Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M410617200 on January 12, 2005

J. Biol. Chem., Vol. 280, Issue 11, 10202-10209, March 18, 2005
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
280/11/10202    most recent
M410617200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ribeiro, C. M. P.
Right arrow Articles by Boucher, R. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ribeiro, C. M. P.
Right arrow Articles by Boucher, R. C.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Cystic Fibrosis Airway Epithelial Ca2+i Signaling

THE MECHANISM FOR THE LARGER AGONIST-MEDIATED Ca2+i SIGNALS IN HUMAN CYSTIC FIBROSIS AIRWAY EPITHELIA*

Carla M. Pedrosa Ribeiro{ddagger}§, Anthony M. Paradiso{ddagger}, Mark A. Carew¶, Stephen B. Shears¶, and Richard C. Boucher{ddagger}

From the {ddagger}Cystic Fibrosis/Pulmonary Research and Treatment Center, University of North Carolina at Chapel Hill, North Carolina 27599-7248 and Inositide Signaling Section, Laboratory of Signal Transduction, NIEHS, National Institutes of Health, Research Triangle Park, North Carolina 27709

Received for publication, September 15, 2004 , and in revised form, January 6, 2005.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
In cystic fibrosis (CF) airways, abnormal epithelial ion transport likely initiates mucus stasis, resulting in persistent airway infections and chronic inflammation. Mucus clearance is regulated, in part, by activation of apical membrane receptors coupled to intracellular calcium (Ca2+i) mobilization. We have shown that Ca2+i signals resulting from apical purinoceptor (P2Y2-R) activation are increased in CF compared with normal human airway epithelia. The present study addressed the mechanism for the larger apical P2Y2-R-dependent Ca2+i signals in CF human airway epithelia. We show that the increased Ca2+i mobilization in CF was not specific to P2Y2-Rs because it was mimicked by apical bradykinin receptor activation, and it did not result from a greater number of P2Y2-R or a more efficient coupling between P2Y2-Rs and phospholipase C-generated inositol 1,4,5-trisphosphate. Rather, the larger apical P2Y2-R activation-promoted Ca2+i signals in CF epithelia resulted from an increased density and Ca2+ storage capacity of apically confined endoplasmic reticulum (ER) Ca2+ stores. To address whether the ER up-regulation resulted from ER retention of misfolded {Delta}F508 CFTR or was an acquired response to chronic luminal airway infection/inflammation, three approaches were used. First, ER density was studied in normal and CF sweat duct human epithelia expressing high levels of {Delta}F508 CFTR, and it was found to be the same in normal and CF epithelia. Second, apical ER density was morphometrically analyzed in airway epithelia from normal subjects, {Delta}F508 homozygous CF patients, and a disease control, primary ciliary dyskinesia; it was found to be greater in both CF and primary ciliary dyskinesia. Third, apical ER density and P2Y2-R activation-mobilized Ca2+i, which were investigated in airway epithelia in a long term culture in the absence of luminal infection, were similar in normal and CF epithelia. To directly test whether luminal infection/inflammation triggers an up-regulation of the apically confined ER Ca2+ stores, normal airway epithelia were chronically exposed to supernatant from mucopurulent material from CF airways. Supernatant treatment expanded the apically confined ER, resulting in larger apical P2Y2-R activation-dependent Ca2+i responses, which reproduced the increased Ca2+i signals observed in CF epithelia. In conclusion, the mechanism for the larger Ca2+i signals elicited by apical P2Y2-R activation in CF airway epithelia is an expansion of the apical ER Ca2+ stores triggered by chronic luminal airway infection/inflammation. Greater ER-derived Ca2+i signals may provide a compensatory mechanism to restore, at least acutely, mucus clearance in CF airways.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Airway epithelia constitute the major interface between inspired air and the airway wall. These epithelia are highly polarized and exhibit a series of integrated functions that provide mechanical cleansing, i.e. mucus clearance, as a primary mode of lung defense. The individual airway epithelial functional components that mediate mucus clearance, including ion transport, mucin secretion, and ciliary beat frequency (1), are regulated in part by intracellular calcium (Ca2+i) (2, 3). Airway epithelial Ca2+i mobilization can be elicited by selective autocrine and/or paracrine activation of apical or basolateral membrane heterotrimeric G protein-coupled receptors (GPCRs)1 linked to phospholipase C (PLC) stimulation, which generates inositol 1,4,5-trisphosphate (IP3) and induces Ca2+ release from endoplasmic reticulum (ER) stores (3, 4). 5' nucleotides (ATP/UTP), released by airway epithelial cells and sensed by apical membrane purinoceptors (P2Y2-Rs) (5), may be the dominant autocrine regulators of Ca2+i mobilization in airway epithelia (3).

In airway epithelia of patients with cystic fibrosis (CF), the functional absence of the cystic fibrosis transmembrane conductance regulator (CFTR) results in a diminished periciliary liquid layer depth (6) and a reduction in mucus clearance. Likewise, abnormal mucus clearance is found in patients with primary ciliary dyskinesia (PCD), a syndrome that results from defective airway epithelial ciliary proteins linked to a decreased ciliary activity (7). In both diseases, persistent airways infection and inflammation are the predominant clinical phenotypic characteristics consequent to the impairment of mucus clearance (8).

There are clues that airway epithelia may regulate the Ca2+i signaling pathway in response to airways disease. For example, in vivo studies established that the nasal transepithelial electrical potential difference responses to agents that activate P2Y2-Rs and promote Ca2+i mobilization (e.g. ATP/UTP) are greater in CF patients than in normal subjects (9, 10). In vitro studies also detected a larger apical Ca2+i-dependent Cl– conductance in CF airway epithelia (9, 11–13). In addition, we recently reported that apical P2Y2-R activation promotes greater Ca2+i mobilization in CF compared with normal human nasal epithelia (4). However, the underlying mechanism(s) responsible for the regulation of the increased Ca2+i responsiveness of CF airway epithelia and its functional consequences are unknown.

Therefore, in the present study we investigated the mechanism for the augmented apical GPCR-derived Ca2+i signals in CF airway epithelia by probing the P2Y2-R/Ca2+ signaling system in functional, biochemical, and cell biological studies in normal and CF human airway epithelia. Further, we investigated whether the raised Ca2+i signals in CF are a manifestation of the molecular pathogenesis of mutant CFTR ({Delta}F508 CFTR) or are an acquired host response to chronic infection/inflammation in vivo. We compared ER density in non-infected human sweat duct epithelia from normal and {Delta}F508 CF individuals and in human airway epithelia from normal, {Delta}F508 CF, and PCD patients with chronic airway infection and inflammation. In addition, ER density and apical P2Y2-R activation-induced Ca2+i mobilization were studied in short term and long term cultures of normal and CF bronchial epithelia. Finally, to directly address whether chronic airway infection/inflammation, independently of defective CFTR, up-regulated apically confined ER Ca2+ stores, ER density and UTP-mobilized ER Ca2+ were investigated in normal airway epithelia chronically exposed to supernatant from CF airways mucopurulent material (SMM).


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Cell Culture and Freshly Excised Tissue—Tissues and cells were obtained under the auspices of protocols approved by the Institutional Committee on the Protection of the Rights of Human Subjects. Excess tissues from human donor lungs and excised recipient lungs were obtained at the time of lung transplantation from main stem or lobar bronchi. Tissues were either fixed in 4% paraformaldehyde and embedded in paraffin or used for cell isolation. Bronchial epithelial cells were provided by the University of North Carolina CF Center Tissue Core. Normal and CF ({Delta}F508 homozygous) cells were harvested and cultured as described previously (4). Cultures were maintained at an air-liquid surface interface, and polarized primary cultures were studied at 6–11 days (short term monolayers) or 30–40 days later (long term well differentiated). Normal and CF cultures were apically washed with sterile PBS, and the serosal media were replenished every 2–4 days.

Nasal scrapes obtained from normal (n = 4, ages 33–35), {Delta}F508 homozygous CF (n = 4, ages 25–46), or PCD (n = 3, ages 34–57) individuals and skin biopsies from normal (n = 4, ages 28–47) and {Delta}F508 homozygous CF (n = 5, ages 31–47) individuals were used for ER density studies.

Ca2+i Studies—6–11- or 30–40-day-old cultures were loaded with fura-2/AM, and Ca2+i was measured under bilateral perfusion as reported previously (4). Ca2+i signals were calibrated as described previously (14). There were no systematic differences between CF and normal epithelia as a result of differential fura-2 behavior, including dye loading. Baseline Ca2+i levels were the same in CF and normal epithelia, as reported previously (4), and no consistent differences were observed between CF and normal epithelia in the sustained phase of Ca2+i mobilization following activation of P2Y2-Rs.

Ribonuclease Protection Assay (RPA)—A 398-base pair human P2Y2-R fragment was prepared by reverse transcriptase-PCR from human airway RNA and ligated into the pCRII vector (Invitrogen). P2Y2-R primer sequences were as follows: 253F, 5'AGACCTGGGCCCCTGGAATGACACCATC3'; and 651R, 5'AGACGCCCAGACACCGGTGCACGCTGATG3'.

Individual clones were verified by automatic sequencing. Templates for RPAs were prepared by PCR from the P2Y2-R plasmid with the following primers for the PCRII vector: PCRII SP6, 5'ATGATTACGCCAAGCTATTTAGGTGACACT3' and PCRII T7, 5'GACGGCCAGTGAATTGTAATACGACTCACT3'.

50 ng of purified PCR fragment was transcribed, incorporating the [32P]UTP label with the Maxiscript kit (Ambion), and RPA was performed with the RPA III kit (Ambion). Protected fragments were quantified by phosphorimaging with ImageQuant software (Amersham Biosciences).

Phospholipase C Activity—After 4 days in culture, monolayers of normal and CF bronchial epithelia were radiolabeled with [3H]inositol for 4–5 days (15). For 20 min prior to study, cultures were placed in serum-free media containing 10 mM lithium and [3H]inositol followed by 5 min 100 µM mucosal UTP-induced PLC activity measured as reported previously (15). The levels of 3H-labeled inositol phosphates were normalized to [3H]IP6 levels because IP6 levels are not affected by agonist stimulation (16). Assays were performed in duplicate.

Immunostaining of Calreticulin and IP3 receptors (IP3Rs) and DIOC6(3) Staining—The immunostaining of calreticulin and IP3Rs in cultures and deparaffinized native bronchial epithelial or skin biopsy sections was performed according to a modification of our previous method (17). For calreticulin and IP3Rs staining, samples were incubated with a rabbit anti-calreticulin antibody (1:100 dilution, Affinity Bioreagents) and a mouse anti-IP3R antibody that recognizes all IP3R isoforms (1:100 dilution, Calbiochem) for 60 min at 37 °C. This incubation was followed by three PBS washes and a 30-min incubation at 25 °C with a fluorescein-labeled goat anti-rabbit antibody (1:20 dilution for calreticulin, Kirkegaard & Perry Laboratories) and with a Texas Red-labeled goat anti-mouse antibody (1:200 dilution for IP3Rs, Jackson Immunoresearch Laboratories). As controls, the primary antibodies were omitted or substituted with rabbit and mouse {gamma}-globulins (Jackson Immunoresearch Laboratories). For antibody-independent ER staining, sections of native bronchial epithelia were labeled with the fluorescent dihexaoxacarbocyanine dye DIOC6(3) by incubation with 250 ng/ml DIOC6(3) for 1 min at room temperature in PBS followed by three washes with PBS as we have reported previously (17). The Ca2+ store markers and the DIOC6(3) signals were studied by laser confocal microscopy (Leica, model TCS 4D, PL APO 63x/1.20 mm water lens) in the XZ or XY scanning mode.

To quantify the fluorescence intensity of labeled calreticulin and IP3Rs and DIOC6(3), multiple scans were obtained from each sample, and regions of interest were designated in the apical domains with the MetaMorph software. The same acquisition parameters (e.g. laser power, contrast, brightness, and pinhole value) were employed for each channel to acquire the images from normal and CF cultures or native tissue in experiments performed on the same day. The fluorescence intensity values from the regions of interest were averaged from paired normal and CF cultures, native bronchial epithelia, skin biopsies, or normal cultures treated with PBS or supernatant from CF airways mucopurulent material (SMM, see "Studies with Infectious/Inflammatory Material from CF Airways").

Calreticulin Western Blot Analysis—Monolayers of normal and CF bronchial epithelia were lysed and blotted as reported previously (18). The calreticulin antibody was a rabbit polyclonal (1:5000 dilution, Affinity Bioreagents), and the secondary antibody was an anti-rabbit horseradish peroxidase (1:10,000 dilution, Amersham Biosciences). Blots were developed with enhanced chemiluminescence.

Electron Microscopy—Nasal scrapes from normal, {Delta}F508 homozygous CF, and PCD individuals were fixed in 2% glutaraldehyde plus 2% paraformaldehyde plus 0.25% tannic acid, post-fixed in 1% OsO4, and processed for electron microscopy (19). Apical ER morphometric scoring was performed double blind. Only ciliated cells were analyzed, and repairing cells with migrating basal bodies (procentrioles) and micrographs with tangential cuts were excluded. The apical domain was defined as the region 1–3.4 µm (to exclude basal bodies) from the apical plasma membrane. The criteria for identifying ER were: parallel membranes in elongated or oval strands, containing an amorphous center without cristae (to exclude mitochondria), or electron-dense particles (to exclude rough ER, because it is increased in repairing cells), and not stacked (to exclude Golgi). Data are expressed as number of ER strands/µm2.

Studies with Infectious/Inflammatory Material from CF Airways— Mucopurulent material was harvested from the airway lumens of excised human CF lungs infected with Pseudomonas aeruginosa and S. aureus at the time of transplant and provided by the University of North Carolina CF Center Tissue Core. This material was centrifuged at 100,000 rpm (60 min, 4 °C), and the supernatant was filtered through a 0.2-µm filter and frozen at –80 °C. Preliminary studies revealed that treatment of airway epithelia with SMM from individual CF lungs infected with P. aeruginosa and Staphyloccocus aureus induced epithelial hyperinflammation. Because of the small volume of SMM/patient, SMMs from nine CF lungs (five males and four females, age 17–48 years, four {Delta}F508 homozygous and five unknown genotypes) were pooled to assure homogeneous stimulus throughout experiments.

To address the effect of SMM on ER size and Ca2+ storage, PBS or SMM (40 µl) was applied to the mucosal surfaces of well differentiated cultures of normal bronchial epithelia for 48 h, and then either ER volume was studied by calreticulin immunostaining as described above or peak Ca2+i responses to 100 µM mucosal UTP were measured, respectively.

Statistics—Data represent the mean ± S.E. from at least three experiments from three individual donors and were analyzed by unpaired t test or two-way analysis of variance. Statistical significance was defined with p < 0.05.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
Larger Apical GPCR-modulated Ca2+i Responses Are a Generalized Feature of CF Airway Epithelia—We have shown previously that CF human nasal epithelia exhibit larger rises in Ca2+i in response to apical P2Y2-R activation than normal nasal epithelia (4). To investigate whether this difference was generalized to lower airways, we studied the effect of a maximal dose (100 µM) UTP applied to the apical surface of 6–11-day-old monolayers of normal and CF human bronchial epithelial cultures on Ca2+i mobilization (4). UTP addition to normal bronchial epithelium induced an initial Ca2+i peak, resulting from IP3-dependent ER Ca2+ store release, and a sustained rise in Ca2+i, resulting from activation of capacitative Ca2+ entry (3) (Fig. 1A). P2Y2-R activation in CF epithelium (Fig. 1B) resulted in a markedly higher Ca2+i mobilization peak than in normal epithelium, in agreement with our findings in nasal epithelia (4). Fig. 1C illustrates the summary {Delta}Ca2+i data (peak-baseline Ca2+i values) from these studies.



View larger version (15K):
[in this window]
[in a new window]
  		FIG. 1.
The larger apical UTP-mobilized Ca2+i in CF airway epithelia is not agonist specific. A and B, representative Ca2+i tracings depicting the effect of apical UTP-mobilized Ca2+i in short term primary culture monolayers of normal and CF human bronchial epithelia, respectively. C, summary {Delta}Ca2+i values (peak-baseline Ca2+i) from UTP-stimulated cultures. D and E, representative Ca2+i tracings depicting the effect of apical bradykinin (BK)-mobilized Ca2+i in short term primary culture monolayers of normal and CF human bronchial epithelia, respectively. F, compiled {Delta}Ca2+i values (peak-baseline Ca2+i) from BK-stimulated cultures. Data are expressed as mean ± S.E. (n = 4 for UTP studies in both groups; n = 3 for BK studies in both groups). *, p < 0.05.

 
We next addressed whether the larger Ca2+i mobilization in CF was a specific property of P2Y2-R activation or was generalized to other GPCRs linked to PLC at the apical membrane. Fig. 1, D and E, shows representative Ca2+i tracings from 6–11-day-old monolayers of normal and CF bronchial epithelial cultures, respectively, following apical addition of a maximal dose (5 µM) of bradykinin. Fig. 1F depicts the summary {Delta}Ca2+i data from these experiments, illustrating that apical bradykinin receptor activation in CF also resulted in an increased {Delta}Ca2+i mobilization. Because the greater bradykinin-induced Ca2+i signal in CF mimicked that elicited by P2Y2-R activation, the larger {Delta}Ca2+i signal in CF does not depend on a specific class of GPCRs.

P2Y2-R Number and P2Y2-R-dependent PLC Activation Are the Same in Normal and CF Airway Epithelia—We tested whether P2Y2-R expression was increased in CF. Because no antibodies or radioligands were available for P2Y2-R quantification, we used an RPA to assess P2Y2-R steady-state mRNA levels in 6–11-day-old primary culture monolayers of normal and CF bronchial airway epithelia. No difference was found in P2Y2-R mRNA levels from normal compared with CF human airway epithelia (Fig. 2, A and B).



View larger version (11K):
[in this window]
[in a new window]
  		FIG. 2.
P2Y2-R expression and P2Y2-R-PLC coupling efficiency are similar in normal and CF bronchial epithelial cultures. A, P2Y2-R steady-state mRNA levels from three different samples from short term primary culture monolayers of normal and CF human bronchial epithelia. B, P2Y2-R mRNA expression levels (corrected for actin mRNA levels) from the data shown in A (n = 3 for both groups). C, UTP-dependent PLC activity (the sum of IP3 metabolites (Ins-1-P, Ins-2-P, Ins(1,3,4)P3, Ins(1,4,5)P3, Ins(1,3,4,5)P4, and Ins(1,3,4,6)P4) in short term culture monolayers of normal and CF human primary bronchial epithelia. Inositol phosphate levels were normalized to IP6 and expressed as -fold increase over the inositol phosphate values in the absence of UTP. Data are expressed as mean ± S.E. (n = 3 for both groups). CF and normal airway epithelial cells also showed similar levels of IP3, as well as Ins(3,4,5,6)P4, an inhibitor of Ca2+-activated Cl– channels (20) (data not shown).

 
We next investigated whether the larger Ca2+i mobilization in CF was driven by an enhanced PLC response to P2Y2-R activation. P2Y2-R-regulated PLC activity was assayed by measuring IP3 and the accumulation of its downstream metabolites in the presence of lithium to prevent recycling of inositol phosphates back to inositol (20). We found that PLC activation in response to a 5-min treatment with 100 µM apical UTP was not elevated in 6–11-day-old primary culture monolayers of CF (Fig. 2C). These findings indicate that the larger {Delta}Ca2+i in CF does not reflect increased P2Y2-R number or increased efficiency of P2Y2-R coupling to PLC.

Apical ER Ca2+ Stores Are Functionally Increased in CF Airway Epithelia—We next addressed whether 6–11-day old monolayers of CF cultures exhibited an increased quantity of ER Ca2+ that could be mobilized in response to IP3 generation resulting from GPCR activation. To measure the Ca2+ storage capacity of the apical ER, a protocol was developed based on findings that ER Ca2+ stores are functionally confined to the plasma membrane domain ipsilateral to P2Y2-R activation (21). 6–11-Day-old normal and CF monolayers, bathed in bilateral nominally Ca2+-free buffer, were exposed to 100 µM basolateral UTP to deplete P2Y2-R-sensitive basolateral Ca2+ stores. Basolateral UTP increased Ca2+i to the same extent in both cultures (Fig. 3A), suggesting that basolateral ER Ca2+ store capacity was the same in normal and CF epithelia. Apical ER Ca2+ store capacity was then measured with perfusion with 0.6 mM bilateral La3+ to block plasma membrane Ca2+-AT-Pases and Ca2+ influx channels (22) followed by 1 µM apical thapsigargin (an ER Ca2+-ATPase inhibitor) to release Ca2+ from apical ER stores (23). Ca2+i rose and was sustained because of inhibition of the plasma membrane and ER Ca2+-ATPases by La3+ and thapsigargin, respectively (Fig. 3A). The greater rise in Ca2+i in CF (Fig. 3A) indicated that the quantity of Ca2+ sequestered in the apical ER was functionally greater in CF compared with normal bronchial epithelial cultures. Fig. 3B illustrates the summary {Delta}Ca2+i data from these experiments. These results led us to speculate that the density of apical ER Ca2+ stores is increased in short term 6–11-day-old cultures of CF airway epithelia.



View larger version (8K):
[in this window]
[in a new window]
  		FIG. 3.
The increased Ca2+i mobilization triggered by apical purinergic receptor activation in CF airway epithelia reflects larger apically confined functional ER Ca2+ stores. A, representative Ca2+i tracings depicting the Ca2+i responses to sequential exposure of basolateral UTP (to assess the capacity of UTP-releasable basolateral ER Ca2+ stores), bilateral (BL) La3+, and apical thapsigargin (TG) (to assess the capacity of apically confined ER Ca2+ stores) in short term primary culture monolayers of normal and CF human bronchial epithelia. Cultures were bilaterally perfused with a nominally Ca2+-free buffer throughout the entire experiment. B, compiled {Delta}Ca2+i values (steady state-baseline Ca2+i) from the experiments shown in A (n = 4). Data are expressed as mean ± S.E.; *, p < 0.05, CF versus normal cultures.

 
Apical ER Ca2+ Stores Are Morphologically Expanded in Short Term CF Airway Epithelial Cultures and Native CF Airway Epithelia—We next measured the expression of two ER Ca2+ store markers, IP3Rs and calreticulin (an intraluminal ER protein involved in Ca2+ sequestration), in 6–11-day-old monolayers of normal and CF bronchial epithelia by confocal immunofluorescence microscopy (Fig. 4). The relative cellular distribution of these Ca2+ store markers was similar in normal and CF epithelia (i.e. they localized predominantly toward the apical pole and the fluorescent signals from calreticulin and IP3Rs were increased in CF cultures (Fig. 4, A and B)). No immunostaining of Ca2+ store markers was detected when the primary antibodies were omitted or nonspecific IgGs were used (data not shown). These data suggest an increased expression of calreticulin and IP3Rs in CF cultures; however, because the IP3R antibody used recognizes all IP3R isoforms, it is possible that the change in IP3R signal may reflect a switch in the predominance of one isoform versus others rather than a change in the total amount of all IP3Rs in CF. The increase in CF calreticulin immunofluorescence was confirmed by calreticulin immunoblotting from whole cell lysates of early stage culture monolayers of normal and CF bronchial epithelia (Fig. 4C).



View larger version (32K):
[in this window]
[in a new window]
  		FIG. 4.
Apical ER Ca2+ stores are morphologically expanded in CF cultures and native CF tissue. A, XZ confocal scans from short term primary culture monolayers of normal and CF bronchial airway epithelia immunostained for calreticulin or IP3Rs. Bar, 10 µm. B, percent of apical fluorescence intensity from calreticulin and IP3Rs (normalized to fluorescence intensity values from normal cultures; n = 5). C, Western blot for calreticulin from whole cell lysates (50 µg of protein/lane) from short term primary culture monolayers of normal and CF bronchial airway epithelia (representative from three normal and three CF cultures). D, XY confocal scans from normal and CF sections of native bronchial epithelia stained with DIOC6(3). E, percent of apical DIOC6(3) fluorescence intensity (normalized to fluorescence intensity values from normal sections; n = 5). F, XY confocal scans from normal and CF sections of native bronchial epithelia immunostained for calreticulin and IP3 Rs. Bar, 10 µm. G, percent of apical fluorescence intensity from calreticulin and IP3Rs (normalized to fluorescence intensity values from normal sections; n = 5 for calreticulin, and n = 3 for IP3Rs in normal and CF). Data are expressed as mean ± S.E.; *, p < 0.05, CF versus normal epithelia.

 
The apical ER volume of normal and CF epithelia was also studied by an antibody-independent method, utilizing DIOC6(3) fluorescence to stain the ER (17). Fig. 4D illustrates that DIOC6(3) staining was greater in native CF compared with normal bronchial airway epithelia. The mean apical fluorescence intensity from the CF group exceeded that of the normal group by a factor proportional to that observed with antibody-dependent methods (Fig. 4E).

To test whether the topography and expression levels of the ER Ca2+ stores found in CF versus normal short term primary culture monolayers mimicked those in vivo, confocal immunofluorescence microscopy studies of IP3Rs and calreticulin were performed in native normal and CF bronchial epithelia (Fig. 4, F and G). Similar to our findings in short term primary culture monolayers (Fig. 4, A and B), ER Ca2+ stores were distributed toward the apical domain of native epithelia, and their expression was increased in CF (Fig. 4, F and G). Collectively, these data, coupled with the direct measurement of ER density by electron microscopy (Fig. 5), strongly suggested that the functional increase in apical ER Ca2+ storage detected in CF epithelia (Fig. 3) was because of an increase in the ER volume in the apical domain.



View larger version (98K):
[in this window]
[in a new window]
  		FIG. 5.
ER density is similar in native {Delta}F508 homozygous CF versus normal sweat duct epithelia but greater in airway epithelia from native CF and PCD infected airways. XY confocal scans of the ER (as depicted by calreticulin staining) in normal (A) and {Delta}F508 homozygous CF (B) native sweat duct epithelia are shown. Bar, 10 µm. C, compiled ER density data from the apical epithelial domain of normal and {Delta}F508 homozygous CF sweat ducts (n = 4 and 5 individuals for normal and CF, respectively). Micrographs of the apical region of normal (D), {Delta}F508 homozygous CF (E), and PCD (F) nasal ciliated epithelial cells are shown. Red and black arrows depict the ER and the intercellular spaces, respectively (see panels D, E, and F). G, compiled ER density data from the apical epithelial domain of the three groups (n = 3–4 individuals). Data are expressed as mean ± S.E.; *, p < 0.05, CF or PCD versus normal epithelia.

 
Is the ER Expansion in CF a Result of Misfolded {Delta}F508 CFTR or an Acquired Response to Chronic Airway Infection?— Two approaches were used to address this question. First, we tested the hypothesis that the ER up-regulation could be linked to abnormal CFTR folding in the absence of infection/inflammation. We elected to study sweat ducts because they are a source of non-infected CF epithelium and they exhibit relatively high levels of CFTR expression (24). Fig. 5, A and B, depict the immunostaining of calreticulin in native sweat ducts from normal and {Delta}F508 homozygous CF individuals, respectively. Quantification of calreticulin immunofluorescence revealed that its expression was the same in normal and CF sweat duct epithelia (Fig. 5C), suggesting that the ER expansion observed in CF airway epithelia was not a consequence of ER retention of {Delta}F508 CFTR.

Second, we evaluated whether the ER expansion in CF was acquired by studying airway epithelia from patients with an unrelated disease characterized by chronic airways infection, e.g. PCD (8). We quantified morphometrically the ER density in freshly isolated nasal scrapes from normal (Fig. 5D), {Delta}F508 homozygous CF (Fig. 5E), and PCD (Fig. 5F) individuals. ER density, as depicted by red arrows, was increased in both CF and PCD compared with normal epithelium (Fig. 5G). Apical UTP-mobilized Ca2+i was also increased 2-fold in short term primary culture monolayers of PCD compared with normal bronchial epithelia (data not shown). These data suggest that the apical ER volume is expanded in CF in response to luminal airway infection and inflammation.

The ER Expansion Observed in Short Term CF Cultures Reverts to Normal in CF Epithelia Cultured for Long Term in the Absence of Luminal Infection—To address directly the possible relationship between luminal infection/inflammation and ER expansion in CF airway epithelia, normal and {Delta}F508 homozygous CF bronchial epithelia were cultured for long term for 30–40 days, and ER density was investigated by calreticulin immunofluorescence as described in the studies depicted in Fig. 4A. Fig. 6, A and B, depicts the calreticulin expression in a normal culture and a {Delta}F508 homozygous CF culture, respectively, illustrating that apical calreticulin expression was no longer up-regulated in the long term CF compared with the normal culture. Fig. 6C shows the summary data for apical calreticulin staining from long term normal and CF cultures. These findings demonstrate that the ER expansion observed in short term CF cultures is lost upon prolonged culturing under sterile conditions. We next investigated whether the morphological reversal of ER expression to normal correlated with a functional reversal of agonist-sensitive Ca2+ stores to normal in long term {Delta}F508 CF cultures. Fig. 6, D and E, illustrates that activation of apical P2Y2-Rs with mucosal ATP (100 µM) elicited a similar Ca2+i mobilization in long term normal and CF cultures, respectively. Fig. 6F depicts the summary {Delta}Ca2+i data (peak-baseline Ca2+i values) from these studies. These data demonstrate that the characteristic phenotype of short term 6–11-day-old {Delta}F508 CF cultures (e.g. apical ER expansion associated with increased agonist-sensitive ER Ca2+ stores) reverts to normal after long term culturing in the absence of luminal infection and is independent of mutated CFTR.



View larger version (23K):
[in this window]
[in a new window]
  		FIG. 6.
Apical ER density and ER Ca2+ storage is the same in normal and CF airway epithelia cultured for long term in the absence of luminal infection. ER density, depicted by calreticulin staining, in 30–40-day-old long term cultures of normal (A) and CF (B) bronchial airway epithelia. The apical surface corresponds to the upper area in figures. Bar, 10 µm. C, compiled data for calreticulin fluorescence from the apical domain of normal and CF cultures. D and E, representative Ca2+i tracings depicting the effect of (100 µM) apical ATP-mobilized Ca2+i in 30–40-day-old long term cultures of normal and CF human bronchial epithelia, respectively. F, compiled {Delta}Ca2+i values (peak-baseline Ca2+i) from ATP-stimulated cultures. Data are expressed as mean ± S.E. (n = 3–5).

 
Can the CF Phenotype, e.g. Increased Density of Apically Confined ER Ca2+ Stores Coupled to Larger Apical P2Y2-R Activation-dependent Ca2+i Signals, Be Transferred to Normal Airway Epithelia by Prolonged Exposure to Mucopurulent Material from CF Airways?—The above findings suggest that the expanded apical ER phenotype does not depend on ER retention of {Delta}F508 CFTR but results from an epithelial adaptation to the in situ CF airway infectious/inflammatory milieu, and it is lost in vitro with time in the absence of airway infection. Based on these findings, we hypothesized that the ER expansion and the consequent up-regulation of functional Ca2+ stores could be induced in normal airway epithelia exposed to an infectious/inflammatory luminal environment. To test this notion, the luminal surfaces of 30–40-day-old normal bronchial epithelia were exposed for up to 48 h to either PBS or SMM harvested from CF airways, and the following parameters were measured. First, the apical ER compartment, visualized by calreticulin immunofluorescence, was assessed in PBS-versus SMM-treated cultures. Fig. 7A illustrates that apical ER density was increased in SMM-compared with PBS-treated cultures in a time-dependent manner. The compiled data from these studies are shown in Fig. 7B. SMM-treated short term cultures of normal epithelia also expressed an increased ER density (not shown). Second, we tested whether the increased apical ER expression in SMM-treated cultures resulted in larger Ca2+i signals in response to apical P2Y2-R activation with 100 µM mucosal UTP. UTP-mobilized Ca2+i was increased in cultures pretreated with SMM compared with PBS (Fig. 7C), mimicking the larger mucosal UTP-dependent Ca2+i signals found in short term primary cultures of CF bronchial airway epithelia (Fig. 1, A–C). These findings demonstrate that chronic luminal exposure of normal cultures to SMM reproduces the increased ER density and apical GPCR activation-dependent Ca2+i signals observed in short term cultures of CF airway epithelia.



View larger version (10K):
[in this window]
[in a new window]
  		FIG. 7.
The CF phenotype, e.g. increased density of apically confined ER Ca2+ stores coupled to larger apical P2Y2-R activation-dependent Ca2+i signals, is transferred to normal airway epithelia by prolonged mucosal exposure to CF airways mucopurulent material. A, time course illustrating the ER expansion, depicted by calreticulin staining, in 30–40-day-old normal airway epithelia exposed to mucosal supernatant from CF airways mucopurulent material over 48 h. Arrows point to the apical surface. Bar, 10 µm. B, compiled data for ER density from the apical domain of PBS- or SMM-treated cultures. C, effect of a 48-h SMM treatment of 30–40-day-old normal cultures of human bronchial airway epithelia on apical UTP-mobilized Ca2+i ({Delta}340/380 signal from fura-2). Data are expressed as mean ± S.E. (n = 3; *, p < 0.05).

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
We have hypothesized previously that an increased Ca2+i signal coupled to Cl– secretion would provide a compensatory mechanism to offset the absent cAMP-mediated Cl– transport in CF (3). Perhaps the strongest evidence for the role of Ca2+i-mediated Cl– secretion in protecting against CF lung disease came from CF knock-out mice, which express a large endogenous Ca2+-activated Cl– conductance in the airway epithelia and are devoid of airway disease (13, 25). CF patients do exhibit larger Ca2+i-dependent responses triggered by luminal purinoceptor agonists (9, 10), but the mechanism(s) of this response in human airways has remained unclear.

In this study, we have elucidated the mechanism for the increased apical GPCR activation-dependent Ca2+i signals in CF human airway epithelia (4) (Fig. 1) by showing that it resulted from the expansion of the apical ER/Ca2+ store compartment (Figs. 3, 4, 5 and 7) rather than from a greater number of P2Y2-Rs or coupling efficiency between P2Y2-R activation and PLC activity (Fig. 2). Although it is plausible that the higher Ca2+i-dependent Cl– secretion in human CF airway epithelia may in part be a consequence of an increased Ca2+-activated Cl– channel (CaCC) number, our data demonstrating higher Ca2+i mobilization in CF compared with normal human nasal (4) or bronchial (Fig. 1) epithelia suggest that higher Ca2+i levels at the vicinity of the apical membrane CaCC likely mediate this response.

A number of observations led to the conclusion that the enlarged ER in CF reflected an acquired epithelial response to luminal airway infection/inflammation rather than an ER stress response to misfolded {Delta}F508 CFTR (26). First, non-infected native sweat duct epithelia from {Delta}F508 homozygous CF patients exhibited normal ER size (Fig. 5). Second, the apical ER density was similarly increased in native CF and PCD airway epithelia (Fig. 5). Third, the expanded ER phenotype observed in short term (6–11-day-old, Fig. 4) primary cultures of {Delta}F508 CF airway epithelia reverted to normal in long term (30–40-day-old, Fig. 6) {Delta}F508 CF cultures. Fourth, chronic in vitro exposure of normal airway epithelia to bacterial and inflammatory factors (such as SMM) harvested from CF airways increased the ER size and Ca2+ storage (Fig. 7), mimicking the phenotype of short term CF cultures. These data suggest that the elaborated apical ER phenotype observed in short term primary cultures of CF airway epithelia, which mimics that of native CF airway epithelia, 1) reflects a "memory" of the in situ infectious environment of CF airways, 2) reverts in vitro in the absence of luminal airway infection, and 3) is independent of the intrinsic {Delta}F508 CFTR defect.

Regarding host defense mechanisms that clear airway surfaces, the raised Ca2+i release due to ER expansion, especially confined to the apical domain (4), (27), may provide an adaptive response for both the normal and the CF airways. The higher Ca2+i mobilization may be particularly useful to CF patients, who depend solely on CaCC to compensate for the absent cAMP-mediated Cl– secretion in CF (3). Thus, the approximate doubling of Ca2+i mobilization in CF is predicted to double the magnitude of Cl– secretion (4). This relatively larger component of Cl– secretion may allow CF airways to transiently restore defective mucus clearance. In this scenario, cough (shear stress)-induced release of ATP/UTP (5) into airway surface liquid would produce larger Ca2+i signals via apical P2Y2-R activation and would more effectively activate CaCC and ciliary beat to transiently restore mucus clearance (28).

Conversely, this adaptive airway epithelial response to chronic luminal infection/inflammation involving the up-regulation of apical ER Ca2+ stores can have an adverse effect, because the increased agonist-induced Ca2+i mobilization in CF airway epithelia may also play a role in Ca2+i-dependent airway inflammatory responses (29). A role for increased ER Ca2+ stores has been raised in the pathogenesis of neurological diseases. For example, ER expansion has been described in a model for Gaucher disease, where neuronal cells expressed an increase in ER and ryanodine receptors and a greater ER-dependent Ca2+ release in response to glutamate or caffeine stimulation (30). Thus, the increased glutamate-dependent Ca2+i signal may be linked with the neuronal toxicity and cell death characteristic of Gaucher disease. In contrast, most cases of Alzheimer disease are caused by presenilin mutations, and it is thought that ER protein (presenilin) retention (31) leads to increases in ER size and Ca2+ storage capacity in this disease (32–34).

In conclusion, our findings add to the understanding of the mechanisms and roles of Ca2+i-dependent signal transduction in airway epithelia by elucidating that 1) ER Ca2+ stores are predominantly distributed toward the apical domain, 2) the apical ER compartment and its capacity to sequester Ca2+ are increased in CF and PCD airway epithelia, and 3) the expansion of the apical ER network is an adaptive innate epithelial response to chronic luminal airway infection/inflammation. We speculate that the up-regulation of the ER/Ca2+ stores in CF may reflect a response that can be generalized to other diseases characterized by persistent epithelial exposure to an infectious and inflammatory milieu. These observations may prove important in designing strategies and selecting dosages of therapeutic agents aimed at restoring mucus clearance in patients with chronic infectious lung disease (e.g. CF and PCD) via regulation of Ca2+i-dependent mechanisms.


   FOOTNOTES
 
* This work was supported in part by Cystic Fibrosis Foundation Grants CFF RIBEIR00Z0 and CFF RIBEIR00G0 (to C. M. P. R.) and by National Institutes of Health Grants HL34322 and HL60280 (to R. C. B.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

§ To whom correspondence should be addressed. Tel.: 919-966-7045; Fax: 919-966-5178; E-mail: carla_ribeiro{at}med.unc.edu.

1 The abbreviations used are: GPCR, G protein-coupled receptor; PLC, phospholipase C; IP3, inositol 1,4,5-trisphosphate; IP3R, IP3 receptor; ER, endoplasmic reticulum; P2Y2-R, purinoceptor; CF, cystic fibrosis; CFTR, cystic fibrosis transmembrane conductance regulator; PCD, primary ciliary dyskinesia; SMM, supernatant from mucopurulent material from CF airways; PBS, phosphate-buffered saline; RPA, ribonuclease protection assay; DIOC6(3), dihexaoxacarbocyanine; CaCC, Ca2+-activated Cl– channel; Ins, inositol. Back


   ACKNOWLEDGMENTS
 
We are deeply indebted to Margaret Leigh, Johnny Carson, and Jackie Kylander for advice on ER morphometry, James Yankaskas and Scott Randell for supplying primary cells and tissue blocks, Laurenell Burch for performing RPAs, Kim Burns for supplying electron microscopy pictures, Tracy Eldred for providing tissue sections, Hamsa Suchindran for performing Western blots, and Lisa Brown for editorial assistance.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Wanner, A., Salathe, M., and O'Riordan, T. G. (1996) Am. J. Respir. Crit. Care Med. 154, 1868–1902[Medline] [Order article via Infotrieve]
  2. Knowles, M. R., Noone, P. G., Bennett, W. D., and Boucher, R. C. (1998) in Cilia, Mucus, and Mucociliary Interactions (Baum, G. L., Priel, Z., Roth, Y., Liron, N., and Ostfeld, E., eds) pp. 307–315, Marcel Dekker, Inc., New York
  3. Ribeiro, C. M. P., Paradiso, A. M., Lazarowski, E., and Boucher, R. C. (2001) in Cilia, Mucus and Mucociliary Interactions (Salathe, M., ed) pp. 303–314, Marcel Dekker, Inc., New York
  4. Paradiso, A. M., Ribeiro, C. M. P., and Boucher, R. C. (2001) J. Gen. Physiol. 117, 53–68[Abstract/Free Full Text]
  5. Lazarowski, E. R., and Boucher, R. C. (2000) News Physiol. Sci. 16, 1–5
  6. Matsui, H., Grubb, B. R., Tarran, R., Randell, S. H., Gatzy, J. T., Davis, C. W., and Boucher, R. C. (1998) Cell 95, 1005–1015[CrossRef][Medline] [Order article via Infotrieve]
  7. Eliasson, R., Mossberg, B., Camner, P., and Afzelius, B. A. (1977) N. Engl. J. Med. 297, 1–6[Abstract]
  8. Leigh, M. W. (1998) Disorders of the Respiratory Tract of Children, W. B. Saunders Co., Philadelphia, PA
  9. Knowles, M. R., Clarke, L. L., and Boucher, R. C. (1991) N. Engl. J. Med. 325, 533–538[Abstract]
  10. Knowles, M. R., Clarke, L. L., and Boucher, R. C. (1992) Chest 101, (suppl.) 60S-63S[Medline] [Order article via Infotrieve]
  11. Willumsen, N. J., and Boucher, R. C. (1989) Am. J. Physiol. 256, C226–C233
  12. Clarke, L. L., Grubb, B. R., Yankaskas, J. R., Cotton, C. U., McKenzie, A., and Boucher, R. C. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 479–483[Abstract/Free Full Text]
  13. Grubb, B. R., Vick, R. N., and Boucher, R. C. (1994) Am. J. Physiol. 266, C1478–C1483
  14. Paradiso, A. M., Cheng, E. H., and Boucher, R. C. (1991) Am. J. Physiol. 261, L63–L69
  15. Shears, S. B. (1997) Signalling by Inositides: A Practical Approach (Shears, S. B., ed) Oxford University Press, Oxford
  16. Yang, X., Rudolf, M., Carew, M. A., Yoshida, M., Nerreter, V., Riley, A. M., Chung, S. K., Bruzik, K. S., Potter, B. V., Schultz, C., and Shears, S. B. (1999) J. Biol. Chem. 274, 18973–18980[Abstract/Free Full Text]
  17. Ribeiro, C. M., Reece, J., and Putney, J. W., Jr. (1997) J. Biol. Chem. 272, 26555–26561[Abstract/Free Full Text]
  18. Sarkadi, B., Bauzon, D., Huckle, W. R., Earp, H. S., Berry, A., Suchindran, H., Price, E. M., Olsen, J. C., Boucher, R. C., and Scarborough, G. A. (1992) J. Biol. Chem. 267, 2087–2095[Abstract/Free Full Text]
  19. Robinson, G., and Gray, T. (1996) Theory and Practice of Histological Techniques (Bancroft, J. D., and Stevens, A., eds) Churchill Livingstone, Inc., New York
  20. Carew, M. A., Yang, X., Schultz, C., and Shears, S. B. (2000) J. Biol. Chem. 275, 26906–66913[Abstract/Free Full Text]
  21. Paradiso, A. M., Mason, S. J., Lazarowski, E. R., and Boucher, R. C. (1995) Nature 377, 643–646[CrossRef][Medline] [Order article via Infotrieve]
  22. Paradiso, A. M., Brown, H. A., Ye, H., Harden, T. K., and Boucher, R. C. (1999) Exp. Lung Res. 25, 277–290[CrossRef][Medline] [Order article via Infotrieve]
  23. Ribeiro, C. M. P., and Putney, J. W., Jr. (1996) J. Biol. Chem. 271, 21522–21528[Abstract/Free Full Text]
  24. Kartner, N., Augustinas, O., Jensen, T. J., Naismith, A. L., and Riordan, J. R. (1992) Nat. Genet. 1, 321–327[CrossRef][Medline] [Order article via Infotrieve]
  25. Clarke, L. L., Grubb, B. R., Gabriel, S. E., Smithies, O., Koller, B. H., and Boucher, R. C. (1992) Science 257, 1125–1128[Abstract/Free Full Text]
  26. Weber, A. J., Soong, G., Bryan, R., Saba, S., and Prince, A. (2001) Am. J. Physiol. 281, L71–L78
  27. Ribeiro, C. M., Paradiso, A. M., Livraghi, A., and Boucher, R. C. (2003) J. Gen. Physiol. 122, 377–387[Abstract/Free Full Text]
  28. Noone, P. G., Bennett, W. D., Regnis, J. A., Zeman, K. L., Carson, J. L., King, M., Boucher, R. C., and Knowles, M. R. (1999) Am. J. Respir. Crit. Care Med. 160, 144–149[Abstract/Free Full Text]
  29. Ribeiro, C. P., O'Neal, W. K., Jones, L. C., and Boucher, R. C. (2003) Pediatr. Pulmonol. 25, (suppl.) 270 (abstr.)
  30. Korkotian, E., Schwarz, A., Pelled, D., Schwarzmann, G., Segal, M., and Futerman, A. H. (1999) J. Biol. Chem. 274, 21673–21678[Abstract/Free Full Text]
  31. Pahl, H. L. (1999) Physiol. Rev. 79, 683–701[Abstract/Free Full Text]
  32. Guo, Q., Sopher, B. L., Furukawa, K., Pham, D. G., Robinson, N., Martin, G. M., and Mattson, M. P. (1997) J. Neurosci. 17, 4212–4222[Abstract/Free Full Text]
  33. Leissring, M. A., Parker, I., and LaFerla, F. M. (1999) J. Biol. Chem. 274, 32535–32538[Abstract/Free Full Text]
  34. Leissring, M. A., Akbari, Y., Fanger, C. M., Cahalan, M. D., Mattson, M. P., and LaFerla, F. M. (2000) J. Cell Biol. 149, 793–798[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
M. E. B. Martino, J. C. Olsen, N. B. Fulcher, M. C. Wolfgang, W. K. O'Neal, and C. M. P. Ribeiro
Airway Epithelial Inflammation-induced Endoplasmic Reticulum Ca2+ Store Expansion Is Mediated by X-box Binding Protein-1
J. Biol. Chem., May 29, 2009; 284(22): 14904 - 14913.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Respir. Crit. Care Med.Home page
S. Ahmad, A. Ahmad, E. S. Dremina, V. S. Sharov, X. Guo, T. N. Jones, J. E. Loader, J. R. Tatreau, A.-L. Perraud, C. Schoneich, et al.
Bcl-2 Suppresses Sarcoplasmic/Endoplasmic Reticulum Ca2+-ATPase Expression in Cystic Fibrosis Airways: Role in Oxidant-mediated Cell Death
Am. J. Respir. Crit. Care Med., May 1, 2009; 179(9): 816 - 826.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
L. Maiuri, A. Luciani, I. Giardino, V. Raia, V. R. Villella, M. D'Apolito, M. Pettoello-Mantovani, S. Guido, C. Ciacci, M. Cimmino, et al.
Tissue Transglutaminase Activation Modulates Inflammation in Cystic Fibrosis via PPAR{gamma} Down-Regulation
J. Immunol., June 1, 2008; 180(11): 7697 - 7705.
[Abstract] [Full Text] [PDF]

Home page
 Eur Respir JHome page
C. R. Esther Jr, N. E. Alexis, M. L. Clas, E. R. Lazarowski, S. H. Donaldson, C. M. Pedrosa Ribeiro, C. G. Moore, S. D. Davis, and R. C. Boucher
Extracellular purines are biomarkers of neutrophilic airway inflammation
Eur. Respir. J., May 1, 2008; 31(5): 949 - 956.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Respir. Cell Mol. Bio.Home page
A. Livraghi, M. Mall, A. M. Paradiso, R. C. Boucher, and C. M. P. Ribeiro
Modelling Dysregulated Na+ Absorption in Airway Epithelial Cells with Mucosal Nystatin Treatment
Am. J. Respir. Cell Mol. Biol., April 1, 2008; 38(4): 423 - 434.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
A. H. Rossi, W. C. Salmon, M. Chua, and C. W. Davis
Calcium signaling in human airway goblet cells following purinergic activation
Am J Physiol Lung Cell Mol Physiol, January 1, 2007; 292(1): L92 - L98.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
Z. Fu, K. Bettega, S. Carroll, K. R. Buchholz, and T. E. Machen
Role of Ca2+ in responses of airway epithelia to Pseudomonas aeruginosa, flagellin, ATP, and thapsigargin
Am J Physiol Lung Cell Mol Physiol, January 1, 2007; 292(1): L353 - L364.
[Abstract] [Full Text] [PDF]

Home page
 Arch Otolaryngol Head Neck SurgHome page
K. Dejima, S. H. Randell, M. J. Stutts, B. A. Senior, and R. C. Boucher
Potential Role of Abnormal Ion Transport in the Pathogenesis of Chronic Sinusitis
Arch Otolaryngol Head Neck Surg, December 1, 2006; 132(12): 1352 - 1362.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
S. F. Okada, R. A. Nicholas, S. M. Kreda, E. R. Lazarowski, and R. C. Boucher
Physiological Regulation of ATP Release at the Apical Surface of Human Airway Epithelia
J. Biol. Chem., August 11, 2006; 281(32): 22992 - 23002.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Cell Physiol.Home page
T. E. Machen
Innate immune response in CF airway epithelia: hyperinflammatory?
Am J Physiol Cell Physiol, August 1, 2006; 291(2): C218 - C230.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Respir. Crit. Care Med.Home page
S. Blouquit, A. Regnier, L. Dannhoffer, C. Fermanian, E. Naline, R. Boucher, and T. Chinet
Ion and Fluid Transport Properties of Small Airways in Cystic Fibrosis
Am. J. Respir. Crit. Care Med., August 1, 2006; 174(3): 299 - 305.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Respir. Cell Mol. Bio.Home page
S. H. Randell, R. C. Boucher, and for the University of North Carolina Virtual Lung
Effective Mucus Clearance Is Essential for Respiratory Health
Am. J. Respir. Cell Mol. Biol., July 1, 2006; 35(1): 20 - 28.
[Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
K. Harada, T. Okiyoneda, Y. Hashimoto, K. Ueno, K. Nakamura, K. Yamahira, T. Sugahara, T. Shuto, I. Wada, M. A. Suico, et al.
Calreticulin Negatively Regulates the Cell Surface Expression of Cystic Fibrosis Transmembrane Conductance Regulator
J. Biol. Chem., May 5, 2006; 281(18): 12841 - 12848.
[Abstract] [Full Text] [PDF]

Home page
 J. Cell Sci.Home page
L. Yang, J. Reece, S. E. Gabriel, and S. B. Shears
Apical localization of ITPK1 enhances its ability to be a modifier gene product in a murine tracheal cell model of cystic fibrosis
J. Cell Sci., April 1, 2006; 119(7): 1320 - 1328.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
K. R. Hallows, A. C. Fitch, C. A. Richardson, P. R. Reynolds, J. P. Clancy, P. C. Dagher, L. A. Witters, J. K. Kolls, and J. M. Pilewski
Up-regulation of AMP-activated Kinase by Dysfunctional Cystic Fibrosis Transmembrane Conductance Regulator in Cystic Fibrosis Airway Epithelial Cells Mitigates Excessive Inflammation
J. Biol. Chem., February 17, 2006; 281(7): 4231 - 4241.
[Abstract] [Full Text] [PDF]

Home page
 J. Histochem. Cytochem.Home page
J. Perez-Vilar, C. M. P. Ribeiro, W. C. Salmon, R. Mabolo, and R. C. Boucher
Mucin Granules are in Close Contact with Tubular Elements of the Endoplasmic Reticulum
J. Histochem. Cytochem., October 1, 2005; 53(10): 1305 - 1309.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
C. M. P. Ribeiro, A. M. Paradiso, U. Schwab, J. Perez-Vilar, L. Jones, W. O'Neal, and R. C. Boucher
Chronic Airway Infection/Inflammation Induces a Ca2+i-dependent Hyperinflammatory Response in Human Cystic Fibrosis Airway Epithelia
J. Biol. Chem., May 6, 2005; 280(18): 17798 - 17806.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
280/11/10202    most recent
M410617200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ribeiro, C. M. P.
Right arrow Articles by Boucher, R. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ribeiro, C. M. P.
Right arrow Articles by Boucher, R. C.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2005 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement