Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M409457200 on January 5, 2005

J. Biol. Chem., Vol. 280, Issue 11, 10419-10426, March 18, 2005
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
280/11/10419    most recent
M409457200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yanagawa, T.
Right arrow Articles by Raz, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yanagawa, T.
Right arrow Articles by Raz, A.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Differential Regulation of Phosphoglucose Isomerase/Autocrine Motility Factor Activities by Protein Kinase CK2 Phosphorylation*

Takashi Yanagawa{ddagger}§, Tatsuyoshi Funasaka{ddagger}, Soichi Tsutsumi¶, Tirza Raz{ddagger}, Nobutada Tanaka||, and Avraham Raz{ddagger}**

From the {ddagger}Tumor Progression and Metastasis Program, Karmanos Cancer Institute, and the Department of Pathology, Wayne State University, School of Medicine, Detroit, Michigan 48201, the Departments of §Orthopedic Surgery and General Surgical Science (Surgery I), Gunma University Graduate School of Medicine, Maebashi 371-8511, Japan, and the ||School of Pharmaceutical Sciences, Showa University, Tokyo 142-8555, Japan

Received for publication, August 17, 2004 , and in revised form, January 4, 2005.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Phosphoglucose isomerase (PGI; EC 5.3.1.9 [EC] ) is a cytosolic housekeeping enzyme of the sugar metabolism pathways that plays a key role in both glycolysis and gluconeogenesis. PGI is a multifunctional dimeric protein that extracellularly acts as a cytokine with properties that include autocrine motility factor (AMF)-eliciting mitogenic, motogenic, and differentiation functions, and PGI has been implicated in tumor progression and metastasis. Little is known of the biochemical regulation of PGI/AMF activities, although it is known that human PGI/AMF is phosphorylated at Ser185 by protein kinase CK2 (CK2); however, the physiological significance of this phosphorylation is unknown. Thus, by site-directed mutagenesis, we substituted Ser185 with aspartic acid (S185D) or glutamic acid (S185E), which introduces a negative charge and conformational changes that mimic phosphorylation. A Ser-to-Ala mutant protein (S185A) was generated to abolish phosphorylation. Biochemical analyses revealed that the phosphorylation mutant proteins of PGI exhibited decreased enzymatic activity, whereas the S185A mutant PGI protein retained full enzymatic activity. PGI phosphorylation by CK2 also led to down-regulation of enzymatic activity. Furthermore, CK2 knockdown by RNA interference was associated with up-regulation of cellular PGI enzymatic activity. The three recombinant mutant proteins exhibited indistinguishable cytokine activity and receptor-binding affinities compared with the wild-type protein. In both in vitro and in vivo assays, the wild-type and S185A mutant proteins underwent active species dimerization, whereas both the S185D and S185E mutant proteins also formed tetramers. These results demonstrate that phosphorylation affects the allosteric kinetic properties of the enzyme, resulting in a less active form of PGI, whereas non-phosphorylated protein species retain cytokine activity. The process by which phosphorylation modulates the enzymatic activity of PGI thus has an important implication for the understanding of the biological regulation of this key glucose metabolism-regulating enzyme.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Phosphoglucose isomerase (PGI)1 is a multifunctional protein that plays an important intracellular role in both the glycolytic and gluconeogenesis pathways, catalyzing the inter-conversion of glucose 6-phosphate and fructose 6-phosphate (1) while extracellularly behaving as a cytokine. Molecular cloning and sequencing have characterized PGI as an autocrine motility factor (AMF), involved in angiogenesis and metastasis (24); a T cell lymphokine, e.g. neuroleukin, which supports the survival of spinal and sensory neurons (5, 6); a maturation factor, which differentiates myeloid leukemic cells to terminal monocytic cells (7); sperm antigen-36 (8); and a myofibril-bound serine proteinase inhibitor (9). Aberrations in the expression or activities of PGI due to mutations or deletions are of significant clinical importance since, in humans, they are associated with hereditary non-spherocytic hemolytic anemia diseases (10, 11). In addition, PGI/AMF is an antigen in arthritis disease (12), and its presence in serum and urine is of prognostic value associated with cancer progression (1315).

Once secreted from tumor cells, PGI behaves as an AMF, which promotes cancer cell invasion and metastasis by stimulating cell motility via the autocrine loop following binding to its seven-transmembrane glycoprotein receptor (AMF receptor) (16, 17). Hypoxia, a phenomenon associated with cancer growth, stimulates its expression (18, 19). PGI/AMF may act as a paracrine factor during cancer progression, as its binding to the endothelial cell AMF receptor promotes angiogenesis and vessel leakiness (3, 4, 20).

To elucidate the catalytic function of PGI, several crystal structure analyses of this protein have been performed (2124). They revealed that active PGI is a dimer composed of a large and a small domain and that its sugar-binding site, which is responsible for its enzymatic activity, is located in the junction where the large and small domains and the C-terminal tail come together (24, 25). Mutagenesis of the sugar-binding motif of PGI results in abrogation of cytokine activity, suggesting that the active site of the enzyme overlaps with cytokine function (24). These data are consistent with the fact that the specific active-site sugar inhibitors erythrose 4-phosphate and 5-phosphoarabinonate also inhibit its cytokine activity (2, 21). However, the regulation mechanisms of the enzymatic/cytokine activity of PGI are not fully understood.

Other glycolytic enzymes of vertebrates, including phosphofructokinase (2628), glyceraldehyde-3-phosphate dehydrogenase (26, 29), phosphoglycerate mutase (26, 30), enolase (26, 31, 32), pyruvate kinase (33), and lactate dehydrogenase (31), are also phosphoproteins like PGI. Phosphofructokinase and pyruvate kinase are phosphorylated by cAMP-dependent kinase, resulting in down-regulation of activity (27, 33). Protein kinase C phosphorylation of phosphofructokinase induces up-regulation of enzymatic activity (28), and phosphorylation of enolase precedes glycolysis (34). It is still unknown whether the expression or activities of the rest of the glycolytic enzymes are also regulated by phosphorylation. Previously, it was reported that PGI is phosphorylated at Ser185 by protein kinase CK2 (CK2) (35), although the physiological significance of such phosphorylation remained to be determined. Thus, to study the function(s) of phosphorylated PGI, we generated, by site-directed mutagenesis, non-phosphorylation- and phosphorylation-mimicking species of recombinant PGI proteins and analyzed their structures and enzymatic and cytokine activities.


    EXPERIMENTAL PROCEDURES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Cells and Monolayer Culture Conditions—The human fibrosarcoma cell line HT1080 (CCL121) was obtained from American Type Culture Collection (Manassas, VA). Cells were grown in Dulbecco's modified Eagle's medium supplemented with 10% heat-inactivated fetal bovine serum, nonessential amino acids, and antibiotics and maintained at 37 °C in a humidified atmosphere of 5% CO2 and 95% air.

Site-directed Mutagenesis—A Ser-to-Ala substitution at residue 185 (S185A) to abolish phosphorylation and Ser-to-Asp (S185D) and Ser-to-Glu (S185E) substitutions to mimic phosphoserine were generated using with the QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA). The pGEX6P vector containing human PGI/AMF cDNA was used as a template for PCR. The sequences of the primers used to generate point mutations were GGTATGTCGCCAACATTGATGGAAC, GGTATGTCGACAACATTGATGGAAC, and GGTATGTCGCGAACATTGATGGAAC for S185A, S185D, and S185E, respectively. The PCR conditions used for all mutants were as follows: 95 °C for 0.5 min and 16 cycles at 95 °C for 0.5 min, 55 °C for 1 min, and 68 °C for 8 min. After the template DNA was digested with the DpnI restriction enzyme, the PCR product was transferred into One Shot® TOP10 competent cells (Invitrogen). Recombinant plasmids including the mutants were purified and sequenced. We have previously established the crystal structure of human PGI (24); and based on these data, the structural changes between the wild-type (WT) and mutant PGI proteins were examined using the program MODELLER (36). We constructed an energy-minimized model of human PGI phosphorylated at Ser185 using the program REFMAC (37).

Transfection with Mutant PGI Genes and RNA Interference—WT and mutant PGI genes were ligated into the mammalian expression vector pcDNA3.1-His (Invitrogen). Parental HT1080 cells were transfected with the vectors using LipofectamineTM 2000 (Invitrogen) according to the manufacturer's instructions. The medium was changed to serum-free medium 24 h after transfection. 24 h later, cells were lysed in radioimmune precipitation assay buffer (20 mM Tris, 150 mM NaCl, 1% Triton X-100, 1% Nonidet P-40, 10 mM EDTA, and 25 mM sodium deoxycholate), and the conditioned medium was collected. Each sample was subjected to SDS-PAGE and transferred to a polyvinylidene difluoride membrane, which was probed by anti-XpressTM antibody (Invitrogen). The small interfering RNA (siRNA) sequences designed for human CK2 and firefly (Photinus pyralis) luciferase (GL3) as a control were 5'-CCAGCUGGUAGUCAUCUUGUU-3' and 5'-CUUACGUGAGUACUUCGATT-3', respectively, as reported previously (38, 39). HT1080 cells were transfected with siRNA using Oligofectamine (Invitrogen) according to the manufacturer's instructions and Western-blotted 48 h after transfection. Anti-CK2{alpha} antibody was from Santa Cruz Biotechnology Inc. (Santa Cruz, CA).

In Vitro Phosphorylation of PGI—Affinity-purified recombinant human WT PGI was incubated with or without CK2 (Calbiochem) in reaction buffer (pH 7.5) containing 50 mM KCl, 20 mM Tris-HCl, 10 mM MgCl2, and 10 µCi of [{gamma}-32P]ATP (ICN Biomedicals, Aurora, OH) at 30 °C for 1 h. To eliminate CK2, samples were immunoprecipitated with monospecific polyclonal antibodies directed against human PGI (2) and then washed five times with phosphate-buffered saline (PBS) (pH 7.2) and separated by SDS-PAGE. Phosphorylation was detected by auto-radiography. For control assays, 200 µM unlabeled ATP was used.

Measurement of PGI Enzymatic Activity—The enzymatic activities of affinity-purified recombinant WT and mutant PGI proteins were measured as described previously (40). Briefly, 0.02 µg of each sample was added to a reaction mixture consisting of 0.1 M Tris (pH 8.5), 4.0 mM fructose 6-phosphate, 0.5 mM NADPH, and 1 unit of glucose-6-phosphate dehydrogenase, and its enzymatic activity was immediately monitored at A340 nm for 10 min using a Shimadzu spectrophotometer. Rabbit PGI (Sigma) was used as a control. To analyze in vivo mutant PGI enzymatic activity, 48 h after transfection with WT and mutant PGI genes, cells were lysed in radioimmune precipitation assay buffer, and each sample at 30 µg/protein was used to measure their enzymatic activities.

Transwell® and Phagokinetic Track Motility Assays—The directional motility was assayed using 6.5-mm Transwell® supports with 8.0-µm pore polycarbonate membrane inserts (Corning Life Sciences, Acton, MA) according to the method of Repesh (41) with some modifications. 100 µl of cell suspension (1 x 105 cells/ml) was added to the upper compartment, and 600 µl of Dulbecco's modified Eagle's medium with 10% fetal bovine serum was added to the lower one. After a 6-h incubation with 100 pg/ml recombinant PGI proteins at 37 °C, the membranes were fixed with 70% ethanol for 1 h, stained with 0.4% trypan blue, and washed with distilled water. The cells that invaded through the membrane were counted after the cells on the upper surface of the membrane were swiped with cotton swabs.

For random motility assay, uniform carpets of gold particles were prepared on glass coverslips coated with bovine serum albumin (BSA) as described previously (42). The coverslips were placed in 35-mm tissue culture dishes, and 2500 HT1080 cells were plated onto them. After a 24-h incubation at 37 °C with or without 100 pg/ml PGI proteins, the phagokinetic tracks produced by the migratory cells were visualized under a microscope. The phagokinetic tracks of at least 30 individual cells were measured, and the S.E. reflecting a 95% confidence level was calculated.

Cross-linking of WT, Mutant, and Phosphorylated PGI Proteins—WT and mutant PGI proteins were cross-linked using dithiobis(succinimidyl propionate) (DSP; Pierce) following the manufacturer's instructions. Briefly, the proteins were eluted in PBS, mixed with a 20-fold molar excess of DSP, and incubated at 24 °C for 30 min. After incubation with CK2, phosphorylated recombinant human PGI protein was also cross-linked as well. The reactions were quenched with 50 mM Tris for 15 min and analyzed by SDS-PAGE. To examine in vivo mutant protein structure, 48 h after transfection with WT and mutant PGI genes, cells were incubated in PBS with 1 mM DSP at 24 °C for 30 min. The reactions were quenched with 50 mM Tris for 15 min, and samples were analyzed by Western blotting and probed with anti-XpressTM antibody.

Binding Analysis—Recombinant WT and mutant PGI proteins (10 µg/µl) in 100 µl of conjugation buffer (0.1 M phosphate and 0.15 M NaCl (pH 7.2)) were incubated with 10 µg of N-hydroxysuccinimide fluorescein (Pierce) on ice for 2 h. Labeled proteins were dialyzed to remove free N-hydroxysuccinimide fluorescein, and their concentrations were determined. HT1080 cells treated with trypsin after three washes with PBS were divided at 3 x 105 cells/sample and incubated in PBS containing 0.1% BSA with or without unlabeled PGI (2 mg) and differing concentrations of labeled WT and mutant PGI proteins (0, 0.3125, 0.625, 1.25, 2.5, 5, 10, and 20 mM) at 24 °C for 1 h. After centrifugation, cell pellets were washed three times with PBS containing 0.1% BSA and lysed in 1 M NaOH for 30 min. The fluorescence intensity of each sample was measured using a SpectraMax® GEMINI XS spectrofluorometer (Molecular Devices Corp., Sunnyvale, CA) using the parameters {lambda}ex = 490 nm and {lambda}em = 520 nm with a 515-nm emission cutoff filter.

Statistical Analysis—Invasion and phagokinetic track assays were analyzed using Bonferroni's/Dunn's method by analysis of variance and the post-hoc test.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Effect of Ser185 Substitution or Phosphorylation of PGI on Its Enzymatic Activity and Secretion—It was previously reported that PGI undergoes post-translational modification by phosphorylation of Ser185 by CK2 (35). Based on the evidence that phosphorylation of glycolytic enzymes alters their enzymatic activities (27, 28, 33), we questioned whether phosphorylation of PGI is of physiological significance. To address this, we constructed mutants by site-directed mutagenesis whereby we substituted Ser185 with aspartic acid (S185D) or glutamic acid (S185E), which introduces a negative charge and conformational changes that mimic phosphorylation (43) and Ser185 with alanine (S185A), which abolishes phosphorylation. As shown in Fig. 1A (inset), the WT and S185A, S185D, and S185E mutant PGI proteins comigrated upon SDS-PAGE as a single protein band. Enzymatic analysis revealed that whereas the WT and S185A proteins exhibited a similar enzymatic activity, the S185D and S185E mutants showed markedly depressed PGI activities (Fig. 1A). To analyze mutant PGI functions in vivo, we used the pcDNA3.1-His mammalian expression vector, which can produce proteins with a unique antigen, the XpressTM epitope, because expressed mutant proteins should be differentiated from the PGI protein that HT1080 cells originally express. As shown in Fig. 1B, the cells transfected with WT and all mutant PGI genes expressed and secreted PGI/AMF. Previously, we hypothesized that PGI phosphorylation provokes PGI secretion because PGI/AMF secreted to conditioned medium is phosphorylated (35). The present study shows, however, that not only phosphorylation-mimicking mutant PGI proteins (S185D and S185E), but also WT and phosphorylation-abolishing (S185A) PGI proteins were secreted. As shown in Fig. 1, WT and S185A mutant PGI gene-transfected cells appeared to augment PGI activity, whereas null vector-, S185D, and S185E-transfected cells did not.



View larger version (21K):
[in this window]
[in a new window]
 
FIG. 1.
Enzymatic activity of WT and mutant PGI/AMF proteins. A, the in vitro enzymatic activity of recombinant WT and mutant PGI/AMF proteins was monitored for 10 min. The enzymatic activity of S185A was similar to that of the WT protein, whereas the enzymatic activity of S185D and S185E diminished to 20% or less of that of the WT protein. {diamond}, WT; •, S185A; {triangleup}, S185D; {blacktriangleup}, S185E. Inset, 1 µg of each sample was subjected to SDS-PAGE, stained with Coomassie Brilliant Blue, and detected as the same molecular mass band. The data shown are representative of five independent experiments with similar results. B, parental HT1080 cells were transfected with WT and mutant PGI genes. The cytosolic and secreted PGI/AMF proteins were analyzed by Western blotting of samples (30 µg/protein) from cell lysates and conditioned medium and probed with anti-XpressTM antibody. The WT and mutant PGI proteins were detected in both cell lysates and conditioned medium (inset). The cell lysates were also used for measuring in vivo mutant PGI protein enzymatic activity. The PGI activities of WT and S185A PGI gene-transfected cells were >2-fold higher than that of the parental cells, whereas transfections with the S185D and S185E PGI genes hardly affected their PGI enzymatic activities. Lane a and {blacksquare}, parental HT1080 cells; lane b and x, null vector-transfected HT1080 cells; lane c and {diamond}, WT PGI gene-transfected HT1080 cells; lane d and •, S185A PGI gene-transfected HT1080 cells; lane e and {triangleup}, S185D PGI gene-transfected HT1080 cells; lane f and {blacktriangleup}, S185E PGI gene-transfected HT1080 cells. The data shown are representative of three independent experiments with similar results.

 
Next, we questioned whether the reduced enzymatic activity of the S185D and S185E mutant PGI proteins results from mimicked phosphorylation status or amino acid substitutions. Thus, recombinant human CK2 (500 units) was used to phosphorylate affinity-purified human PGI (10 µg), and phosphorylated PGI was detected by autoradiography after SDS-PAGE (Fig. 2, inset, lower panel, lane a). The S185D mutant PGI protein we used for a control was not phosphorylated, as expected (Fig. 2, inset, lower panel, lane b), and PGI did not undergo autophosphorylation in the absence of CK2 (lane c). The enzymatic activity of phosphorylated PGI was measured (Fig. 2) and found to be reduced by ~50% at the linear portion of the enzymatic curve. This significantly reduced activity was not as dramatic as that observed in the phosphorylation-mimicking mutant proteins (Fig. 1A), which could be attributed to the fact that not all of the PGI molecules in the phosphorylation reaction mixture were phosphorylated and gives credence to the use of the phosphorylation-mimicking mutant proteins.



View larger version (21K):
[in this window]
[in a new window]
 
FIG. 2.
Enzymatic activity of phosphorylated PGI/AMF. The enzymatic activity of phosphorylated PGI/AMF ({diamondsuit}) was 50% of that of non-phosphorylated PGI/AMF {diamond} in the linear phase, although it was higher than that of the S185D and S185E mutants, which mimic phosphorylation. Inset, detection of PGI/AMF phosphorylation by autoradiography. WT PGI/AMF was phosphorylated by CK2 (lane a) and was not phosphorylated without CK2 (lane b), whereas S185D was not phosphorylated even with CK2 (lane c). Comparison between Coomassie Brilliant Blue (CB) and autoradiography (32P) suggests incomplete phosphorylation of PGI/AMF. The data shown are representative of three independent experiments with similar results.

 
In addition, we transfected HT1080 cells with siRNA against CK2 to examine CK2 involvement with PGI activity. 2 days after transfection, CK2 expression was suppressed by <50% by siRNA, and the PGI activity of transfected cells increased 1.6-fold more compared with controls (Fig. 3).



View larger version (21K):
[in this window]
[in a new window]
 
FIG. 3.
Effect of suppressed CK2 on PGI enzymatic activity. HT1080 cells were transfected with siRNA against CK2 and firefly luciferase (GL3) as a control using Oligofectamine. CK2 expression in siRNA-transfected cells decreased to <50% in parental cells 48 h after transfection (inset), which led to >60% up-regulation of PGI enzymatic activity. Lane a and {diamond}, parental HT1080 cells; lane b and {blacktriangleup}, siRNA against GL3 luciferase-transfected cells; lane c and •, siRNA against CK2-transfected cells. The data shown are representative of three independent experiments with similar results.

 
Effect of Ser185 Substitution of PGI on Its Cytokine Activity—To study the possible relationship between PGI phosphorylation and cytokine activity, we resorted to two independent motility assays: 1) invasion assay utilizing Transwell® for measuring direct motility (Fig. 4A) and 2) phagokinetic track assay for measuring overall random motility capabilities (Fig. 4B). The WT and S185A, S185D, and S185E mutant proteins at 100 pg/ml increased HT1080 cell invasion (directional motility) compared with controls in the invasion assay (analysis of variance; F4,70 = 8.156, p < 0.0001 and p = 0.0005, 0.0033, and 0.0026, respectively) (Fig. 4A). Similarly, in the phagokinetic track motility assay, the mutant proteins stimulated the motility of HT1080 cells to the same level as the WT protein relative to unstimulated control cells (analysis of variance; F4,245 = 3.622, p = 0.0007 (WT protein), 0.0041 (S185A), 0.008 (S185D), and 0.0074 (S185E)) (Fig. 4B). Next, to confirm that PGI phosphorylation does not affect cytokine activity, we tested binding to HT1080 cell surfaces and found that all of the Ser185 mutant PGI proteins exhibited cell-surface saturable binding kinetics similar to those of the WT protein (Fig. 4C).



View larger version (16K):
[in this window]
[in a new window]
 
FIG. 4.
Cytokine activity of WT and mutant PGI/AMF proteins and binding assay. A, Transwell® invasion assay. The HT1080 cells that invaded through the membrane in Transwell® supports were counted. The recombinant WT and mutant PGI/AMF proteins added to the medium significantly increased cell invasion. B, phagokinetic track random motility assay. 2500 HT1080 cells were seeded on uniform carpets of gold particles on glass coverslips coated with BSA. The areas cleared of gold particles by at least 30 individual cells were measured. The WT and mutant PGI/AMF proteins showed significant up-regulation. Error bars indicated the S.E. values of triplicate analyses. C, binding assay for WT and mutant PGI/AMF proteins. HT1080 cells were incubated in PBS containing 0.1% BSA with or without a large amount of unlabeled PGI/AMF (2 mg) and various concentrations of labeled WT and mutant PGI/AMF proteins at 24 °C for 1 h. After incubation and washes, the fluorescence intensity of each sample was measured, and (ligand concentration) - (bound ligand) curves for the WT and mutant proteins were calculated. All PGI/AMF proteins reached saturation at <20 mM ligand. All PGI/AMF proteins demonstrated similar Kd values calculated by Scatchard analysis as follows: WT protein, 1.03 x 10-6 M; S185A, 1.42 x 10-6 M; S185D, 1.36 x 10-6 M; and S185E, 1.17 x 10-6 M. The experiments were repeated three times with similar results.

 
Structures of Cross-linked WT and Mutant PGI Proteins Next, we questioned whether PGI phosphorylation leads to conformational changes, which might explain, in part, the observed reduction in enzymatic activity. PGI is a dimeric protein, and homodimerization is essential for its enzymatic activity. Thus, to study the behavior of the molecule in suspension, we tested the molecular size of the proteins in the presence or absence of the cross-linker DSP and examined whether these mutations affect the dimerization of PGI. Under reducing conditions and in the absence of the cross-linker, the in vitro WT (Fig. 5A, lane 1-), S185A (lane 2-), S185D (lane 3-), and S185E (lane 4-) proteins comigrated upon SDS-PAGE as a single 55-kDa monomeric protein band. However, the presence of the cross-linker revealed that both the WT and S185A protein species exist as dimers in solution (Fig. 5A, lanes 1+ and 2+, respectively), whereas the S185D (lane 3+) and S185E (lane 4+) proteins formed both dimers and tetramers in solution. Phosphorylated PGI also formed a tetramer in the presence of the cross-linker, as did the S185D and S185E mutants (Fig. 5B, lane 2+), whereas non-phosphorylated PGI did not, even with the cross-linker (lane 1+). To examine the conformation of in vivo PGI mutants, we incubated the transfected cells with the cross-linker at 24 °C for 30 min and then analyzed them by Western blotting. As in the in vitro assay, an augmented band expected to be a tetramer of PGI was detected with the S185D and S185E proteins (Fig. 5C, lanes 5 and 6, respectively), but not with the WT and S185A proteins (lanes 3 and 4, respectively). This suggests that the introduced negative charge and conformational changes that mimic phosphorylation induce structural changes that allow the molecules to be in a monomer-dimer-tetramer equilibrium, reflecting, in part, the loss of enzymatic activity.



View larger version (37K):
[in this window]
[in a new window]
 
FIG. 5.
Cross-linked WT and mutant PGI/AMF proteins. A, the WT and mutant proteins formed a monomer without the cross-linker DSP in vitro. After incubation with the cross-linker for 30 min, the WT and mutant proteins formed a dimer. In addition, S185D and S185E also formed a small amount of tetramer. Lanes 1- and 1+, WT protein without and with DSP, respectively; lanes 2- and 2+, S185A without and with DSP, respectively; lanes 3- and 3+, S185D without and with DSP, respectively; lanes 4- and 4+, S185E without and with DSP, respectively. B, recombinant human PGI was incubated without or with CK2 for 1 h and cross-linked. Phosphorylated PGI formed a tetramer. Lanes 1- and 1+, incubation without CK2 in the absence and presence of DSP, respectively; lanes 2- and 2+, incubation with CK2 in the absence and presence of DSP, respectively. C, mutant PGI gene-transfected cells were incubated with the cross-linker (1 mM DSP), and the cell lysates were analyzed by immunoblotting. S185D and S185E formed a tetramer in vivo. Lane 1, parental HT1080 cells; lane 2, null vector-transfected HT1080 cells; lanes 3–6, WT, S185A, S185D, and S185E PGI gene-transfected HT1080 cells, respectively. The data shown are representative of three independent experiments with similar results.

 
Structure of Mutant PGI and Effects of Ser185 Phosphorylation on the Active Site—To further analyze the possible effect of Ser185 phosphorylation on the structure of PGI, we utilized the program MODELLER for homology modeling calculations using the crystal structure of inhibitor-free PGI as a template (24). Human PGI is a dimer presented as a ribbon diagram with the two monomers in blue and red (Fig. 6A). Bound inhibitor molecules are shown in yellow to localize the enzyme active site, and the position of Ser185 is circled and is located on the reverse side of the active-site cleft (Fig. 6A). To further visualize the possible role of Ser185 phosphorylation, we constructed an energy-minimized model of human PGI to introduce phosphorylated Ser185 into substrate-free human PGI using the energy minimization function of the REFMAC program (Fig. 6, B and C, front view and 20° rotation for better visualization). No significant structural changes were observed for the active site of human PGI phosphorylated at Ser185. Because the side chain of Ser185 is exposed to the inner depression of the dimeric molecule of PGI, it is possible that no structural hindrance of the surrounding residues is observed following phosphorylation. As shown in Fig. 6D, the phosphate group of Ser(P)185 could be accommodated between the side chains of Asp161 and Asn386 (Asn386 belonging to the other subunit). Although minor rearrangements of the side chain of Asp161 were observed, no significant structural changes were observed for the active-site residues.



View larger version (34K):
[in this window]
[in a new window]
 
FIG. 6.
Structures of WT, mutant, and Ser185-phosphorylated PGI/AMF proteins. A, dimeric structure of PGI/AMF with erythrose 4-phosphate (E4P). There was no significant structural difference between the WT and mutant PGI/AMF proteins. Cytokine and enzyme active sites where erythrose 4-phosphate binds overlap each other (arrow). One subunit is colored blue, and another one is colored red. Erythrose 4-phosphate is colored yellow. Note that Ser185 is located on the reverse side of the active site. B and C, ribbon diagrams showing the positions of the active site (dashed circle) and Ser185 (ball-and-stick, green) of dimeric human PGI/AMF. Because the location of Ser185 is rather unclear from the view in the upper panels, the PGI/AMF molecule was rotated by 20° and is shown in the lower panels. B, human WT PGI/AMF (experimentally obtained crystal structure). C, human PGI/AMF phosphorylated at Ser185 (theoretically calculated energy-minimized model). Phosphorylated Ser185 is indicated by the thin arrow. There was no significant difference between the WT and Ser185-phosphorylated PGI/AMF proteins. D, ball-and-stick models showing the phosphorylation site of human PGI/AMF. The WT and Ser185-phosphorylated PGI/AMF proteins are shown in yellow and green, respectively. The oxygen and phosphorus atoms of Ser185 are shown in red and orange, respectively. There was no significant structural change in the active-site residues, although minor change was detected at Asp161.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
In this study, we have shown that human PGI/AMF is a phosphoprotein that is phosphorylated at Ser185 by CK2 and that phosphorylation inhibits its enzymatic activity. In this respect, PGI is not unique, as it shares similarity with other phosphoglycolytic enzymes such as phosphofructokinase (2628), glyceraldehyde-3-phosphate dehydrogenase (26, 29), phosphoglycerate mutase (26, 30), enolase (26, 31, 32), pyruvate kinase (33), and lactate dehydrogenase (31) in that phosphorylation regulates enzymatic activity. PGI is nearly ubiquitous in evolution; a cluster of ~40 amino acid residues has remained conserved, whereas most amino acid residues outside the enzyme active site have changed (44). However, similar to the active site, the Ser consensus phosphorylation motif of PGI has also remained highly conserved during evolution (Fig. 6). Human PGI Ser185 corresponds to Ser182, Ser193, Ser189, and Ser185 in bacteria, yeast, Drosophila, and rabbit, respectively (Fig. 7), implying that PGI phosphorylation is a conserved common process regulating its isomerase activity during glycolysis and glycogenesis. Molecular cloning and sequencing have characterized PGI as a leaderless protein that is secreted via the non-classical pathway and designated it as an AMF, which is involved in angiogenesis and metastasis (24); a T cell lymphokine, e.g. neuroleukin, which supports the survival of spinal and sensory neurons (5, 6); a maturation factor, which differentiates myeloid leukemic cells to terminal monocytic cells (7); sperm antigen-36 (8); and a myofibril-bound serine proteinase inhibitor (9). In addition, extracellular PGI is an antigen in arthritis disease (12), and its presence in serum and urine is of prognostic value associated with cancer progression (1315). This study has shown that PGI phosphorylation is not associated with its secretion. In addition, an energy-minimized model revealed that Ser185 phosphorylation of human PGI may not affect the topography of the active-site residues, suggesting that phosphorylation may interfere with isomerization, not with binding of the sugar substrates. This notion is strengthened by the facts that phosphorylation alters its homodimerization ability, similar to the serine phosphorylation of the tau protein (43), and that phosphorylation increases the stability of the individual protein helices that should relieve an unfavorable electrostatic interaction in the tetramer (45).



View larger version (25K):
[in this window]
[in a new window]
 
FIG. 7.
PGI sequence alignment. Ser185 in human PGI/AMF (Homo sapiens; Swiss-Prot accession number P06744 [GenBank] ) corresponds to Ser182 in bacteria (Escherichia coli; accession number P11537 [GenBank] ), Ser193 in yeast (Saccharomyces cerevisiae; accession number P12709 [GenBank] ), Ser189 in Drosophila melanogaster (accession number P52029 [GenBank] ), and Ser185 in rabbit (Oryctolagus cuniculus; accession number Q9N1E2). Well conserved sequences are indicated in gray. Ser185 is well conserved in a wide spectrum of species.

 
Although the exact mechanism for decreasing PGI enzymatic activity by Ser185 phosphorylation still remains unknown, the location of Ser185 may be an important clue for resolving this mechanism. It is noteworthy that Ser185 is located on the reverse side of the active-site cleft (like a lining). Therefore, its phosphorylation may cause subtle structural changes (which may not be detected by energy minimization) at the active-site cleft. Because enzymatic reaction strictly requires intact geometry of active-site residues, subtle structural changes caused by the phosphorylation might abolish the enzymatic activity of phosphorylated PGI. An electrostatic effect introduced by the negative charge of the phosphate group on the reverse side of the active-site cleft may also inhibit the enzymatic activity by 1) electrostatic repulsion between the negative charges of the phosphate groups of Ser185 and the substrate molecule and/or 2) affecting the pKa values of the catalytic residues in the active site. It is also possible that the negative charge modifications induced by phosphorylation are below the resolution of the crystallographic method used. The point mutation at Ser185 may induce a subtle structural change that could not be detected by homology modeling techniques or a change of electrical charges at the active site. Read et al. (23) examined the crystal structures of 28 PGI mutants associated with hemolytic anemia and classified them into three categories: those that alter the PGI structure, those that disrupt dimerization, and those that affect active sites. Phosphorylated PGI may thus be classified into the last category.

The results from this study suggest that phosphorylation of PGI may influence glucose metabolism. It is well known that malignant tumors show an enhancement of glycolysis (46). Transfection with src and ras oncogenes results in an increase in glucose transport and augmented transporter protein and mRNA levels (47). Hexokinase, the first enzyme of the glycolytic pathway, is increased in a rapidly growing hepatoma (48). PGI deficiency and/or reduced activity due to sequence mutations causes hemolytic anemia, and PGI deficiency affects the glucose usage and energy metabolism in a mouse model (49).

In conclusion, PGI belongs to the family of "moonlighting proteins" that exhibit multiple cellular and extracellular functions (50). The data presented here show for the first time that phosphorylation of PGI regulates its enzymatic activity and suggest that this post-translational modification contributes to its multiple functions. It remains to be resolved whether the observed decreased enzymatic activity of phosphorylated PGI results from changes in enzyme-substrate binding (Km) or reaction rate (kcat), and the mutant PGI proteins generated here should be useful in future analyses of how changes in glucose metabolism affect the pathobiology of the cell.


    FOOTNOTES
 
* This work was supported by National Institutes of Health Grant CA-51714 (to A. R.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

** To whom correspondence should be addressed: Tumor Progression and Metastasis Program, Karmanos Cancer Inst., 110 E. Warren Ave., Detroit, MI 48201. Tel.: 313-833-0960; Fax: 313-831-7518; E-mail: raza{at}karmanos.org.

1 The abbreviations used are: PGI, phosphoglucose isomerase; AMF, autocrine motility factor; CK2, protein kinase CK2; WT, wild-type; siRNA, small interfering RNA; PBS, phosphate-buffered saline; BSA, bovine serum albumin; DSP, dithiobis(succinimidyl propionate). Back



    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Harrison, R. A. (1974) Anal. Biochem. 61, 500-507[CrossRef][Medline] [Order article via Infotrieve]
  2. Watanabe, H., Takehana, K., Date, M., Shinozaki, T., and Raz, A. (1996) Cancer Res. 56, 2960-2963[Abstract/Free Full Text]
  3. Funasaka, T., Haga, A., Raz, A., and Nagase, H. (2001) Biochem. Biophys. Res. Commun. 285, 118-128[CrossRef][Medline] [Order article via Infotrieve]
  4. Funasaka, T., Haga, A., Raz, A., and Nagase, H. (2002) Int. J. Cancer 101, 217-223[CrossRef][Medline] [Order article via Infotrieve]
  5. Chaput, M., Claes, V., Portetelle, D., Cludts, I., Cravador, A., Burny, A., Gras, H., and Tartar, A. (1988) Nature 332, 454-455[CrossRef][Medline] [Order article via Infotrieve]
  6. Faik, P., Walker, J. I., Redmill, A. A., and Morgan, M. J. (1988) Nature 332, 455-457[CrossRef][Medline] [Order article via Infotrieve]
  7. Xu, W., Seiter, K., Feldman, E., Ahmed, T., and Chiao, J. W. (1996) Blood 87, 4502-4506[Abstract/Free Full Text]
  8. Yakirevich, E., and Naot, Y. (2000) Biol. Reprod. 62, 1016-1023[Abstract/Free Full Text]
  9. Cao, M. J., Osatomi, K., Matsuda, R., Ohkubo, M., Hara, K., and Ishihara, T. (2000) Biochem. Biophys. Res. Commun. 272, 485-489[CrossRef][Medline] [Order article via Infotrieve]
  10. Schröter, W., Eber, S. W., Bardosi, A., Gahr, M., Gabriel, M., and Sitzmann, F. C. (1985) Eur. J. Pediatr. 144, 301-305[CrossRef][Medline] [Order article via Infotrieve]
  11. Beutler, E., West, C., Britton, H. A., Harris, J., and Forman, L. (1997) Blood Cells Mol. Dis. 23, 402-409[CrossRef][Medline] [Order article via Infotrieve]
  12. Matsumoto, I., Staub, A., Benoist, C., and Mathis, D. (1999) Science 286, 1732-1735[Abstract/Free Full Text]
  13. Baumann, M., and Brand, K. (1988) Cancer Res. 48, 7018-7021[Abstract/Free Full Text]
  14. Baumann, M., Kappl, A., Lang, T., Brand, K., Siegfried, W., and Paterok, E. (1990) Cancer Investig. 8, 351-356[Medline] [Order article via Infotrieve]
  15. Filella, X., Molina, R., Jo, J., Mas, E., and Ballesta, A. M. (1991) Tumor Biol. 12, 360-367
  16. Liotta, L. A., Kleinerman, J., and Saidel, G. M. (1974) Cancer Res. 34, 997-1004[Abstract/Free Full Text]
  17. Silletti, S., Watanabe, H., Hogan, V., Nabi, I. R., and Raz, A. (1991) Cancer Res. 51, 3507-3511[Abstract/Free Full Text]
  18. Yoon, D. Y., Buchler, P., Saarikoski, S. T., Hines, O. J., Reber, H. A., and Hankinson, O. (2001) Biochem. Biophys. Res. Commun. 288, 882-886[CrossRef][Medline] [Order article via Infotrieve]
  19. Niizeki, H., Kobayashi, M., Horiuchi, I., Akakura, N., Chen, J., Wang, J., Hamada, J. I., Seth, P., Katoh, H., Watanabe, H., Raz, A., and Hosokawa, M. (2002) Br. J. Cancer 86, 1914-1919[CrossRef][Medline] [Order article via Infotrieve]
  20. Funasaka, T., Haga, A., Raz, A., and Nagase, H. (2002) Biochem. Biophys. Res. Commun. 293, 192-200[CrossRef][Medline] [Order article via Infotrieve]
  21. Chou, C. C., Sun, Y. J., Meng, M., and Hsiao, C. D. (2000) J. Biol. Chem. 275, 23154-23160[Abstract/Free Full Text]
  22. Jeffery, C. J., Bahnson, B. J., Chien, W., Ringe, D., and Petsko, G. A. (2000) Biochemistry 39, 955-964[CrossRef][Medline] [Order article via Infotrieve]
  23. Read, J., Pearce, J., Li, X., Muirhead, H., Chirgwin, J., and Davies, C. (2001) J. Mol. Biol. 309, 447-463[CrossRef][Medline] [Order article via Infotrieve]
  24. Tanaka, N., Haga, A., Uemura, H., Akiyama, H., Funasaka, T., Nagase, H., Raz, A., and Nakamura, K. T. (2002) J. Mol. Biol. 318, 985-997[CrossRef][Medline] [Order article via Infotrieve]
  25. Sun, Y. J., Chou, C. C., Chen, W. S., Wu, R. T., Meng, M., and Hsiao, C. D. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 5412-5417[Abstract/Free Full Text]
  26. Reiss, N., Kanety, H., and Schlessinger, J. (1986) Biochem. J. 239, 691-697[Medline] [Order article via Infotrieve]
  27. Sakakibara, R., and Uyeda, K. (1983) J. Biol. Chem. 258, 8656-8662[Abstract/Free Full Text]
  28. Hofer, H. W., Schlatter, S., and Graefe, M. (1985) Biochem. Biophys. Res. Commun. 129, 892-897[CrossRef][Medline] [Order article via Infotrieve]
  29. Kawamoto, R. M., and Caswell, A. H. (1986) Biochemistry 25, 657-661[Medline] [Order article via Infotrieve]
  30. Rose, Z. B., and Dube, S. (1976) J. Biol. Chem. 251, 4817-4822[Abstract/Free Full Text]
  31. Cooper, J. A., Esch, F. S., Taylor, S. S., and Hunter, T. (1984) J. Biol. Chem. 259, 7835-7841[Abstract/Free Full Text]
  32. Cai, G. Z., Callaci, T. P., Luther, M. A., and Lee, J. C. (1997) Biophys. Chem. 64, 199-209[CrossRef][Medline] [Order article via Infotrieve]
  33. Blair, J. B., Cimbala, M. A., and James, M. E. (1982) J. Biol. Chem. 257, 7595-7602[Free Full Text]
  34. Nettelblad, F. A., and Engstrom, L. (1987) FEBS Lett. 214, 249-252[CrossRef][Medline] [Order article via Infotrieve]
  35. Haga, A., Niinaka, Y., and Raz, A. (2000) Biochim. Biophys. Acta 1480, 235-244[CrossRef][Medline] [Order article via Infotrieve]
  36. Sali, A., and Blundell, T. L. (1993) J. Mol. Biol. 234, 779-815[CrossRef][Medline] [Order article via Infotrieve]
  37. Murshudov, G. N., Vagin, A. A., and Dodson, E. J. (1997) Acta Crystallogr. Sect. D Biol. Crystallogr. 53, 240-255[CrossRef][Medline] [Order article via Infotrieve]
  38. Lim, A. C., Tiu, S. Y., Li, Q., and Qi, R. Z. (2004) J. Biol. Chem. 279, 4433-4439[Abstract/Free Full Text]
  39. Elbashir, S. M., Harborth, J., Lendeckel, W., Yalcin, A., Weber, K., and Tuschl, T. (2001) Nature 411, 494-498[CrossRef][Medline] [Order article via Infotrieve]
  40. Gracy, R. W., and Tilley, B. E. (1975) Methods Enzymol. 41, 392-400[Medline] [Order article via Infotrieve]
  41. Repesh, L. A. (1989) Invasion Metastasis 9, 192-208[Medline] [Order article via Infotrieve]
  42. Albrecht-Buehler, G. (1977) Cell 12, 333-339[CrossRef][Medline] [Order article via Infotrieve]
  43. Haase, C., Stieler, J. T., Arendt, T., and Holzer, M. (2004) J. Neurochem. 88, 1509-1520[Medline] [Order article via Infotrieve]
  44. Kao, H. W., and Lee, S. C. (2002) Mol. Biol. Evol. 19, 367-374[Abstract/Free Full Text]
  45. Signarvic, R. S., and DeGrado, W. F. (2003) J. Mol. Biol. 334, 1-12[CrossRef][Medline] [Order article via Infotrieve]
  46. Warburg, O. (1956) Science 123, 309-314[Free Full Text]
  47. Flier, J. S., Mueckler, M. M., Usher, P., and Lodish, H. F. (1987) Science 235, 1492-1495[Abstract/Free Full Text]
  48. Johansson, T., Berrez, J. M., and Nelson, B. D. (1985) Biochem. Biophys. Res. Commun. 133, 608-613[CrossRef][Medline] [Order article via Infotrieve]
  49. Merkle, S., and Pretsch, W. (1993) Blood 81, 206-213[Abstract/Free Full Text]
  50. Smalheiser, N. R. (1996) Mol. Biol. Cell 7, 1003-1014[Abstract]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Cancer Res.Home page
T. Yanagawa, T. Funasaka, S. Tsutsumi, H. Hu, H. Watanabe, and A. Raz
Regulation of Phosphoglucose Isomerase/Autocrine Motility Factor Activities by the Poly(ADP-Ribose) Polymerase Family-14
Cancer Res., September 15, 2007; 67(18): 8682 - 8689.
[Abstract] [Full Text] [PDF]


Home page
J. Histochem. Cytochem.Home page
W. G. Jiang, A. Raz, A. Douglas-Jones, and R. E. Mansel
Expression of Autocrine Motility Factor (AMF) and Its Receptor, AMFR, in Human Breast Cancer
J. Histochem. Cytochem., February 1, 2006; 54(2): 231 - 241.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
280/11/10419    most recent
M409457200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yanagawa, T.
Right arrow Articles by Raz, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yanagawa, T.
Right arrow Articles by Raz, A.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2005 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement