| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
J. Biol. Chem., Vol. 280, Issue 11, 10202-10209, March 18, 2005
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the
Cystic Fibrosis/Pulmonary Research and Treatment Center, University of North Carolina at Chapel Hill, North Carolina 27599-7248 and ¶Inositide Signaling Section, Laboratory of Signal Transduction, NIEHS, National Institutes of Health, Research Triangle Park, North Carolina 27709
Received for publication, September 15, 2004 , and in revised form, January 6, 2005.
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
F508 CFTR or was an acquired response to chronic luminal airway infection/inflammation, three approaches were used. First, ER density was studied in normal and CF sweat duct human epithelia expressing high levels of F508 CFTR, and it was found to be the same in normal and CF epithelia. Second, apical ER density was morphometrically analyzed in airway epithelia from normal subjects, F508 homozygous CF patients, and a disease control, primary ciliary dyskinesia; it was found to be greater in both CF and primary ciliary dyskinesia. Third, apical ER density and P2Y2-R activation-mobilized Ca2+i, which were investigated in airway epithelia in a long term culture in the absence of luminal infection, were similar in normal and CF epithelia. To directly test whether luminal infection/inflammation triggers an up-regulation of the apically confined ER Ca2+ stores, normal airway epithelia were chronically exposed to supernatant from mucopurulent material from CF airways. Supernatant treatment expanded the apically confined ER, resulting in larger apical P2Y2-R activation-dependent Ca2+i responses, which reproduced the increased Ca2+i signals observed in CF epithelia. In conclusion, the mechanism for the larger Ca2+i signals elicited by apical P2Y2-R activation in CF airway epithelia is an expansion of the apical ER Ca2+ stores triggered by chronic luminal airway infection/inflammation. Greater ER-derived Ca2+i signals may provide a compensatory mechanism to restore, at least acutely, mucus clearance in CF airways. |
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
In airway epithelia of patients with cystic fibrosis (CF), the functional absence of the cystic fibrosis transmembrane conductance regulator (CFTR) results in a diminished periciliary liquid layer depth (6) and a reduction in mucus clearance. Likewise, abnormal mucus clearance is found in patients with primary ciliary dyskinesia (PCD), a syndrome that results from defective airway epithelial ciliary proteins linked to a decreased ciliary activity (7). In both diseases, persistent airways infection and inflammation are the predominant clinical phenotypic characteristics consequent to the impairment of mucus clearance (8).
There are clues that airway epithelia may regulate the Ca2+i signaling pathway in response to airways disease. For example, in vivo studies established that the nasal transepithelial electrical potential difference responses to agents that activate P2Y2-Rs and promote Ca2+i mobilization (e.g. ATP/UTP) are greater in CF patients than in normal subjects (9, 10). In vitro studies also detected a larger apical Ca2+i-dependent Cl– conductance in CF airway epithelia (9, 11–13). In addition, we recently reported that apical P2Y2-R activation promotes greater Ca2+i mobilization in CF compared with normal human nasal epithelia (4). However, the underlying mechanism(s) responsible for the regulation of the increased Ca2+i responsiveness of CF airway epithelia and its functional consequences are unknown.
Therefore, in the present study we investigated the mechanism for the augmented apical GPCR-derived Ca2+i signals in CF airway epithelia by probing the P2Y2-R/Ca2+ signaling system in functional, biochemical, and cell biological studies in normal and CF human airway epithelia. Further, we investigated whether the raised Ca2+i signals in CF are a manifestation of the molecular pathogenesis of mutant CFTR (F508 CFTR) or are an acquired host response to chronic infection/inflammation in vivo. We compared ER density in non-infected human sweat duct epithelia from normal and F508 CF individuals and in human airway epithelia from normal, F508 CF, and PCD patients with chronic airway infection and inflammation. In addition, ER density and apical P2Y2-R activation-induced Ca2+i mobilization were studied in short term and long term cultures of normal and CF bronchial epithelia. Finally, to directly address whether chronic airway infection/inflammation, independently of defective CFTR, up-regulated apically confined ER Ca2+ stores, ER density and UTP-mobilized ER Ca2+ were investigated in normal airway epithelia chronically exposed to supernatant from CF airways mucopurulent material (SMM).
|
EXPERIMENTAL PROCEDURES |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
F508 homozygous) cells were harvested and cultured as described previously (4). Cultures were maintained at an air-liquid surface interface, and polarized primary cultures were studied at 6–11 days (short term monolayers) or 30–40 days later (long term well differentiated). Normal and CF cultures were apically washed with sterile PBS, and the serosal media were replenished every 2–4 days.
Nasal scrapes obtained from normal (n = 4, ages 33–35), F508 homozygous CF (n = 4, ages 25–46), or PCD (n = 3, ages 34–57) individuals and skin biopsies from normal (n = 4, ages 28–47) and F508 homozygous CF (n = 5, ages 31–47) individuals were used for ER density studies.
Ca2+i Studies—6–11- or 30–40-day-old cultures were loaded with fura-2/AM, and Ca2+i was measured under bilateral perfusion as reported previously (4). Ca2+i signals were calibrated as described previously (14). There were no systematic differences between CF and normal epithelia as a result of differential fura-2 behavior, including dye loading. Baseline Ca2+i levels were the same in CF and normal epithelia, as reported previously (4), and no consistent differences were observed between CF and normal epithelia in the sustained phase of Ca2+i mobilization following activation of P2Y2-Rs.
Ribonuclease Protection Assay (RPA)—A 398-base pair human P2Y2-R fragment was prepared by reverse transcriptase-PCR from human airway RNA and ligated into the pCRII vector (Invitrogen). P2Y2-R primer sequences were as follows: 253F, 5'AGACCTGGGCCCCTGGAATGACACCATC3'; and 651R, 5'AGACGCCCAGACACCGGTGCACGCTGATG3'.
Individual clones were verified by automatic sequencing. Templates for RPAs were prepared by PCR from the P2Y2-R plasmid with the following primers for the PCRII vector: PCRII SP6, 5'ATGATTACGCCAAGCTATTTAGGTGACACT3' and PCRII T7, 5'GACGGCCAGTGAATTGTAATACGACTCACT3'.
50 ng of purified PCR fragment was transcribed, incorporating the [32P]UTP label with the Maxiscript kit (Ambion), and RPA was performed with the RPA III kit (Ambion). Protected fragments were quantified by phosphorimaging with ImageQuant software (Amersham Biosciences).
Phospholipase C Activity—After 4 days in culture, monolayers of normal and CF bronchial epithelia were radiolabeled with [3H]inositol for 4–5 days (15). For 20 min prior to study, cultures were placed in serum-free media containing 10 mM lithium and [3H]inositol followed by 5 min 100 µM mucosal UTP-induced PLC activity measured as reported previously (15). The levels of 3H-labeled inositol phosphates were normalized to [3H]IP6 levels because IP6 levels are not affected by agonist stimulation (16). Assays were performed in duplicate.
Immunostaining of Calreticulin and IP3 receptors (IP3Rs) and DIOC6(3) Staining—The immunostaining of calreticulin and IP3Rs in cultures and deparaffinized native bronchial epithelial or skin biopsy sections was performed according to a modification of our previous method (17). For calreticulin and IP3Rs staining, samples were incubated with a rabbit anti-calreticulin antibody (1:100 dilution, Affinity Bioreagents) and a mouse anti-IP3R antibody that recognizes all IP3R isoforms (1:100 dilution, Calbiochem) for 60 min at 37 °C. This incubation was followed by three PBS washes and a 30-min incubation at 25 °C with a fluorescein-labeled goat anti-rabbit antibody (1:20 dilution for calreticulin, Kirkegaard & Perry Laboratories) and with a Texas Red-labeled goat anti-mouse antibody (1:200 dilution for IP3Rs, Jackson Immunoresearch Laboratories). As controls, the primary antibodies were omitted or substituted with rabbit and mouse 
-globulins (Jackson Immunoresearch Laboratories). For antibody-independent ER staining, sections of native bronchial epithelia were labeled with the fluorescent dihexaoxacarbocyanine dye DIOC6(3) by incubation with 250 ng/ml DIOC6(3) for 1 min at room temperature in PBS followed by three washes with PBS as we have reported previously (17). The Ca2+ store markers and the DIOC6(3) signals were studied by laser confocal microscopy (Leica, model TCS 4D, PL APO 63x/1.20 mm water lens) in the XZ or XY scanning mode.
To quantify the fluorescence intensity of labeled calreticulin and IP3Rs and DIOC6(3), multiple scans were obtained from each sample, and regions of interest were designated in the apical domains with the MetaMorph software. The same acquisition parameters (e.g. laser power, contrast, brightness, and pinhole value) were employed for each channel to acquire the images from normal and CF cultures or native tissue in experiments performed on the same day. The fluorescence intensity values from the regions of interest were averaged from paired normal and CF cultures, native bronchial epithelia, skin biopsies, or normal cultures treated with PBS or supernatant from CF airways mucopurulent material (SMM, see "Studies with Infectious/Inflammatory Material from CF Airways").
Calreticulin Western Blot Analysis—Monolayers of normal and CF bronchial epithelia were lysed and blotted as reported previously (18). The calreticulin antibody was a rabbit polyclonal (1:5000 dilution, Affinity Bioreagents), and the secondary antibody was an anti-rabbit horseradish peroxidase (1:10,000 dilution, Amersham Biosciences). Blots were developed with enhanced chemiluminescence.
Electron Microscopy—Nasal scrapes from normal, F508 homozygous CF, and PCD individuals were fixed in 2% glutaraldehyde plus 2% paraformaldehyde plus 0.25% tannic acid, post-fixed in 1% OsO4, and processed for electron microscopy (19). Apical ER morphometric scoring was performed double blind. Only ciliated cells were analyzed, and repairing cells with migrating basal bodies (procentrioles) and micrographs with tangential cuts were excluded. The apical domain was defined as the region 1–3.4 µm (to exclude basal bodies) from the apical plasma membrane. The criteria for identifying ER were: parallel membranes in elongated or oval strands, containing an amorphous center without cristae (to exclude mitochondria), or electron-dense particles (to exclude rough ER, because it is increased in repairing cells), and not stacked (to exclude Golgi). Data are expressed as number of ER strands/µm2.
Studies with Infectious/Inflammatory Material from CF Airways— Mucopurulent material was harvested from the airway lumens of excised human CF lungs infected with Pseudomonas aeruginosa and S. aureus at the time of transplant and provided by the University of North Carolina CF Center Tissue Core. This material was centrifuged at 100,000 rpm (60 min, 4 °C), and the supernatant was filtered through a 0.2-µm filter and frozen at –80 °C. Preliminary studies revealed that treatment of airway epithelia with SMM from individual CF lungs infected with P. aeruginosa and Staphyloccocus aureus induced epithelial hyperinflammation. Because of the small volume of SMM/patient, SMMs from nine CF lungs (five males and four females, age 17–48 years, four F508 homozygous and five unknown genotypes) were pooled to assure homogeneous stimulus throughout experiments.
To address the effect of SMM on ER size and Ca2+ storage, PBS or SMM (40 µl) was applied to the mucosal surfaces of well differentiated cultures of normal bronchial epithelia for 48 h, and then either ER volume was studied by calreticulin immunostaining as described above or peak Ca2+i responses to 100 µM mucosal UTP were measured, respectively.
Statistics—Data represent the mean ± S.E. from at least three experiments from three individual donors and were analyzed by unpaired t test or two-way analysis of variance. Statistical significance was defined with p < 0.05.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
Ca2+i data (peak-baseline Ca2+i values) from these studies.
|
Ca2+i data from these experiments, illustrating that apical bradykinin receptor activation in CF also resulted in an increased Ca2+i mobilization. Because the greater bradykinin-induced Ca2+i signal in CF mimicked that elicited by P2Y2-R activation, the larger Ca2+i signal in CF does not depend on a specific class of GPCRs. P2Y2-R Number and P2Y2-R-dependent PLC Activation Are the Same in Normal and CF Airway Epithelia—We tested whether P2Y2-R expression was increased in CF. Because no antibodies or radioligands were available for P2Y2-R quantification, we used an RPA to assess P2Y2-R steady-state mRNA levels in 6–11-day-old primary culture monolayers of normal and CF bronchial airway epithelia. No difference was found in P2Y2-R mRNA levels from normal compared with CF human airway epithelia (Fig. 2, A and B).
|
Ca2+i in CF does not reflect increased P2Y2-R number or increased efficiency of P2Y2-R coupling to PLC.
Apical ER Ca2+ Stores Are Functionally Increased in CF Airway Epithelia—We next addressed whether 6–11-day old monolayers of CF cultures exhibited an increased quantity of ER Ca2+ that could be mobilized in response to IP3 generation resulting from GPCR activation. To measure the Ca2+ storage capacity of the apical ER, a protocol was developed based on findings that ER Ca2+ stores are functionally confined to the plasma membrane domain ipsilateral to P2Y2-R activation (21). 6–11-Day-old normal and CF monolayers, bathed in bilateral nominally Ca2+-free buffer, were exposed to 100 µM basolateral UTP to deplete P2Y2-R-sensitive basolateral Ca2+ stores. Basolateral UTP increased Ca2+i to the same extent in both cultures (Fig. 3A), suggesting that basolateral ER Ca2+ store capacity was the same in normal and CF epithelia. Apical ER Ca2+ store capacity was then measured with perfusion with 0.6 mM bilateral La3+ to block plasma membrane Ca2+-AT-Pases and Ca2+ influx channels (22) followed by 1 µM apical thapsigargin (an ER Ca2+-ATPase inhibitor) to release Ca2+ from apical ER stores (23). Ca2+i rose and was sustained because of inhibition of the plasma membrane and ER Ca2+-ATPases by La3+ and thapsigargin, respectively (Fig. 3A). The greater rise in Ca2+i in CF (Fig. 3A) indicated that the quantity of Ca2+ sequestered in the apical ER was functionally greater in CF compared with normal bronchial epithelial cultures. Fig. 3B illustrates the summary Ca2+i data from these experiments. These results led us to speculate that the density of apical ER Ca2+ stores is increased in short term 6–11-day-old cultures of CF airway epithelia.
|
|
To test whether the topography and expression levels of the ER Ca2+ stores found in CF versus normal short term primary culture monolayers mimicked those in vivo, confocal immunofluorescence microscopy studies of IP3Rs and calreticulin were performed in native normal and CF bronchial epithelia (Fig. 4, F and G). Similar to our findings in short term primary culture monolayers (Fig. 4, A and B), ER Ca2+ stores were distributed toward the apical domain of native epithelia, and their expression was increased in CF (Fig. 4, F and G). Collectively, these data, coupled with the direct measurement of ER density by electron microscopy (Fig. 5), strongly suggested that the functional increase in apical ER Ca2+ storage detected in CF epithelia (Fig. 3) was because of an increase in the ER volume in the apical domain.
|
F508 CFTR or an Acquired Response to Chronic Airway Infection?— Two approaches were used to address this question. First, we tested the hypothesis that the ER up-regulation could be linked to abnormal CFTR folding in the absence of infection/inflammation. We elected to study sweat ducts because they are a source of non-infected CF epithelium and they exhibit relatively high levels of CFTR expression (24). Fig. 5, A and B, depict the immunostaining of calreticulin in native sweat ducts from normal and F508 homozygous CF individuals, respectively. Quantification of calreticulin immunofluorescence revealed that its expression was the same in normal and CF sweat duct epithelia (Fig. 5C), suggesting that the ER expansion observed in CF airway epithelia was not a consequence of ER retention of F508 CFTR.
Second, we evaluated whether the ER expansion in CF was acquired by studying airway epithelia from patients with an unrelated disease characterized by chronic airways infection, e.g. PCD (8). We quantified morphometrically the ER density in freshly isolated nasal scrapes from normal (Fig. 5D), F508 homozygous CF (Fig. 5E), and PCD (Fig. 5F) individuals. ER density, as depicted by red arrows, was increased in both CF and PCD compared with normal epithelium (Fig. 5G). Apical UTP-mobilized Ca2+i was also increased 2-fold in short term primary culture monolayers of PCD compared with normal bronchial epithelia (data not shown). These data suggest that the apical ER volume is expanded in CF in response to luminal airway infection and inflammation.
The ER Expansion Observed in Short Term CF Cultures Reverts to Normal in CF Epithelia Cultured for Long Term in the Absence of Luminal Infection—To address directly the possible relationship between luminal infection/inflammation and ER expansion in CF airway epithelia, normal and F508 homozygous CF bronchial epithelia were cultured for long term for 30–40 days, and ER density was investigated by calreticulin immunofluorescence as described in the studies depicted in Fig. 4A. Fig. 6, A and B, depicts the calreticulin expression in a normal culture and a F508 homozygous CF culture, respectively, illustrating that apical calreticulin expression was no longer up-regulated in the long term CF compared with the normal culture. Fig. 6C shows the summary data for apical calreticulin staining from long term normal and CF cultures. These findings demonstrate that the ER expansion observed in short term CF cultures is lost upon prolonged culturing under sterile conditions. We next investigated whether the morphological reversal of ER expression to normal correlated with a functional reversal of agonist-sensitive Ca2+ stores to normal in long term F508 CF cultures. Fig. 6, D and E, illustrates that activation of apical P2Y2-Rs with mucosal ATP (100 µM) elicited a similar Ca2+i mobilization in long term normal and CF cultures, respectively. Fig. 6F depicts the summary Ca2+i data (peak-baseline Ca2+i values) from these studies. These data demonstrate that the characteristic phenotype of short term 6–11-day-old F508 CF cultures (e.g. apical ER expansion associated with increased agonist-sensitive ER Ca2+ stores) reverts to normal after long term culturing in the absence of luminal infection and is independent of mutated CFTR.
|
F508 CFTR but results from an epithelial adaptation to the in situ CF airway infectious/inflammatory milieu, and it is lost in vitro with time in the absence of airway infection. Based on these findings, we hypothesized that the ER expansion and the consequent up-regulation of functional Ca2+ stores could be induced in normal airway epithelia exposed to an infectious/inflammatory luminal environment. To test this notion, the luminal surfaces of 30–40-day-old normal bronchial epithelia were exposed for up to 48 h to either PBS or SMM harvested from CF airways, and the following parameters were measured. First, the apical ER compartment, visualized by calreticulin immunofluorescence, was assessed in PBS-versus SMM-treated cultures. Fig. 7A illustrates that apical ER density was increased in SMM-compared with PBS-treated cultures in a time-dependent manner. The compiled data from these studies are shown in Fig. 7B. SMM-treated short term cultures of normal epithelia also expressed an increased ER density (not shown). Second, we tested whether the increased apical ER expression in SMM-treated cultures resulted in larger Ca2+i signals in response to apical P2Y2-R activation with 100 µM mucosal UTP. UTP-mobilized Ca2+i was increased in cultures pretreated with SMM compared with PBS (Fig. 7C), mimicking the larger mucosal UTP-dependent Ca2+i signals found in short term primary cultures of CF bronchial airway epithelia (Fig. 1, A–C). These findings demonstrate that chronic luminal exposure of normal cultures to SMM reproduces the increased ER density and apical GPCR activation-dependent Ca2+i signals observed in short term cultures of CF airway epithelia.
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
In this study, we have elucidated the mechanism for the increased apical GPCR activation-dependent Ca2+i signals in CF human airway epithelia (4) (Fig. 1) by showing that it resulted from the expansion of the apical ER/Ca2+ store compartment (Figs. 3, 4, 5 and 7) rather than from a greater number of P2Y2-Rs or coupling efficiency between P2Y2-R activation and PLC activity (Fig. 2). Although it is plausible that the higher Ca2+i-dependent Cl– secretion in human CF airway epithelia may in part be a consequence of an increased Ca2+-activated Cl– channel (CaCC) number, our data demonstrating higher Ca2+i mobilization in CF compared with normal human nasal (4) or bronchial (Fig. 1) epithelia suggest that higher Ca2+i levels at the vicinity of the apical membrane CaCC likely mediate this response.
A number of observations led to the conclusion that the enlarged ER in CF reflected an acquired epithelial response to luminal airway infection/inflammation rather than an ER stress response to misfolded F508 CFTR (26). First, non-infected native sweat duct epithelia from F508 homozygous CF patients exhibited normal ER size (Fig. 5). Second, the apical ER density was similarly increased in native CF and PCD airway epithelia (Fig. 5). Third, the expanded ER phenotype observed in short term (6–11-day-old, Fig. 4) primary cultures of F508 CF airway epithelia reverted to normal in long term (30–40-day-old, Fig. 6) F508 CF cultures. Fourth, chronic in vitro exposure of normal airway epithelia to bacterial and inflammatory factors (such as SMM) harvested from CF airways increased the ER size and Ca2+ storage (Fig. 7), mimicking the phenotype of short term CF cultures. These data suggest that the elaborated apical ER phenotype observed in short term primary cultures of CF airway epithelia, which mimics that of native CF airway epithelia, 1) reflects a "memory" of the in situ infectious environment of CF airways, 2) reverts in vitro in the absence of luminal airway infection, and 3) is independent of the intrinsic F508 CFTR defect.
Regarding host defense mechanisms that clear airway surfaces, the raised Ca2+i release due to ER expansion, especially confined to the apical domain (4), (27), may provide an adaptive response for both the normal and the CF airways. The higher Ca2+i mobilization may be particularly useful to CF patients, who depend solely on CaCC to compensate for the absent cAMP-mediated Cl– secretion in CF (3). Thus, the approximate doubling of Ca2+i mobilization in CF is predicted to double the magnitude of Cl– secretion (4). This relatively larger component of Cl– secretion may allow CF airways to transiently restore defective mucus clearance. In this scenario, cough (shear stress)-induced release of ATP/UTP (5) into airway surface liquid would produce larger Ca2+i signals via apical P2Y2-R activation and would more effectively activate CaCC and ciliary beat to transiently restore mucus clearance (28).
Conversely, this adaptive airway epithelial response to chronic luminal infection/inflammation involving the up-regulation of apical ER Ca2+ stores can have an adverse effect, because the increased agonist-induced Ca2+i mobilization in CF airway epithelia may also play a role in Ca2+i-dependent airway inflammatory responses (29). A role for increased ER Ca2+ stores has been raised in the pathogenesis of neurological diseases. For example, ER expansion has been described in a model for Gaucher disease, where neuronal cells expressed an increase in ER and ryanodine receptors and a greater ER-dependent Ca2+ release in response to glutamate or caffeine stimulation (30). Thus, the increased glutamate-dependent Ca2+i signal may be linked with the neuronal toxicity and cell death characteristic of Gaucher disease. In contrast, most cases of Alzheimer disease are caused by presenilin mutations, and it is thought that ER protein (presenilin) retention (31) leads to increases in ER size and Ca2+ storage capacity in this disease (32–34).
In conclusion, our findings add to the understanding of the mechanisms and roles of Ca2+i-dependent signal transduction in airway epithelia by elucidating that 1) ER Ca2+ stores are predominantly distributed toward the apical domain, 2) the apical ER compartment and its capacity to sequester Ca2+ are increased in CF and PCD airway epithelia, and 3) the expansion of the apical ER network is an adaptive innate epithelial response to chronic luminal airway infection/inflammation. We speculate that the up-regulation of the ER/Ca2+ stores in CF may reflect a response that can be generalized to other diseases characterized by persistent epithelial exposure to an infectious and inflammatory milieu. These observations may prove important in designing strategies and selecting dosages of therapeutic agents aimed at restoring mucus clearance in patients with chronic infectious lung disease (e.g. CF and PCD) via regulation of Ca2+i-dependent mechanisms.
|
FOOTNOTES |
|---|
To whom correspondence should be addressed. Tel.: 919-966-7045; Fax: 919-966-5178; E-mail: carla_ribeiro{at}med.unc.edu.
1 The abbreviations used are: GPCR, G protein-coupled receptor; PLC, phospholipase C; IP3, inositol 1,4,5-trisphosphate; IP3R, IP3 receptor; ER, endoplasmic reticulum; P2Y2-R, purinoceptor; CF, cystic fibrosis; CFTR, cystic fibrosis transmembrane conductance regulator; PCD, primary ciliary dyskinesia; SMM, supernatant from mucopurulent material from CF airways; PBS, phosphate-buffered saline; RPA, ribonuclease protection assay; DIOC6(3), dihexaoxacarbocyanine; CaCC, Ca2+-activated Cl– channel; Ins, inositol.
|
ACKNOWLEDGMENTS |
|---|
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  L. Maiuri, A. Luciani, I. Giardino, V. Raia, V. R. Villella, M. D'Apolito, M. Pettoello-Mantovani, S. Guido, C. Ciacci, M. Cimmino, et al. Tissue Transglutaminase Activation Modulates Inflammation in Cystic Fibrosis via PPAR{gamma} Down-Regulation J. Immunol., June 1, 2008; 180(11): 7697 - 7705. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. R. Esther Jr, N. E. Alexis, M. L. Clas, E. R. Lazarowski, S. H. Donaldson, C. M. Pedrosa Ribeiro, C. G. Moore, S. D. Davis, and R. C. Boucher Extracellular purines are biomarkers of neutrophilic airway inflammation Eur. Respir. J., May 1, 2008; 31(5): 949 - 956. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Livraghi, M. Mall, A. M. Paradiso, R. C. Boucher, and C. M. P. Ribeiro Modelling Dysregulated Na+ Absorption in Airway Epithelial Cells with Mucosal Nystatin Treatment Am. J. Respir. Cell Mol. Biol., April 1, 2008; 38(4): 423 - 434. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. H. Rossi, W. C. Salmon, M. Chua, and C. W. Davis Calcium signaling in human airway goblet cells following purinergic activation Am J Physiol Lung Cell Mol Physiol, January 1, 2007; 292(1): L92 - L98. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. Fu, K. Bettega, S. Carroll, K. R. Buchholz, and T. E. Machen Role of Ca2+ in responses of airway epithelia to Pseudomonas aeruginosa, flagellin, ATP, and thapsigargin Am J Physiol Lung Cell Mol Physiol, January 1, 2007; 292(1): L353 - L364. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Dejima, S. H. Randell, M. J. Stutts, B. A. Senior, and R. C. Boucher Potential Role of Abnormal Ion Transport in the Pathogenesis of Chronic Sinusitis Arch Otolaryngol Head Neck Surg, December 1, 2006; 132(12): 1352 - 1362. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. F. Okada, R. A. Nicholas, S. M. Kreda, E. R. Lazarowski, and R. C. Boucher Physiological Regulation of ATP Release at the Apical Surface of Human Airway Epithelia J. Biol. Chem., August 11, 2006; 281(32): 22992 - 23002. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
