Originally published In Press as doi:10.1074/jbc.M500028200 on January 13, 2005
J. Biol. Chem., Vol. 280, Issue 11, 10716-10720, March 18, 2005
CSX/Nkx2.5 Modulates Differentiation of Skeletal Myoblasts and Promotes Differentiation into Neuronal Cells in Vitro*
Ali M. Riazi
,
Haeyul Lee,
Christina Hsu, and
Glen Van Arsdell
From the
Division of Cardiovascular Surgery, Hospital for Sick Children, Toronto, M5G 1X8 Ontario, Canada
Received for publication, January 3, 2005
, and in revised form, January 13, 2005.
 |
ABSTRACT
|
|---|
CSX/Nkx2.5 transcription factor plays a pivotal role in cardiac development; however, its role in development and differentiation of other organs has not been investigated. In this study, we used C2C12 myoblasts and human fetal primary myoblasts to investigate the function of Nkx2.5 in skeletal myogenesis. The expression levels of Nkx2.5 decreased as C2C12 myoblasts elongated and fused to form myotubes. The expression of human NKX2.5 in C2C12 myoblasts inhibited myocyte differentiation and myotube formation, and up-regulated Gata4 and Tbx5 expression. The expression of NKX2.5 in terminally differentiated C2C12 myotubes resulted in a change in morphology and breakdown into smaller myotubes. Furthermore, overexpression of NKX2.5 in C2C12 cells and primary cultures of human fetal myoblasts led to differentiation of myoblasts into neuron-like cells and expression of neuronal markers. This study sheds light on the previously unknown non-cardiac functions of Nkx2.5 transcription factor.
 |
INTRODUCTION
|
|---|
The cardiac and skeletal muscle progenitor cells are derived from the mesoderm and are committed to their lineages early in embryogenesis. The molecular pathway(s) involved in differentiation of myocytes from their progenitor cells is not well understood. The transcription factor CSX/Nkx2.5, a vertebrate homolog of Drosophila Tinman, is one of the earliest determinants of the cardiac cell lineage and is detected mainly in cardiac progenitors and pharyngeal endoderm as early as 7.5 days post coitum (13). Recent findings have indicated that Nkx2.5 is essential for myocardial cell lineage specification and development of the cardiac conduction system (4, 5). The extracardiac expression and function of Nkx2.5 is controversial (2, 6). Nkx2.5 expression has been demonstrated in a subset of the cranial skeletal muscle, spleen, stomach, liver, tongue, and anterior larynx in addition to the heart (7) suggesting that Nkx2.5 might play a role in development of these organs. The homozygous deletion of Nkx2.5 in mice is lethal at the early stages of development because of defective looping of the heart tube (8), and therefore it has been difficult to study the function of Nkx2.5 in development of other organs as well as in the differentiation and maturation of cardiac myocytes. Notwithstanding its function in embryonic cardiac development, Nkx2.5 overexpression seems to be detrimental in postnatal cardiac myocyte and dramatically changes the cardiac cell structure and function (9). The transcriptional regulatory network governing the cardiac myocyte differentiation is not completely elucidated; however, it is known that Nkx2.5 physically interacts with other transcription factors such as GATA4 and Tbx5 to synergistically activate target cardiac-specific genes (1012).
The C2C12 myoblast cell line has been used extensively in the study of skeletal myogenesis (13). When cultured in the presence of growth factors, these myoblasts proliferate as mononucleated cells and express muscle regulatory factors such as MyoD and Myf-5. C2C12 myoblasts terminally differentiate into skeletal myocyte and fuse to form multinucleated myotubes when cultured to confluence and deprived of growth factors. A fraction of C2C12 cells (reserve cells, 2050% of cells) remain in a proliferating undifferentiated state. The expression of transcription factors myogenin and MRF-4 significantly increases as myoblasts elongate and fuse to form myotubes, whereas cell cycle-regulatory proteins such as cyclin A are down-regulated (14). Here we have investigated the expression of Nkx2.5 and its function in myogenesis and demonstrate that Nkx2.5 expression level is critical for myocyte differentiation and myotube formation. In addition, overexpression of Nkx2.5 in myoblasts results in expression of neuronal markers suggesting a role for this gene or a gene under Nkx2.5 regulation in neurogenesis.
 |
MATERIALS AND METHODS
|
|---|
Culturing C2C12 and Primary MyoblastsC2C12 cells were obtained from ATCC. Cells were normally cultured in growth medium, Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum and penicillin/streptomycin at 37 °C with 10% CO2. To allow cells to differentiate, medium was changed to Dulbecco's modified Eagle's medium supplemented with 2% horse serum. Approximately 70% of the cells differentiated and fused to form myotubes after 35 days in a routine experiment. Mouse and human fetal skeletal myoblast preparation was done according to a published protocol for mouse myoblast preparation (15) with some modifications. Approval of the institute ethics committee was obtained for collecting samples from terminated pregnancies. Approximately 70% of prepared myoblasts fused to form myotubes in Dulbecco's modified Eagle's medium supplemented with 1% serum. To isolate C2C12 myotubes, myoblasts were allowed to form myotubes in differentiation medium. The myotubes were detached by brief exposure to trypsin (0.05% + EDTA) and were passed through a 100-µm filter and seeded at 24 myotubes/mm2 on a gridded 35-mm dish. The next day the cells were briefly treated with distilled H2O to remove the contaminating myoblasts and maintained in media containing 2% horse serum.
Adenoviral Expression of NKX2.5To express NKX2.5 from adenovirus, AdEasy adenoviral expression system was obtained from Stratagene. Human NKX2.5 (accession number: BC025711
[GenBank]
) cDNA was amplified from fetal heart RNA (Clontech) using primers AGACTGGTCGACTGCCACCATGTTCC and AGAGTCAGGGATCCTAGTTGAGGTG, digested with SalI and BamHI and cloned into the AdTrack-CMV vector (Invitrogen) in forward or reverse orientations. Manufacturer's instructions were followed for virus production. Adenoviral titers and multiplicity of infection (MOI)1 were estimated in human embryonic kidney-293 cells by counting the number of GFP+ cells, 24 h after infection. The recombinant adenoviruses were used at 220 MOI for primary and C2C12 myoblasts and at
200 MOI to infect myotubes.
Cell Cycle AnalysisThe standard method for cell cycle analysis using DNA staining by propidium iodide was used. Briefly, cells were fixed in 70% ethanol, rinsed with phosphate-buffered saline, stained with 50 µg/ml propidium iodide, and analyzed by fluorescence-activated cell sorter.
Real Time RT-PCRTotal RNA was prepared using TRIzol solution (Invitrogen) and reverse transcribed using SuperScript II (Invitrogen). For real time PCR analysis either TaqMan assay (assay-on-demand for mouse myogenin and Nkx2.5, Applied Biosystems) or SYBR Green (for Tbx5, Gata4) was used. Data were analyzed by relative quantitation method using standard curve. The following sets of primers were used for SYBR Green real time assay or in one-step RT-PCR (kit from Qiagen) analysis: Nkx2.5, GGCGTCGGGGACTTGAACACC, CGCACTCACTTTAATGGGAAG; Gata4, CTTGAGGCATGGCACATCTCTGCA, TAATGGTGGGAGATGGGAA; Tbx-5, GCAGGGCCTGAGTACCTCTT, GGCTGATGGGCCACTGAGGT; myogenin, CACTCCCTTACGTCCATCGTG, CGGCAGCTTTACAAACAACAC; glyceraldehyde-3-phosphate dehydrogenase, TCCACCACCCTGTTGCTGTAG, GACCACAGTCCATGCCATCACT; and synapsin-I, GCAACGGAGACTACCGCAGTTTG, TTGTCTTCATCCTGGTGGTCACC. PCR conditions for all the primers were 94 °C for 15 s, 58 °C for 30 s, and 72 °C for 1s for 2630 cycles.
Immunofluorescence, Immunoprecipitation, and Western Analysis MyHC antibody (MF-20) was obtained from the Developmental Studies Hybridoma Bank developed under the auspices of the NICHD, National Institutes of Health and maintained by the University of Iowa, Iowa City, IA. Other antibodies were purchased. Nkx2.5, MyoD, p21, p27, and cyclin A were purchased from Santa Cruz, myogenin was purchased from Pharmingen, nestin and NeuN were purchased from Chemicon, and BrdUrd antibody was from Pharmingen. Immunofluorescence and Western blot analysis were performed according to standard procedure. Immunoprecipitation of Nkx2.5 was performed using 400 µg of whole cell lysates and 1 µg of anti Nkx2.5 antibody.
Statistical AnalysisResults are expressed as mean ± S.D. unless otherwise indicated. Statistical significance was determined by oneway analysis of variance. p < 0.05 was used to determine a significant difference.
 |
RESULTS
|
|---|
We examined the expression of Nkx2.5 and myogenin in C2C12 cells at different stages of differentiation using real time RT-PCR. RNA was prepared from C2C12 cells at day -1 (subconfluent), and at days 0 (100% confluent), 1, and 3 after the culture medium was changed to differentiation medium. The cells started to elongate at day 1, and multinucleated myotubes appeared at day 3 (not shown). Fig. 1A demonstrates a real time analysis of Nkx2.5 and myogenin RNA. The Nkx2.5 RNA level in differentiated C2C12 cells declined to about 25% of its level in the undifferentiated cells. However, myogenin was highly up-regulated (by
45-fold) as cells differentiated and fused (days 13). Accordingly, the Nkx2.5 protein was also reduced as cells underwent differentiation (Fig. 1B). Immunostaining with Nkx2.5 antibody revealed expression throughout nuclei and cytoplasm, which was absent in human umbilical cord endothelial cell culture negative control (not shown).

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 1. Expression of Nkx2.5 in skeletal myoblasts and myocytes. A, graphical representation of real time RT-PCR analysis of Nkx2.5 and myogenin (Myog) expression in C2C12 cells at day -1 (subconfluent) and days 0, 1, and 3 (d-1, d0, d1, and d3, respectively) after culturing in differentiation media. The Nkx2.5 RNA level significantly declined in d3 compared with d-1 (d3, 0.15 ± 0.1; d-1, 0.63768 ± 0.3; *, p = 0.041, n = 5). Myogenin was up-regulated 45-fold (d-1, 0.030 ± 0.03 versus d3, 1.406 ± 0.6, **, p = 0.003, n = 5). The changes in expression of Nkx2.5 and myogenin were also demonstrated using RT-PCR (lower panel). B, Western blot analysis of immunoprecipitated Nkx2.5 protein at various differentiation time points. Lower band indicates cross-reaction to immunoglobulin light chain.
|
|
We evaluated the role of Nkx2.5 in myocyte differentiation by overexpressing human NKX2.5 in C2C12 cells from an adenovirus. The human and mouse Nkx2.5 proteins (accession numbers BC025711
[GenBank]
and X75415
[GenBank]
, respectively) are 87% identical (using BLAST program) and therefore expected to have fundamental properties in common. Expression of Nkx2.5 in C2C12 myoblasts and human fetal skeletal myoblasts completely blocked the formation of myotubes, as no myosin heavy chain (MyHC) protein was detected in the cells cultured for 4 days in differentiation media (Fig. 2A) indicating that Nkx2.5 modulates skeletal myogenesis.

View larger version (54K):
[in this window]
[in a new window]
|
FIG. 2. NKX2.5-expressing myoblasts do not form myotubes. A, C2C12 cells (a and b) and human primary fetal myoblasts (c and d) were transduced with either human NKX2.5 and/or GFP-expressing adenoviruses. No MyHC+ myocyte or myotubes were detected in cells expressing NKX2.5 (a and c) after 2 days of culture in differentiation medium, whereas cells expressing GFP (b and d) differentiated into myotubes expressing MyHC. B, Western blot analysis of C2C12 cells exposed to adenovirus expressing GFP (lanes 1 and 3) and NKX2.5 (lanes 2 and 4) either at 24 h post-treatment in growth medium (lanes 1 and 2) or additional 24 h culture in differentiation medium (lanes 3 and 4). CDK-inhibitors, p21 and p27 were significantly increased, whereas the amount of MyoD and cyclin A was reduced in NKX2.5-expressing cells (lane 2). Myogenin protein was not detected in NKX2.5-expressing cells. The Western blots were immunoblotted for glyceraldehyde-3-phosphate dehydrogenase (GAPDH) for loading control. C, cell cycle analysis of control and adenovirus-treated C2C12 cells. The percentage of cells in S phase was reduced in NKX2.5-expressing cells 24 h post-treatment (5.125 ± 0.81 versus 10.95 ± 1.23% in the GFP-expressing cells). D, real time PCR analysis of Tbx5 and Gata4 RNA levels in GFP or NKX2.5-expressing C2C12 cells. Cells were exposed to increasing amounts of NKX2.5 and/or GFP adenovirus (5, 10, and 20 MOI). Gata4 RNA level was significantly increased in cells treated with 5 MOI of NKX2.5-adenovirus (6.5 ± 1.6 versus 4.36 ± 0.3 in GFP controls; *, p = 0.012, n = 6), while it was down-regulated in cells treated with 20 MOI of NKX2.5-adenovirus (3.6 ± 0.4 versus 4.36 ± 0.3 in the control; **, p = 0.007, n = 6). Tbx5 RNA level showed a similar pattern of expression, but the difference was not statistically significant.
|
|
The expression levels of myogenin, MyoD, cyclin-dependent kinase inhibitors, p21 (Cip1) and p27 (Kip1), and cyclin A were also examined in the C2C12 cells overexpressing NKX2.5 in growth- and differentiation-promoting conditions. Overexpression of NKX2.5 in C2C12 cells lowered the level of MyoD and blocked the expression of myogenin. Concomitantly, p21 and p27 were significantly up-regulated in NKX2.5-expressing cells, whereas cyclin A was reduced (Fig. 2B). Furthermore, cells treated with adenovirus expressing NKX2.5 and/or GFP were analyzed with fluorescence-activated cell sorter for cell cycle analysis. As shown in Fig. 2C the percentage of cells in S phase was reduced by
2-fold in cultures treated with NKX2.5-expressing adenovirus after 24 h (5.125 ± 0.81% in NKX2.5-overexpressing cells versus 10.95 ± 1.23% in the GFP-expressing cells).
The expression levels of transcription factor genes, Gata4 and Tbx5 were evaluated in C2C12 cells treated with increasing amounts of NKX2.5 adenovirus, using real time PCR. Both Gata4 and Tbx5 were slightly up-regulated when cells were treated with low concentrations of the adenovirus (Fig. 2D); however, higher concentrations of the adenovirus and therefore higher level of NKX2.5 expression resulted in the down-regulation of these genes. The C2C12 cells overexpressing NKX2.5 did not express cardiac-specific cell markers ANF and cTnI as examined by RT-PCR (not shown).
C2C12 and human fetal myoblasts overexpressing NKX2.5 demonstrated a change in morphology 23 days after treatment, and displayed small, spherical, and refractive cell bodies with long cellular processes (Fig. 3, a and b) compared with normal myoblast morphology in GFP-vector-treated control cells (Fig. 3c). The majority of NKX2.5-expressing C2C12 cells were positive for the immature neuronal cell marker, nestin, 35 days post-treatment (Fig. 3, di). Nestin was also detected in differentiated myocytes and myotubes in control cells (not shown). In addition, a number of cells with neuronal morphology expressed NeuN (Fig. 3, jl), whereas no glial fibrillary acidic protein-positive cells were detected by immunofluorescence suggesting that the majority of cells were acquiring neuronal and not glial cell characteristics. Furthermore, NKX2.5-transduced C2C12 and primary human myoblasts expressed synapsin I, a protein found in the nerve terminals and known to play a role in axonogenesis and synaptogenesis (16) (Fig. 3m). The level of synapsin-I expression in NKX2.5-expressing fetal myoblasts was similar to the RNA level detected in a fetal mouse brain (Fig. 3m, lanes 4 and 6).

View larger version (51K):
[in this window]
[in a new window]
|
FIG. 3. NKX2.5-expressing myoblasts acquire neuronal characteristics. C2C12 (a) and human fetal primary myoblasts (b) demonstrate a neuronal morphology after treatment with Nkx2.5-expressing adenovirus for 35 days in culture. Human fetal myoblasts transduced with the control adenoviral vector did not demonstrate a change in morphology. Cells expressing NKX2.5 from adenovirus (in green) express the immature neuronal marker, nestin (in red) (df). Nuclei were stained with DAPI and are indicated in blue (g). Nestin is expressed in cells demonstrating a neuronal shape (h), whereas nestin-expressing cells were hardly detected in vector-transduced C2C12 cells (i). Approximately 5% of C2C12 cells expressing NKX2.5 demonstrated NeuN (a mature neuronal marker) in their nuclei (jl, blue represents DAPI, and red represents NeuN) 35 days post-treatment, whereas no NeuN expression was detected in the control (not shown). RT-PCR analysis indicates expression of synapsin I in C2C12 and fetal skeletal myoblasts transduced with AdNKX2.5 (m). Lanes 16 represent RT-PCR with 0.5 µg of total RNA from C2C12-AdGFP, C2C12-AdNKX2.5, adult mouse brain, fetal (15 days post coitum) mouse brain, human fetal myoblasts-AdXKN (human NKX2.5 in reverse orientation), human fetal myoblasts-AdNKX2.5, respectively.
|
|
To further investigate the function of Nkx2.5 in myogenesis we transduced C2C12 myotubes with NKX2.5-expressing adenovirus. The myotubes, normally expressing a lower level of Nkx2.5, changed morphology and produced a bead-on-a-string appearance. Two to three days after cells were transduced with NKX2.5-adenovirus, the nuclei were positioned into separate clusters of several or sometimes single nuclei, and the sarcomeric proteins (MyHC and
-actinin) started to disappear from the cytoplasm of the myotubes (Fig. 4A). Later, constrictions appeared throughout the length of the myotubes and finally smaller myotubes or mononucleated myoblasts were separated (Fig. 4A). Almost 100% of the myotubes expressing NKX2.5 showed the morphological change, whereas a similar phenotype was rarely seen in myotubes in the control plate. To evaluate the mitotic ability of the myotubes, C2C12 myotubes were isolated, separated from myoblasts, and seeded at low density on a gridded plate before being infected with NKX2.5-expressing adenovirus. Cell cultures were then treated with BrdUrd and the number of cells undergoing DNA synthesis was evaluated using anti-BrdUrd antibody. The number of BrdUrd+ cells did not seem to significantly differ in NKX2.5-transduced cells under conditions used (Fig. 4B).

View larger version (41K):
[in this window]
[in a new window]
|
FIG. 4. Myotubes treated with NKX2.5 adenovirus demonstrated an altered morphology. A, nuclei of the myotubes treated with NKX2.5-adenovirus were positioned in clusters (b, indicated with arrows) compared with a normal nuclei arrangement in cells treated with adenoviral GFP vector (a), 23 days after treatment. Myotubes were immunostained for MyHC. There was no detectable MyHC in NKX2.5 adenovirus-treated multinucleated myotubes (d) compared with control myotubes (c) 1 week after treatment, using immunofluorescence staining for MyHC (in red). Nuclei were stained with DAPI, indicated in blue. The isolated myotubes treated with adenovirus expressing NKX2.5 divide into smaller myotubes (indicated by arrows) after 34 days in culture (e). B, myotubes expressing either NKX2.5 and GFP or just GFP were cultured for 5 days and treated with BrdUrd for 24 h in growth media and stained with anti-BrdUrd antibody. The number of BrdUrd+ myotubes were counted from a total of 500 myotubes and plotted. An example of a myotube expressing GFP and undergoing DNA synthesis is also shown. Arrowhead indicates a BrdUrd+ myotube.
|
|
 |
DISCUSSION
|
|---|
Nkx2.5 is one of the earliest genes expressed in cardiac mesoderm during development and functions in association with other transcription factors such as GATA4, Tbx5, and MEF2C (3, 17) to initiate cardiac muscle differentiation. The expression of Nkx2.5 in cranial muscle and tongue in addition to the heart has been reported previously (7). In this study we discovered a previously unknown function of Nkx2.5 in skeletal myogenesis. Our results clearly contradict a report suggesting the absence of Nkx2.5 expression in C2C12 cells (2). We used real time PCR and Western blot analysis to show expression of Nkx2.5 RNA and protein in C2C12 cells. Furthermore, we demonstrated that Nkx2.5 expression levels corresponded to the differentiation status of the skeletal myoblasts.
The adenoviral expression of NKX2.5 in myoblasts prevented the differentiation into myocytes and formation of myotubes. The levels of myogenic transcription factors, MyoD and myogenin, were markedly reduced in the NKX2.5-expressing cells. In addition, C2C12 cells expressing NKX2.5 demonstrated a marked increase in cyclin-dependent kinase inhibitors, p21 and p27, a reduction in cyclin A, and cell cycle block at G1/S transition. Previous studies have indicated that cell cycle withdrawal and differentiation of myoblasts is accompanied with expression of p21 and p27 and down-regulation of cyclin A (14, 1820). The changes in expression of these regulatory proteins might partially explain cell cycle withdrawal and differentiation of NKX2.5-expressing cells into a non-myocyte lineage.
Expression of human NKX2.5 was not sufficient for transdifferentiating C2C12 myoblasts into cardiac myocytes as cells did not express cardiac myocyte markers, ANF and cTnI. However, it did result in the up-regulation of Gata4 and Tbx5 transcription factor genes that are highly expressed during heart development. Our findings support the previous reports of regulation of Tbx5 by Nkx2.5 (21, 22). A higher level of expression of NKX2.5 resulted in down-regulation of Gata4 and Tbx5. This may indicate differentiation of myoblasts into cells with non-myocyte characteristics.
Forced expression of NKX2.5 in myoblasts resulted in a change in morphology and expression of neuronal markers indicating that either Nkx2.5 or a gene(s) under its regulation is responsible for reprogramming myoblasts into neuron-like cells in vitro. The expression of Nkx2.5 has not been reported in the nervous system. However, genes such as Pax7 and TrkC receptor that are involved in neurogenesis have potential Nkx2.5 binding sites in their promoters (23, 24). Interestingly, Nkx2.5, TrkC, and its ligand neurotrophin-3 are all expressed in developing a conduction system of the heart (25). It is believed that neuronal genes such as neurofilaments are expressed in the cardiac conduction system myocytes (26), and therefore these findings could represent the differentiation of skeletal myoblasts into cells with characteristics of cardiac conduction cells. Furthermore, in this study we have demonstrated that increased expression of NKX2.5 in myotubes, normally expressing low levels of Nkx2.5, leads to degradation of the sarcomere and division of myotubes into smaller myotubes. The apparent division of myotubes overexpressing NKX2.5 may represent dedifferentiation; however, the assessment of the potential of regenerated cells to differentiate into myoblasts or other cell types was not possible using our adenoviral expression system, because the majority of treated myotubes died after a few days in culture. Similarly an alteration of sarcomere structure and down-regulation of connexin 40 and 43 has been reported when Nkx2.5 is overexpressed in neonatal cardiomyocytes (9). In this study, there was no increase in BrdUrd incorporation in myotubes expressing Nkx2.5. We speculate that the activation of other regulatory genes is needed in order for the cells to re-enter the cell cycle. Reprogramming myotubes into myoblasts has been achieved by overexpressing a homeodomain-containing transcription factor, Msx-1 (27) and by exposing cells to myoseverin, a microtubule-binding purine in vitro (28). A relationship between Nkx2.5 overexpression and up-regulation of Msx-1 in myoblasts remains to be studied. A cDNA microarray analysis is now underway to study the genes under Nkx2.5 regulation in skeletal myoblast.
In conclusion, this study describes a hitherto unknown function of the transcription factor Nkx2.5 as a differentiation factor in skeletal myogenesis and neurogenesis. These findings may have future applications in regeneration of terminally differentiated muscle and neurons using myoblasts.
 |
FOOTNOTES
|
|---|
* This work was supported by a grant from the Hospital for Sick Children Foundation (to G. V. A.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. 
To whom correspondence should be addressed: Division of Cardiovascular Research, Rm. 7017, McMaster Bldg., The Hospital for Sick Children, 555 University Ave., Toronto, M5G 1X8 Ontario, Canada. Tel.: 416-813-8202; Fax: 416-813-7480; E-mail: ali.riazi{at}sickkids.ca.
1 The abbreviations used are: MOI, multiplicity of infection; GFP, green fluorescent protein; RT, reverse transcription; MyHC, myosin heavy chain; BrdUrd, bromodeoxyuridine; DAPI, 4',6-diamidino-2-phenylindole. 
 |
REFERENCES
|
|---|
- Evans, S. M. (1999) Semin. Cell Dev. Biol. 10, 73-83[CrossRef][Medline]
[Order article via Infotrieve]
- Lints, T. J., Parsons, L. M., Hartley, L., Lyons, I., and Harvey, R. P. (1993) Development (Camb.) 119, 419-431[Abstract]
- Bruneau, B. G. (2002) Circ. Res. 90, 509-519[Abstract/Free Full Text]
- Pashmforoush, M., Lu, J. T., Chen, H., Amand, T. S., Kondo, R., Pradervand, S., Evans, S. M., Clark, B., Feramisco, J. R., Giles, W., Ho, S. Y., Benson, D. W., Silberbach, M., Shou, W., and Chien, K. R. (2004) Cell 117, 373-386[CrossRef][Medline]
[Order article via Infotrieve]
- Jay, P. Y., Harris, B. S., Maguire, C. T., Buerger, A., Wakimoto, H., Tanaka, M., Kupershmidt, S., Roden, D. M., Schultheiss, T. M., O'Brien, T. X., Gourdie, R. G., Berul, C. I., and Izumo, S. (2004) J. Clin. Investig. 113, 1130-1137[CrossRef][Medline]
[Order article via Infotrieve]
- Komuro, I., and Izumo, S. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 8145-8149[Abstract/Free Full Text]
- Kasahara, H., Bartunkova, S., Schinke, M., Tanaka, M., and Izumo, S. (1998) Circ. Res. 82, 936-946[Abstract/Free Full Text]
- Tanaka, M., Chen, Z., Bartunkova, S., Yamasaki, N., and Izumo, S. (1999) Development (Camb.) 126, 1269-1280[Abstract]
- Kasahara, H., Ueyama, T., Wakimoto, H., Liu, M. K., Maguire, C. T., Converso, K. L., Kang, P. M., Manning, W. J., Lawitts, J., Paul, D. L., Berul, C. I., and Izumo, S. (2003) J. Mol. Cell Cardiol. 35, 243-256[CrossRef][Medline]
[Order article via Infotrieve]
- Sepulveda, J. L., Vlahopoulos, S., Iyer, D., Belaguli, N., and Schwartz, R. J. (2002) J. Biol. Chem. 277, 25775-25782[Abstract/Free Full Text]
- Monzen, K., Shiojima, I., Hiroi, Y., Kudoh, S., Oka, T., Takimoto, E., Hayashi, D., Hosoda, T., Habara-Ohkubo, A., Nakaoka, T., Fujita, T., Yazaki, Y., and Komuro, I. (1999) Mol. Cell. Biol. 19, 7096-7105[Abstract/Free Full Text]
- Hiroi, Y., Kudoh, S., Monzen, K., Ikeda, Y., Yazaki, Y., Nagai, R., and Komuro, I. (2001) Nat. Genet. 28, 276-280[CrossRef][Medline]
[Order article via Infotrieve]
- Andres, V., and Walsh, K. (1996) J. Cell Biol. 132, 657-666[Abstract/Free Full Text]
- Wang, J., and Nadal-Ginard, B. (1995) Biochem. Biophys. Res. Commun. 206, 82-88[CrossRef][Medline]
[Order article via Infotrieve]
- Springer, M. L., and Blau, H. M. (1997) Somatic Cell Mol. Genet. 23, 203-209[Medline]
[Order article via Infotrieve]
- Chin, L. S., Li, L., Ferreira, A., Kosik, K. S., and Greengard, P. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 9230-9234[Abstract/Free Full Text]
- Skerjanc, I. S., Petropoulos, H., Ridgeway, A. G., and Wilton, S. (1998) J. Biol. Chem. 273, 34904-34910[Abstract/Free Full Text]
- Missero, C., Calautti, E., Eckner, R., Chin, J., Tsai, L. H., Livingston, D. M., and Dotto, G. P. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 5451-5455[Abstract/Free Full Text]
- Guo, K., Wang, J., Andres, V., Smith, R. C., and Walsh, K. (1995) Mol. Cell. Biol. 15, 3823-3829[Abstract]
- Frith-Terhune, A., Koh, K. N., Jin, W. J., Chung, K. B., Park, S. K., and Koh, G. Y. (1998) Mol. Cell 8, 637-646
- Sun, G., Lewis, L. E., Huang, X., Nguyen, Q., Price, C., and Huang, T. (2004) J. Cell. Biochem. 92, 189-199[CrossRef][Medline]
[Order article via Infotrieve]
- Schwartz, R. J., and Olson, E. N. (1999) Development (Camb.) 126, 4187-4192[Abstract]
- Syagailo, Y. V., Okladnova, O., Reimer, E., Grassle, M., Mossner, R., Gattenlohner, S., Marx, A., Meyer, J., and Lesch, K. P. (2002) Gene (Amst.) 294, 259-268[CrossRef][Medline]
[Order article via Infotrieve]
- Ichaso, N., Rodriguez, R. E., Martin-Zanca, D., and Gonzalez-Sarmiento, R. (1998) Oncogene 17, 1871-1875[CrossRef][Medline]
[Order article via Infotrieve]
- Hiltunen, J. O., Arumae, U., Moshnyakov, M., and Saarma, M. (1996) Circ. Res. 79, 930-939[Abstract/Free Full Text]
- Vitadello, M., Vettore, S., Lamar, E., Chien, K. R., and Gorza, L. (1996) J. Mol. Cell Cardiol. 28, 1833-1844[CrossRef][Medline]
[Order article via Infotrieve]
- Odelberg, S. J., Kollhoff, A., and Keating, M. T. (2000) Cell 103, 1099-1109[CrossRef][Medline]
[Order article via Infotrieve]
- Rosania, G. R., Chang, Y. T., Perez, O., Sutherlin, D., Dong, H., Lockhart, D. J., and Schultz, P. G. (2000) Nat. Biotechnol. 18, 304-308[CrossRef][Medline]
[Order article via Infotrieve]

CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
M. Honda, F. Masui, N. Kanzawa, T. Tsuchiya, and T. Toyo-oka
Specific knockdown of m-calpain blocks myogenesis with cDNA deduced from the corresponding RNAi
Am J Physiol Cell Physiol,
April 1, 2008;
294(4):
C957 - C965.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2005 by the American Society for Biochemistry and Molecular Biology.