pelto-Huikko, M., and Gustafsson, J. A. (1994) Biochem. Biophys. Res. Commun. 204, 49–56[CrossRef][Medline] [Order article via Infotrieve]
  5. Dumas, B., Harding, H. P., Choi, H. S., Lehmann, K. A., Chung, M., Lazar, M. A., and Moore, D. D. (1994) Mol. Endocrinol. 8, 996–1005[Abstract/Free Full Text]
  6. Forman, B. M., Chen, J., Blumberg, B., Kliewer, S. A., Henshaw, R., Ong, E. S., and Evans, R. M. (1994) Mol. Endocrinol. 8, 1253–1261[Abstract/Free Full Text]
  7. Giambiagi, N., Cassia, R., Petropoulos, I., Part, D., Cereghini, S., Zakin, M. M., and Ochoa, A. (1995) Biochem. Mol. Biol. Int. 37, 1091–1102[Medline] [Order article via Infotrieve]
  8. Bonnelye, E., Vanacker, J. M., Desbiens, X., Begue, A., Stehelin, D., and Laudet, V. (1994) Cell Growth Differ. 5, 1357–1365[Abstract]
  9. Adelmant, G., Begue, A., Stehelin, D., and Laudet, V. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 3553–3558[Abstract/Free Full Text]
  10. Dussault, I., and Giguere, V. (1997) Mol. Cell. Biol. 17, 1860–1867[Abstract]
  11. Bois-Joyeux, B., Chauvet, C., Nacer-Cherif, H., Bergeret, W., Mazure, N., Giguere, V., Laudet, V., and Danan, J. L. (2000) DNA Cell Biol. 19, 589–599[CrossRef][Medline] [Order article via Infotrieve]
  12. Retnakaran, R., Flock, G., and Giguere, V. (1994) Mol. Endocrinol. 8, 1234–1244[Abstract/Free Full Text]
  13. Delerive, P., Chin, W. W., and Suen, C. S. (2002) J. Biol. Chem. 277, 35013–35018[Abstract/Free Full Text]
  14. Tanaka, T., Yamamoto, J., Iwasaki, S., Asaba, H., Hamura, H., Ikeda, Y., Watanabe, M., Magoori, K., Ioka, R. X., Tachibana, K., Watanabe, Y., Uchiyama, Y., Sumi, K., Iguchi, H., Ito, S., Doi, T., Hamakubo, T., Naito, M., Auwerx, J., Yanagisawa, M., Kodama, T., and Sakai, J. (2003) Proc. Natl. Acad. Sci. U. S. A. 100, 15924–15929[Abstract/Free Full Text]
  15. Raspe, E., Duez, H., Gervois, P., Fievet, C., Fruchart, J. C., Besnard, S., Mariani, J., Tedgui, A., and Staels, B. (2001) J. Biol. Chem. 276, 2865–2871[Abstract/Free Full Text]
  16. Lau, P., Nixon, S. J., Parton, R. G., and Muscat, G. E. (2004) J. Biol. Chem. 279, 36828–36840[Abstract/Free Full Text]
  17. Vu-Dac, N., Chopin-Delannoy, S., Gervois, P., Bonnelye, E., Martin, G., Fruchart, J. C., Laudet, V., and Staels, B. (1998) J. Biol. Chem. 273, 25713–25720[Abstract/Free Full Text]
  18. Panagotopulos, S. E., Witting, S. R., Horace, E. M., Hui, D. Y., Maiorano, J. N., and Davidson, W. S. (2002) J. Biol. Chem. 277, 39477–39484[Abstract/Free Full Text]
  19. Liu, L., Bortnick, A. E., Nickel, M., Dhanasekaran, P., Subbaiah, P. V., Lund-Katz, S., Rothblat, G. H., and Phillips, M. C. (2003) J. Biol. Chem. 278, 42976–42984[Abstract/Free Full Text]
  20. Raspe, E., Duez, H., Mansen, A., Fontaine, C., Fievet, C., Fruchart, J. C., Vennstrom, B., and Staels, B. (2002) J. Lipid Res. 43, 2172–2179[Abstract/Free Full Text]
  21. Coste, H., and Rodriguez, J. C. (2002) J. Biol. Chem. 277, 27120–27129[Abstract/Free Full Text]
  22. Delerive, P., Monte, D., Dubois, G., Trottein, F., Fruchart-Najib, J., Mariani, J., Fruchart, J. C., and Staels, B. (2001) EMBO Rep. 2, 42–48[CrossRef][Medline] [Order article via Infotrieve]
  23. Muscat, G. E., Wagner, B. L., Hou, J., Tangirala, R. K., Bischoff, E. D., Rohde, P., Petrowski, M., Li, J., Shao, G., Macondray, G., and Schulman, I. G. (2002) J. Biol. Chem. 277, 40722–40728[Abstract/Free Full Text]
  24. Dressel, U., Allen, T. L., Pippal, J. B., Rohde, P. R., Lau, P., and Muscat, G. E. (2003) Mol. Endocrinol. 17, 2477–2493[Abstract/Free Full Text]
  25. Holst, D., Luquet, S., Nogueira, V., Kristiansen, K., Leverve, X., and Grimaldi, P. A. (2003) Biochim. Biophys. Acta. 1633, 43–50[Medline] [Order article via Infotrieve]
  26. Wang, Y. X., Lee, C. H., Tiep, S., Yu, R. T., Ham, J., Kang, H., and Evans, R. M. (2003) Cell 113, 159–170[CrossRef][Medline] [Order article via Infotrieve]
  27. Muoio, D. M., MacLean, P. S., Lang, D. B., Li, S., Houmard, J. A., Way, J. M., Winegar, D. A., Corton, J. C., Dohm, G. L., and Kraus, W. E. (2002) J. Biol. Chem. 277, 26089–26097[Abstract/Free Full Text]
  28. Hevener, A. L., He, W., Barak, Y., Le, J., Bandyopadhyay, G., Olson, P., Wilkes, J., Evans, R. M., and Olefsky, J. (2003) Nat. Med. 9, 1491–1497[CrossRef][Medline] [Order article via Infotrieve]
  29. Burke, L., Downes, M., Carozzi, A., Giguere, V., and Muscat, G. E. (1996) Nucleic Acids Res. 24, 3481–3489[Abstract/Free Full Text]
  30. Burke, L. J., Downes, M., Laudet, V., and Muscat, G. E. (1998) Mol. Endocrinol. 12, 248–262[Abstract/Free Full Text]
  31. Wade, R., Sutherland, C., Gahlmann, R., Kedes, L., Hardeman, E., and Gunning, P. (1990) Dev. Biol. 142, 270–282[CrossRef][Medline] [Order article via Infotrieve]
  32. Lloyd, C., Schevzov, G., and Gunning, P. (1992) J. Cell Biol. 117, 787–797[Abstract/Free Full Text]
  33. Brennan, K. J., and Hardeman, E. C. (1993) J. Biol. Chem. 268, 719–725[Abstract/Free Full Text]
  34. Dunwoodie, S. L., Joya, J. E., Arkell, R. M., and Hardeman, E. C. (1994) J. Biol. Chem. 269, 12212–12219[Abstract/Free Full Text]
  35. Shani, M. (1986) Mol. Cell. Biol. 6, 2624–2631[Abstract/Free Full Text]
  36. Shani, M., Dekel, I., and Yoffe, O. (1988) Mol. Cell. Biol. 8, 1006–1009[Abstract/Free Full Text]
  37. Esterbauer, H., Hell, E., Krempler, F., and Patsch, W. (1999) Clin. Chem. 45, 331–339[Abstract/Free Full Text]
  38. Pircher, P., Chomez, P., Yu, F., Vennstrom, B., and Larsson, L. (2005) Am. J. Physiol. Regul. Integr. Comp. Physiol. 288, R482–R490[Abstract/Free Full Text]
  39. Attie, A. D., Krauss, R. M., Gray-Keller, M. P., Brownlie, A., Miyazaki, M., Kastelein, J. J., Lusis, A. J., Stalenhoef, A. F., Stoehr, J. P., Hayden, M. R., and Ntambi, J. M. (2002) J. Lipid Res. 43, 1899–1907[Abstract/Free Full Text]
  40. Makowski, L., Boord, J. B., Maeda, K., Babaev, V. R., Uysal, K. T., Morgan, M. A., Parker, R. A., Suttles, J., Fazio, S., Hotamisligil, G. S., and Linton, M. F. (2001) Nat. Med. 7, 699–705[CrossRef][Medline] [Order article via Infotrieve]
  41. Clapham, J. C., Coulthard, V. H., and Moore, G. B. (2001) Biochem. Biophys. Res. Commun. 287, 1058–1062[CrossRef][Medline] [Order article via Infotrieve]
  42. Moore, G. B., Himms-Hagen, J., Harper, M. E., and Clapham, J. C. (2001) Biochem. Biophys. Res. Commun. 283, 785–790[CrossRef][Medline] [Order article via Infotrieve]
  43. Wang, S., Cawthorne, M. A., and Clapham, J. C. (2002) Ann. N. Y. Acad. Sci. 967, 112–119[Medline] [Order article via Infotrieve]
  44. Migita, H., Morser, J., and Kawai, K. (2004) FEBS Lett. 561, 69–74[CrossRef][Medline] [Order article via Infotrieve]
  45. Migita, H., Satozawa, N., Lin, J. H., Morser, J., and Kawai, K. (2004) FEBS Lett. 557, 269–274[CrossRef][Medline] [Order article via Infotrieve]
  46. Wallenius, V., Wallenius, K., Ahren, B., Rudling, M., Carlsten, H., Dickson, S. L., Ohlsson, C., and Jansson, J. O. (2002) Nat. Med. 8, 75–79[CrossRef][Medline] [Order article via Infotrieve]
  47. McPherron, A. C., and Lee, S. J. (2002) J. Clin. Investig. 109, 595–601[CrossRef][Medline] [Order article via Infotrieve]
  48. Bruce, C. R., and Dyck, D. J. (2004) Am. J. Physiol. 287, E616–E621
  49. Faldt, J., Wernstedt, I., Fitzgerald, S. M., Wallenius, K., Bergstrom, G., and Jansson, J. O. (2004) Endocrinology 145, 2680–2686[CrossRef][Medline] [Order article via Infotrieve]
  50. Di Gregorio, G. B., Hensley, L., Lu, T., Ranganathan, G., and Kern, P. A. (2004) Am. J. Physiol. 287, E182–E187
  51. Renaud, J. P., Harris, J. M., Downes, M., Burke, L. J., and Muscat, G. E. (2000) Mol. Endocrinol. 14, 700–717[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 Mol. Endocrinol.Home page
S. Hummasti and P. Tontonoz
Adopting New Orphans into the Family of Metabolic Regulators
Mol. Endocrinol., August 1, 2008; 22(8): 1743 - 1753.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Endocrinol.Home page
T. P. Burris
Nuclear Hormone Receptors for Heme: REV-ERB{alpha} and REV-ERB{beta} Are Ligand-Regulated Components of the Mammalian Clock
Mol. Endocrinol., July 1, 2008; 22(7): 1509 - 1520.
[Abstract] [Full Text] [PDF]

Home page
 Diabetes and Vascular Disease ResearchHome page
H. Duez and B. Staels
The nuclear receptors Rev-erbs and RORs integrate circadian rhythms and metabolism
Diabetes and Vascular Disease Research, June 1, 2008; 5(2): 82 - 88.
[Abstract] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
H. Watarai, E. Sekine, S. Inoue, R. Nakagawa, T. Kaisho, and M. Taniguchi
PDC-TREM, a plasmacytoid dendritic cell-specific receptor, is responsible for augmented production of type I interferon
PNAS, February 26, 2008; 105(8): 2993 - 2998.
[Abstract] [Full Text] [PDF]

Home page
 Physiol. GenomicsHome page
J. J. McCarthy, J. L. Andrews, E. L. McDearmon, K. S. Campbell, B. K. Barber, B. H. Miller, J. R. Walker, J. B. Hogenesch, J. S. Takahashi, and K. A. Esser
Identification of the circadian transcriptome in adult mouse skeletal muscle
Physiol Genomics, September 11, 2007; 31(1): 86 - 95.
[Abstract] [Full Text] [PDF]

Home page
 J Mol EndocrinolHome page
S. Raichur, P. Lau, B. Staels, and G. E O Muscat
Retinoid-related orphan receptor {gamma} regulates several genes that control metabolism in skeletal muscle cells: links to modulation of reactive oxygen species production
J. Mol. Endocrinol., July 1, 2007; 39(1): 29 - 44.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
M. A. Pearen, J. G. Ryall, M. A. Maxwell, N. Ohkura, G. S. Lynch, and G. E. O. Muscat
The Orphan Nuclear Receptor, NOR-1, Is a Target of {beta}-Adrenergic Signaling in Skeletal Muscle
Endocrinology, November 1, 2006; 147(11): 5217 - 5227.
[Abstract] [Full Text] [PDF]

Home page
 Physiol. GenomicsHome page
J.-J. Park, J. R. Berggren, M. W. Hulver, J. A Houmard, and E. P. Hoffman
GRB14, GPD1, and GDF8 as potential network collaborators in weight loss-induced improvements in insulin action in human skeletal muscle
Physiol Genomics, October 11, 2006; 27(2): 114 - 121.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
S. A. Myers, S.-C. M. Wang, and G. E. O. Muscat
The Chicken Ovalbumin Upstream Promoter-Transcription Factors Modulate Genes and Pathways Involved in Skeletal Muscle Cell Metabolism
J. Biol. Chem., August 25, 2006; 281(34): 24149 - 24160.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Cell Physiol.Home page
A. G. Smith and G. E. O. Muscat
Orphan nuclear receptors: therapeutic opportunities in skeletal muscle
Am J Physiol Cell Physiol, August 1, 2006; 291(2): C203 - C217.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
M. A. Maxwell, M. E. Cleasby, A. Harding, A. Stark, G. J. Cooney, and G. E. O. Muscat
Nur77 Regulates Lipolysis in Skeletal Muscle Cells: EVIDENCE FOR CROSS-TALK BETWEEN THE {beta}-ADRENERGIC AND AN ORPHAN NUCLEAR HORMONE RECEPTOR PATHWAY
J. Biol. Chem., April 1, 2005; 280(13): 12573 - 12584.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
280/10/8651    most recent
M413949200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ramakrishnan, S. N.
Right arrow Articles by Muscat, G. E. O.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ramakrishnan, S. N.
Right arrow Articles by Muscat, G. E. O.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2005 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement