Originally published In Press as doi:10.1074/jbc.M412370200 on January 6, 2005
J. Biol. Chem., Vol. 280, Issue 12, 10974-10980, March 25, 2005
Furin Directly Cleaves proMMP-2 in the trans-Golgi Network Resulting in a Nonfunctioning Proteinase*
Jian Cao
,
Alnawaz Rehemtulla¶,
Maria Pavlaki
,
Pallavi Kozarekar
, and
Christian Chiarelli||
From the
Department of Medicine, School of Medicine, State University of New York at Stony Brook, Stony Brook, New York 11794, the ¶Department of Radiation Oncology, University of Michigan, Ann Arbor, Michigan 48109 and the ||Department of Research, Veterans Affairs Medical Center, Northport, New York 11768
Received for publication, December 2, 2004
, and in revised form, January 5, 2005.
 |
ABSTRACT
|
|---|
Proprotein convertases play an important role in tumorigenesis and invasiveness. Here, we report that a dibasic amino acid convertase, furin, directly cleaves proMMP-2 within the trans-Golgi network leading to an inactive form of matrix metalloproteinase-2 (MMP-2). Co-transfection of COS-1 cells with both proMMP-2 and furin cDNAs resulted in the cleavage of the N-terminal propeptide of proMMP-2. The molecular mass of cleaved MMP-2 (63 kDa), detected in both cell lysates and conditioned medium, is between the intermediate and fully activated forms of MMP-2 induced by membrane type 1-MMP. Furin-cleaved MMP-2 does not possess proteolytic activity as examined in a cell-free assay. Treatment of transfected cells with a furin inhibitor resulted in a dose-dependent inhibition of proMMP-2 cleavage; recombinant tissue inhibitor of metalloproteinase-2, which binds to the active site of membrane type 1-MMP, had no inhibitory effect. Site-directed mutagenesis of amino acids in the furin consensus recognition motif of proMMP-2(R69KPR72
) prevented propeptide cleavage, thereby identifying the scissile bond and characterizing the basic amino acids required for cleavage. Other experimental observations were consistent with intracellular furin cleavage of proMMP-2 in the trans-Golgi network. The furin cleavage site in other proMMPs was examined. MMP-3, which contains the RXXR furin consensus sequence, was cleaved in furin co-transfected cells, whereas MMP-1, which lacks an RXXR consensus sequence, was not cleaved. In conclusion, we report the novel observation that furin can directly cleave the RXXR amino acid sequence in the propeptide domain of proMMP-2 leading to inactivation of the enzyme.
 |
INTRODUCTION
|
|---|
Matrix metalloproteinases (MMPs)1 are an important family of zinc- and calcium-dependent proteinases that degrade extracellular matrix components and numerous other proteins. MMPs are implicated in physiological and pathological processes related to extracellular matrix turnover, including wound healing, angiogenesis, tumor invasion, and metastasis (1). MMP-2 (gelatinase A, 72-kDa type IV collagenase) appears to be especially important in tumor invasion and metastasis because of its ability to degrade basement membrane type IV collagen (2).
All MMPs are synthesized as preproenzymes, and most of them are secreted from cells as proenzymes consisting of a propeptide, a catalytic domain, a hinge region, and a hemopexin-like domain; MMP-7, -23, -26, and membrane-type matrix metalloproteinases (MT-MMPs) are exceptions (1, 3). The zymogens of most MMPs are activated through a two-step activation mechanism. Activator proteinases, such as trypsin or plasmin or organomercurial chemical treatment, first attack the proteinase-susceptible "bait" region located in the middle of the propeptide domain (4, 5). This cleavage induces conformational changes in the propeptide and renders the final activation site to be readily cleaved by a second proteolysis. The latter reaction is usually an intermolecular autocatalytic event (6).
In contrast to other secreted MMPs, proMMP-2 is physiologically activated on the cell surface through a MT-MMP-dependent mechanism (7). Stoichiometric binding of TIMP-2 to the catalytic site of MT1-MMP on the cell surface, followed by the binding of the C-terminal domain of proMMP-2 to the C terminus of TIMP-2, results in a trimolecular complex. A second TIMP-2-free MT1-MMP molecule on the cell surface then cleaves proMMP-2, leaving highly focused active MMP-2 available for efficient substrate degradation and participation in other events (8). The initial cleavage of proMMP-2 by MT1-MMP occurs at the Asn37Leu38 bond forming an intermediate (64-kDa form identified by gelatin zymography), which is followed by an intermolecular autocleavage of the Asn80Tyr81 bond to generate a 62-kDa fully activated form (9, 10). Although much attention has been focused on the cell surface activation process of proMMP-2, intracellular cleavage of proMMP-2 has been documented (11). Furin, one of seven proprotein convertases, has been implicated in the MMP-2 activation mechanism. Furin cleaves proMT1-MMP at the R108RKR111 furin consensus sequence, leading to activation of MT1-MMP (12).
Furin is a subtilisin-like serine endoprotease that cleaves neuropeptides, receptors, growth factors, cell surface glycoproteins, and enzymes on the C-terminal side of the consensus sequence -Arg-X-Lys/Arg-Arg
-(RX(K/R)R) in the trans-Golgi network (TGN) (13, 14). Arg residues at the P1 and P4 positions of the cleavage site are essential, whereas the P2 basic amino acid is not but serves to enhance processing efficiency. Therefore, RXXR represents the minimal furin cleavage site. Favorable residues at P2 and P6 can compensate for less favorable ones at position P4 (15). Furin is a type I membrane protein localized to the TGN, a late Golgi structure that is responsible for sorting secretory pathway proteins to their final destinations, including the cell surface, endosomes, lysosomes, and secretory granules (16). The steady-state localization of furin to the TGN has led to the supposition that this endoprotease cleaves proprotein substrates in this compartment (17). Furin has also been reported to form a naturally truncated and, hence, secreted form called shed furin, which exhibits functional activity even though it lacks the transmembrane domain and the cytoplasmic tail (18, 19).
In studies designed to further characterize the role of furin in MT1-MMP-induced proMMP-2 activation, we observed that co-transfection of furin cDNA along with proMMP-2 cDNA in COS-1 cells resulted in cleavage of proMMP-2. This result was surprising because COS-1 cells express negligible amounts of MT1-MMP and are unable to activate proMMP-2 in the absence of transfection with MT1-MMP cDNA (20). This observation led us to carry out additional experiments, which demonstrated that furin directly cleaves proMMP-2 in the TGN, resulting in cell secretion of a non-proteolytic enzyme.
 |
MATERIALS AND METHODS
|
|---|
ReagentsBrefeldin A, a reagent that causes a distortion in intracellular protein traffic from the endoplasmic reticulum (ER) to the Golgi apparatus (21), was purchased from Molecular Probes, Inc. (Eugene, OR). Fluorescence-quenched peptide substrate (Mca-Pro-Leu-Gly-Leu-Dpa-Ala-Arg-NH2) and decanoyl-Arg-Val-Lys-Arg-chloromethylketone (Dec-RVKR-cmk), a furin inhibitor containing a consensus furin cleavage sequence, was purchased from Bachem Bioscience Inc. (King of Prussia, PA). The pcDNA3 expression vector and oligonucleotide primers were purchased from Invitrogen. DNA restriction enzymes and the pSG5 expression vector were purchased from Stratagene (La Jolla, CA). Recombinant proMMP-2 was produced by COS-1 cells transfected with proMMP-2 cDNA and purified as described previously (22). Rabbit anti-human furin antibody has been described previously (23). Rabbit anti-human MT1-MMP (hinge region) antibody was purchased from Triple Point Biologics (Portland, OR). Rabbit anti-human MMP-1 (collagenase-1) and MMP-3 (stromelysin-1) antibodies were kindly provided by Dr. Hideaki Negase (Imperial College, London, UK). Mouse anti-human MMP-2 antibody was purchased from Oncogene Research Products (Cambridge, MA). MT1-MMP, MMP-2, TIMP-2, and
1-antitrypsin Pittsburgh mutant (
1-PI, an inhibitor of furin), wild-type, soluble, and dominant negative furin (furinS
A) cDNAs were described previously (19, 20, 22). CT-1847, a hydroxamic acid-derived broad-spectrum inhibitor of MMPs, was kindly provided by A. J. P. Docherty (Celltech, Slough, UK).
Cell Culture and TransfectionCOS-1 cells were maintained in Dulbecco's modified Eagle's medium (Invitrogen) containing 10% fetal bovine serum (Atlanta Biologicals) and 2 mM glutamine, 100 units/ml penicillin, and 100 µg/ml streptomycin under a 5% CO2 atmosphere. Plasmids were transfected into cells using the calcium phosphate method as described previously (20). Conditioned media were harvested after an 18-h incubation of COS-1 cells at 37 °C in serum-free media.
Construction of PlasmidsMMP-1 and MMP-3 cDNAs were kindly provided by Dr. Chitra Biswas (Tufts University School of Medicine) and subcloned into the pcDNA3 expression vector. The truncated proMMP-2 cDNA, designated as proMMP-2
C, which lacks the entire hinge and hemopexin-like domains of MMP-2 (from Ala418 to Cys631) was constructed by introducing a stop codon into Ala418. In brief, a PCR fragment encoding for the signal, propeptide, and catalytic domains of proMMP-2 was amplified using the proMMP-2/pcDNA3 vector as template with a forward T7 primer, which annealed with a T7 promoter sequence in the pcDNA3 vector (5' to 3': AATACGACTCACTATAG) and the reverse primer (5' to 3': AAGGATCCCTACCCATAGAGCTCCTGAATGC 3'). The resulting PCR fragments containing EcoRI and BamHI sites were then cloned into the pcDNA3 expression vector.
To examine the potential furin cleavage site in proMMP-2, a mutant proMMP-2 with arginine 69 substituted by the neutral amino acid alanine (MMP-2R69
A), was constructed by an overlap extension mutagenesis approach using a two-step PCR as described previously (22). The mutagenic reverse primer (5' to 3': GTTGCCGCAGCGTGGCTTCGCCATGG TCTCGAT) (underlined nucleotides indicate the altered codon) was paired with a forward T7 primer to generate the N-terminal portion fragment carrying the desired mutation by employing the PCR using the proMMP-2/pcDNA3 template. Another PCR fragment encoding the C-terminal region of proMMP-2 (Lys70Cys631) was generated by amplifying the proMMP-2 cDNA template with the forward primer (5' to 3': AAGCCACGCTGCGGCAACCCA), which partially complemented the mutated N-terminal proMMP-2 fragment generated above, and the reverse primer Sp6, which recognizes the Sp6 promoter sequence in the pcDNA3 vector (5' to 3': GTGACACTATAGAAT). Finally, PCR amplification using the T7 forward primer and the Sp6 reverse primer was employed to generate full-length mutant proMMP-2, and the resulting fragment was cloned into the pSG5 expression vector driven by an SV40 promoter. The cloning junction and mutant sequences in all mutants were confirmed by DNA sequencing as described previously (22).
Immunofluorescent Staining and Confocal MicroscopyCells transfected with proMMP-2 cDNA and furin cDNA were grown on glass coverslips to 60% confluence and fixed for 10 min at 4 °C in 3.7% paraformaldehyde in phosphate-buffered saline (PBS) followed by permeabilization with 0.1% Nonidet P-40 in PBS. Cells were then blocked with 3% bovine serum albumin/PBS for 30 min and subsequently incubated with primary antibodies (1 µg/ml for both mouse anti-proMMP-2 antibody and rabbit anti-furin antibody) and secondary antibodies (1: 1500 dilution of a fluorescein-conjugated goat anti-rabbit IgG and a Texas Red-conjugated mouse IgG) (Rockland, Gilbertsville, PA). After extensive washes, the coverslips were mounted on microscope slides with antifading medium (Vectashield, Vector Laboratories Inc., Burlingame, CA). The samples with double-stained specimens were examined and photographed with a Nikon fluorescent microscope and Bio-Rad Radiance 2000 model confocal imaging system. The images were analyzed by Lasersharp 2000 software (Bio-Rad).
Co-immunoprecipitation of Both MMP-2 and FurinCOS-1 cells co-transfected with furin and proMMP-2 cDNAs were lysed with radioimmune precipitation assay (RIPA) lysis buffer, and the cell lysates were immunoprecipitated with anti-MMP-2 antibodies followed by capture of the antigen-antibody complex with protein A-agarose beads (Invitrogen). The MMP-2 complex was fractionated by SDS-PAGE (10% polyacrylamide gel), and Western blotting was performed using anti-furin antibodies.
Fluorogenic Substrate Degradation AssayFurin-cleaved MMP-2 along with unprocessed latent MMP-2 was isolated from the conditioned medium of COS-1 cells co-transfected with proMMP-2 cDNA and furin cDNA using gelatin-Sepharose chromatography as described previously (24). Similarly, proMMP-2 and MT1-MMP-activated MMP-2 were isolated and used as controls. Protein concentrations were determined using bovine serum albumin as a standard (BCATM protein assay kit, Pierce). Equal amounts of furin-cleaved and MT1-MMP-activated MMP-2 (based on densitometry analysis) as well as proMMP-2 were incubated with 1.5 µM fluorogenic substrate (Mca-Pro-Leu-Gly-Leu-Dpa-Ala-Arg-NH2) at 25 °C for 60 min. Fluorimetric analysis was performed at
excitation = 328 nm and
emission = 393 nm as described previously (25).
Procedures for Gelatin Substrate Zymography and Western BlottingBasic protocols for these techniques have been described in our recent studies (22, 26).
 |
RESULTS
|
|---|
Direct Cleavage of proMMP-2 by Furin in Transfected COS-1 CellsCOS-1 cells serve as an ideal model in evaluating MMPs because these cells contain negligible amounts of endogenous MMPs and express high levels of protein in response to transfection with cDNAs. To examine the role of furin in the furin-MT1-MMP-MMP-2 activation axis, COS-1 cells were co-transfected with both furin and proMMP-2 cDNAs, and the conditioned medium from the transfected cells was examined by gelatin zymography. Surprisingly, conditioned media harvested from these cells revealed the cleavage of proMMP-2 (zymogen form) (Fig. 1A). In comparison with the MT1-MMP processing of proMMP-2, which resulted in intermediate (64-kDa) and activated (62-kDa) forms of MMP-2 (9), furin-cleaved MMP-2 (fur.MMP-2) migrated as a 63-kDa protein. The cleavage of proMMP-2 by furin was confirmed by Western blotting using an anti-MMP-2 antibody (data not shown).

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 1. Furin cleaves proMMP-2 in transfected COS-1 cells. A, cleavage of proMMP-2 by furin. COS-1 cells co-transfected with proMMP-2 cDNA along with mock control, MT1-MMP, or furin cDNAs were incubated in serum-free medium for 18 h at 37 °C. The spent conditioned medium was collected, and gelatin zymography was performed. Stepwise cleavage of proMMP-2 by MT1-MMP was noticed through 64-kDa intermediated MMP-2 (int.MMP-2) to fully activated 62-kDa MMP-2 (act.MMP-2), whereas co-expression of proMMP-2 with furin resulted in cleavage of proMMP-2 to a 63-kDa form (fur.MMP-2). B, dose-dependent inhibition of furin-cleaved proMMP-2 by a furin-specific inhibitor. COS-1 cells co-transfected with proMMP-2 and furin cDNAs were incubated with different concentrations of Dec-RVKR-cmk as indicated. The conditioned medium was collected and analyzed by gelatin zymography. The furin-specific inhibitor interfered with the cleavage of proMMP-2 in a dose-dependent manner.
|
|
To further examine the cleavage of proMMP-2 by furin, a synthetic specific inhibitor of furin, Dec-RVKR-cmk, was employed. Cells co-transfected with both furin and proMMP-2 cDNAs were incubated with the inhibitor. As shown in Fig. 1B, furin-induced cleavage of proMMP-2 was inhibited by Dec-RVKR-cmk in a dose-dependent fashion, confirming that the cleavage of proMMP-2 was furin-mediated.
Cleavage of proMMP-2 by Furin Is Independent of MT1-MMP ExpressionTo clarify the direct role of furin in the cleavage of proMMP-2, conditioned media from COS-1 cells transfected with different combinations of cDNAs encoding protease inhibitors as well as proMMP-2, MT1-MMP, and furin were examined. As shown in Fig. 2A, overexpression of TIMP-2, a natural inhibitor of MT1-MMP, in co-transfected COS-1 cells totally blocked MT1-MMP-induced proMMP-2 activation but had no effect on furin-induced proMMP-2 cleavage. A similar inhibitory effect was noted in transfected cells treated with a synthetic broad-spectrum metalloproteinase inhibitor, e.g. CT1847 (27) (data not shown). On the other hand, co-expression of cells with the furin inhibitor,
1-antitrypsin Pittsburgh mutant cDNA (
1-PI), interfered with the cleavage of proMMP-2 by furin (Fig. 2A) but did not affect MT1-MMP cleavage of proMMP-2 (22).
It has been demonstrated that formation of a complex between the C-terminal domain of MMP-2 with the C-terminal domain of TIMP-2 is essential for immobilizing MMP-2 at the cell surface in order for it to be activated by MT1-MMP (9, 27). Hence, C-terminal hemopexin domain-deleted MMP-2 is not activated by MT1-MMP. To examine the requirement for the C-terminal domain of MMP-2 in cleavage of proMMP-2 by furin, a deletion mutant of proMMP-2 lacking the hemopexin domain from Ala418 to Cys631 (28) was generated (proMMP-2
C). The conditioned medium from COS-1 cells transfected with various cDNAs as indicated was collected, and gelatin zymography was performed (Fig. 2B). Consistent with a previous report (24), proMMP-2
C displayed gelatinolytic activity. As anticipated, co-transfection of COS-1 cells with MT1-MMP and proMMP-2
C cDNAs did not result in cleavage of proMMP-2
C. In contrast, co-expression of furin with proMMP-2
C cDNAs in COS-1 cells resulted in the cleavage of the C-terminal-deleted proMMP-2. Taken together, these data indicate that furin cleaves proMMP-2 at the N terminus and that this cleavage is independent of MT1-MMP.
Intracellular Cleavage of proMMP-2 by FurinFurin is a transmembrane protein distributed mainly in the TGN (29). Furin also traffics to the cell surface and to a lesser degree is shed into the extracellular environment (18). Given these considerations, the processing compartment of proMMP-2 by furin was examined. To evaluate the possibility that the cleavage of proMMP-2 by furin occurs extracellularly, COS-1 cells were transfected with furin alone, MT1-MMP alone, or proMMP-2 cDNA alone. Transfected cells were co-cultured in various combinations, and conditioned media were collected. As anticipated, co-culture of the COS-1 cells expressing MT1-MMP with cells expressing proMMP-2 led to proMMP-2 activation (Fig. 3A) supporting a cell surface-activated mechanism for proMMP-2. In agreement with a previous report that shed furin functions in conditioned medium (18, 19), co-culture of the COS-1 cells expressing furin and proMMP-2 resulted in the cleavage of proMMP-2, but less efficiently, despite the presence of considerable levels of shed furin in the conditioned medium as depicted by Western blotting (Fig. 3B). COS-1 cells expressing furin did not enhance proMMP-2 activation induced by MT1-MMP. To further clarify this observation, a soluble furin cDNA lacking the C-terminal transmembrane domain (Sol. furin) (19) was transfected into COS-1 cells along with proMMP-2 cDNA, and the spent conditioned medium was examined by gelatin zymography. Consistent with the co-culture result, soluble furin processed proMMP-2 less efficiently than wild-type furin (Fig. 3C). These data thus support the hypothesis that furin is shed into conditioned media and possesses enzymatic activity. To further examine the enzymatic role of furin in proMMP-2 cleavage, a dominant negative furin construct was employed in which the active site serine was mutated to alanine (furinS
A) (19). This inactive mutant (furinS
A) failed to cleave proMMP-2 in transfected cells (Fig. 3C).

View larger version (32K):
[in this window]
[in a new window]
|
FIG. 3. Intracellular cleavage of proMMP-2 by furin. A, inefficient extracellular cleavage of proMMP-2 by furin. COS-1 cells transfected with MT1-MMP, furin, proMMP-2, or GFP control were co-cultured as indicated. The spent conditioned medium was collected and examined by gelatin zymography. Co-culture of cells expressing furin and cells expressing proMMP-2 resulted in inefficient cleavage of proMMP-2. B, shedding of furin in transfected COS-1 cells. The conditioned medium from COS-1 cells transfected with furin cDNA was concentrated and examined by Western blotting using an anti-furin antibody. 80-kDa soluble furin was detected in the conditioned medium. C, enzymatic inactive furin is unable to cleave proMMP-2. COS-1 cells were co-transfected with proMMP-2 cDNA along with GFP control, MT1-MMP, furin, soluble furin (sol.Furin), or inactive furin (FurinS-A) cDNAs, and the conditioned media were collected for gelatin zymography. In contrast to furin, furinS A-transfected cells failed to result in cleavage of proMMP-2.
|
|
Given the fact that furin is mainly localized to the TGN, we compared the cleavage of proMMP-2 in whole cell lysates of transfected cells versus the conditioned medium. Cleaved MMP-2 (63 kDa) was noted in both the conditioned medium and the cell lysates of COS-1 cells expressing both furin and proMMP-2 (Fig. 4A, lanes 3 and 7). Because furin-induced proMMP-2 cleavage occurs less efficiently in the extracellular environment (Fig. 3, A and C), we hypothesized that proMMP-2 was primarily activated by furin in the TGN and/or the secretory pathway. To test this hypothesis, cells were treated with brefeldin A, which blocks protein trafficking from the ER to the Golgi apparatus (21). As expected, treatment of transfected cells with brefeldin A blocked cell secretion of proMMP-2 (Fig. 4A, lanes 6 and 8) and cleavage of proMMP-2 by furin (Fig. 4A, lane 4); this was accompanied by accumulation of proMMP-2 in the cell lysate, presumably in the ER (Fig. 4A, lanes 2 and 4). These data suggest that the cleavage of proMMP-2 by furin occurs mainly in the TGN following trafficking of furin and proMMP-2 from the ER to the Golgi apparatus.

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 4. Cleavage of proMMP-2 by furin in TGN. A, intracellular cleavage of proMMP-2 by furin. COS-1 cells co-transfected with proMMP-2 and furin cDNAs were treated with or without brefeldin A (BFA, 1 µg/ml) for 18 h at 37 °C. The conditioned medium and cell lysates were examined by gelatin zymography. Brefeldin A treatment resulted in the accumulation of proMMP-2 in the ER and prevented proMMP-2 cleavage by furin. B, co-localization of furin with proMMP-2 in TGN. COS-1 cells co-transfected with proMMP-2 and furin cDNAs were immunostained with anti-MMP-2 and anti-furin antibodies and examined by confocal microscopy. Furin was co-localized with MMP-2 in the TGN. C, intracellular interaction of furin with proMMP-2. COS-1 cells were co-transfected with furin and GFP or furin and proMMP-2 cDNAs. The cell lysates were subjected to immunoprecipitation (IP) with anti-MMP-2 antibodies. The immunoprecipitates were blotted with anti-furin antibody. The total cell lysates of GFP- and furin-transfected cells were used as controls in immunoblotting (IB).
|
|
To examine the distribution of furin and proMMP-2 in transfected cells, double indirect immunofluorescence staining was employed and analyzed by confocal laser scanning microscopy (Fig. 4B). Approximately 80% of the MMP-2 was co-localized with furin in the perinuclear region, which is consistent with the location of the TGN; 20% MMP-2 was noted in the more peripheral vesicles. Antibodies to trans-Golgi network 38 (TGN38) (30) were used to confirm the TGN localization of furin and MMP-2 (data not shown). To further examine the interaction between furin and MMP-2, a co-immunoprecipitation experiment was employed. COS-1 cells were transfected with both furin cDNA and proMMP-2 cDNA versus furin cDNA and GFP cDNA. Cell lysates were immunoprecipitated with anti-MMP-2 antibodies employing protein A-agarose beads followed by immunoblotting with anti-furin antibodies; a distinct furin band was noted in furin plus proMMP-2-transfected cells but not in furin plus GFP-transfected cells (Fig. 4C). These data are consistent with the formation of a complex between furin and MMP-2 in the TGN.
Identification of Minimum Furin Consensus Cleavage Site in proMMP-2It has been reported that furin preferentially cleaves precursor molecules at the R4-X3-R/K2-R1
motif (31). P1 and P4 arginine represent the minimum cleavage sequences required for substrate cleavage (14). Examination of the N-terminal amino acid sequence of proMMP-2 reveals a potential furin cleavage motif, R69XXR72, in the propeptide domain. To determine whether the cleavage of proMMP-2 by furin is due to cleavage of this RXXR motif, site-directed mutagenesis was employed. Because arginine in both the P1 and P4 positions is essential for furin cleavage, the arginine in the P4 position (Arg69) of proMMP-2 was converted to alanine (MMP-2R69
A). The conditioned medium of COS-1 cells co-transfected with MMP-2R69
A and furin cDNAs was examined by gelatin zymography. In contrast to wild-type proMMP-2 (Fig. 1A), altering the basic amino acid at the P4 position of proMMP-2 completely prevented the cleavage of the mutant by furin but had no effect on the cleavage by MT1-MMP (Fig. 5A). The cleavage site was further confirmed by N-terminal amino acid sequencing of furin-cleaved MMP-2. The furin-cleaved MMP-2 purified by gelatin-Sepharose chromatography was electroblotted onto a polyvinylidene difluoride membrane (Fig. 5B) and subjected to N-terminal sequence analysis. The 63-kDa-cleaved MMP-2 (identified by gelatin zymography) had the N-terminal sequence CGNPDVAN (Fig. 5C), confirming that furin cleaves proMMP-2 between the Arg72 and Cys73 bond.

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 5. Cleavage of proMMP-2 by furin at R69XXR72. A, failure of cleavage of mutant MMP-2 by furin. Mutant proMMP-2 (MMP-2R69 A) cDNA was co-transfected with furin or MT1-MMP cDNA in COS-1 cells. The spent conditioned medium was examined by gelatin zymography. MT1-MMP-expressing cells, but not furin, efficiently processed mutant proMMP-2 to the fully activated form. B and C, confirmation of furin cleavage site by N-terminal amino acid sequencing. To confirm the cleavage site of proMMP-2 by furin, purified furin-cleaved MMP-2 (fur. MMP-2) and unprocessed proMMP-2 were fractionated by 10% polyacrylamide gel electrophoresis followed by transfer to a polyvinylidene difluoride membrane. The fur.MMP-2 protein was stained with Coomassie Brilliant Blue and subjected to amino acid sequencing. The protein sequence revealed the cleavage of the Arg72Cys73 bond in proMMP-2 (C). Pro-Pep., propeptide.
|
|
To investigate whether the cleavage of proMMP-2 by furin represents an alternative activation pathway in MMPs containing an RXXR motif within the propeptide domain, MMP-3 (stromelysin-1), which has the same RKPR motif in its propeptide domain as noted in proMMP-2, was examined. The conditioned media from COS-1 cells co-transected with MMP-3 cDNA along with furin or vehicle and MT1-MMP control cDNAs were collected; cleavage of proMMP-3 was determined by Western blotting using anti-MMP-3 antibodies (Fig. 6). Recombinant pro-MMP-3 was secreted as a 57-kDa protein in transfected cells. Overexpression of MT1-MMP with proMMP-3 did not alter the molecular weight of proMMP-3, indicating that proMMP-3 is not a substrate for MT1-MMP. In contrast, cleavage of proMMP-3 was noted on Western blotting in cells overexpressing both furin and proMMP-3. Furthermore, transfection of COS-1 cells with both furin cDNA and proMMP-1 cDNA (which lacks a minimal consensus cleavage motif, RXXR) did not result in cleavage of proMMP-1 (data not shown). These data indicate that furin can directly cleave MMPs containing an RXXR motif.

View larger version (42K):
[in this window]
[in a new window]
|
FIG. 6. Processing RXXR-containing MMP-3 by furin. COS-1 cells were co-transfected with MMP-3, an RXXR-containing MMP, along with MT1-MMP and furin. The conditioned medium was collected and examined by Western blotting using anti-MMP-3 antibodies. Overexpression of furin but not MT1-MMP cleaved proMMP-3 in transfected cells.
|
|
Defective Proteolytic Activity of Furin-cleaved MMP-2As demonstrated in Fig. 5, furin cleaves proMMP-2 between Arg69 and Cys70 within the conserved PR69C70GVPD cysteine switch motif in the propeptide domain of proMMP-2. In contrast to the classical cysteine switch mechanism, furin-induced cleavage does not result in the anticipated 62-kDa activated MMP-2 (Fig. 1A). To clarify whether furin-cleaved proMMP-2 contained enzymatic activity, a fluorimetric assay using a fluorescence-quenched peptide substrate was utilized (25). Because furin-cleaved MMP-2 released into the conditioned medium was co-purified with proMMP-2 (Fig. 5B), comparable amounts of furin-cleaved MMP-2 and MT1-MMP-activated MMP-2 were incubated with the fluorogenic substrate, and the enzymatic activity of each mixture was determined by fluorimetric assay. In contrast to MT1-MMP-activated MMP-2, which produced dose-dependent cleavage of the peptide substrate, furin-cleaved MMP-2 did not cleave the substrate (Fig. 7). Taken together, our findings demonstrate for the first time that furin negatively regulates the proteolytic activity of proMMP-2 by directly cleaving the propeptide domain of proMMP-2 in the trans-Golgi network.
 |
DISCUSSION
|
|---|
The involvement of MMP-2 in extracellular matrix degradation is controlled by the activation of zymogen and the inhibition of the activated enzyme by endogenous inhibitors (6, 32). MMP-1, -7, activated protein C, free radicals, and serine proteases have been reported to activate soluble proMMP-2 (3336). The cellular mechanism of proMMP-2 activation has been the focus of considerable interest based on the identification of a subfamily of intrinsic membrane-anchored MMPs (MT-MMPs) (7, 9). In contrast to this plasma membrane activation mechanism of proMMP-2, Lee et al. (11) reported that the activation of proMMP-2 can occur within the cell and that the activator is present on Golgi membranes. In the current study, we present biochemical evidence that furin is capable of cleaving proMMP-2 in the TGN before secretion resulting in an inactive form of MMP-2.
Because furin is expressed ubiquitously at low levels in cells, overexpression of furin along with potential protein substrates in cells has proved to be useful for the identification of cleavage candidates (19, 37, 38). In our experiments, expression of furin cDNA along with proMMP-2 cDNA in cells resulted in the cleavage of proMMP-2 at the R69XXR72 furin consensus sequence resulting in a 63-kDa product (identified by gelatin zymography). Furin cleavage of proMMP-2 is specific based on the following evidence: 1) conversion of arginine 69 to alanine in proMMP-2 resulted in failure of cleavage; 2) the dominant negative mutant furin (furinS
A) failed to process proMMP-2; and 3) sequencing of the N-terminal of furin-cleaved MMP-2 confirmed the anticipated R69KPR72 cleavage sequence in proMMP-2. However, it is recognized that overexpression of furin in transfected cells may cause cleavage of precursors which may not occur under physiologic conditions (39). We also demonstrated that furin cleaves proMMP-3, which contains an RXXR sequence, but not proMMP-1, which lacks the furin consensus sequence. Of interest, based on the identification of an RXXR furin consensus sequence in proMMP-2, Bassi et al. (40) and Khatib et al. (41) previously predicted that the proprotein convertase furin may be able to directly cleave proMMP-2 leading to activation of the enzyme. Given the facts that expression of furin is elevated during cancer progression and correlates with invasiveness and metastatic potential in some tumor cell lines (40, 4245), Schalken et al. (46) proposed that the expression level of the furin gene would be useful as a discriminating marker for cancers, e.g. human lung carcinoma.
Furin localizes to the TGN, cell surface, endosomes, lysosomes, and secretory granules, but furin cleaves substrates primarily in the TGN (14, 47). Based on the following evidence, we propose that proMMP-2 is cleaved by furin in the TGN before secretion: 1) both furin and MMP-2 are co-localized in the TGN and can be co-immunoprecipitated in cell lysates; 2) cleaved MMP-2 is detected in cell lysates as well as cell conditioned media; and 3) interference with trafficking from the endoplasmic reticulum to the Golgi apparatus abrogates proMMP-2 activation. Our conclusion is in agreement with previous reports that furin cleaves several metalloproteinases in the TGN (48, 49).
Physiologic activation of proMMP-2 on the cell surface is initiated by cleavage of proMMP-2 at the bait region (Asn37Tyr38) by MT1-MMP and is followed by intermolecular autocleavage to the fully activated enzyme (9). Employing N-terminal amino acid sequencing, we demonstrated that furin cleaves proMMP-2 at the Arg72Cys73 scissile bond; additional cleavage of MMP-2 does not occur. These data suggest that the amino acid sequence between Tyr38 and Cys73 in the propeptide domain of MMP-2 is required for intermolecular autolysis. Furthermore, furin-cleaved MMP-2 did not display enzymatic activity as examined by functional assays (Fig. 7), although it elicited gelatinolytic activity as examined by gelatin zymography. This gelatinolytic activity can be attributed to SDS (6) inducing the dissociation of the cysteine-zinc bond leading to unlocking of the catalytic domain of the 63-kDa MMP-2.
In conclusion, we have demonstrated a novel mechanism for cleavage of proMMP-2 in the TGN. This cleavage mechanism may be used to regulate the activity of other RXXR-containing MMPs. Given the evidence that furin is frequently detected in several human cancers and cell lines (40, 4245), it appears that furin is capable of acting as a double-edged sword in the trans-Golgi network by 1) indirectly activating proMMP-2 following activation of MT1-MMP or 2) directly incapacitating proMMP-2 by cleavage at a furin consensus sequence. Therefore, furin may negatively regulate proMMP-2 activity and provide a regulatory mechanism to control MT1-MMP activation of proMMP-2, hence adding to the list of the paradoxical functions of MMPs in cancer and the ineffectiveness of MMP inhibitors in clinical trials (50). The pathological role of furin in cancer progression requires further investigation.
 |
FOOTNOTES
|
|---|
* This work was supported by a Scientist Development grant from the American Heart Association and a New Investigator grant from the United States Army Medical Research and Materiel Command (to J. C.) and a Research Enhancement Award Program grant from the Department of Veterans Affairs. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. 
To whom correspondence should be addressed: Rm. 004, Life Sciences, SUNY at Stony Brook, Stony Brook, NY 11794-5200. Tel.: 631-632-1815; E-mail: jian.cao{at}sunysb.edu.
1 The abbreviations used are: MMP, matrix metalloproteinase; ER, endoplasmic reticulum; Dec-RVKR-cmk, decanoyl-Arg-Val-Lys-Arg-chloromethylketone; GFP, green fluorescent protein; MT-MMP, membrane-type matrix metalloproteinase; PBS, phosphate-buffered saline; TIMP, tissue inhibitor of metalloproteinase; TGN, trans-Golgi network. 
 |
ACKNOWLEDGMENTS
|
|---|
We thank Dr. Stanley Zucker (Veterans Affairs Medical Center, Northport, NY and SUNY, Stony Brook, NY) for continuous encouragement, support, and critical reading of the manuscript.
 |
REFERENCES
|
|---|
- Sternlicht, M. D., and Werb, Z. (2001) Annu. Rev. Cell Dev. Biol. 17, 463516[CrossRef][Medline]
[Order article via Infotrieve]
- Stetler-Stevenson, W. G., Aznavoorian, S., and Liotta, L. A. (1993) Annu. Rev. Cell Biol. 9, 541573[CrossRef][Medline]
[Order article via Infotrieve]
- Velasco, G., Pendas, A. M., Fueyo, A., Knauper, V., Murphy, G., and Lopez-Otin, C. (1999) J. Biol. Chem. 274, 45704576[Abstract/Free Full Text]
- Wilhelm, S. M., Collier, I. E., Kronberger, A., Eisen, A. Z., Marmer, B. L., Grant, G. A., Bauer, E. A., and Goldberg, G. I. (1987) Proc. Natl. Acad. Sci. U. S. A. 84, 67256729[Abstract/Free Full Text]
- Whitham, S. E., Murphy, G., Angel, P., Rahmsdorf, H. J., Smith, B. J., Lyons, A., Harris, T. J., Reynolds, J. J., Herrlich, P., and Docherty, A. J. (1986) Biochem. J. 240, 913916[Medline]
[Order article via Infotrieve]
- Nagase, H. (1997) Biol. Chem. 378, 151160[Medline]
[Order article via Infotrieve]
- Sato, H., Takino, T., Okada, Y., Cao, J., Shinagawa, A., Yamamoto, E., and Seiki, M. (1994) Nature 370, 6165[CrossRef][Medline]
[Order article via Infotrieve]
- Zucker, S., Pei, D., Cao, J., and Lopez-Otin, C. (2003) Curr. Top. Dev. Biol. 54, 174[Medline]
[Order article via Infotrieve]
- Strongin, A. Y., Collier, I., Bannikov, G., Marmer, B. L., Grant, G. A., and Goldberg, G. I. (1995) J. Biol. Chem. 270, 53315338[Abstract/Free Full Text]
- Atkinson, S. J., Crabbe, T., Cowell, S., Ward, R. V., Butler, M. J., Sato, H., Seiki, M., Reynolds, J. J., and Murphy, G. (1995) J. Biol. Chem. 270, 3047930485[Abstract/Free Full Text]
- Lee, A. Y., Akers, K. T., Collier, M., Li, L., Eisen, A. Z., and Seltzer, J. L. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 44244429[Abstract/Free Full Text]
- Pei, D., and Weiss, S. J. (1996) J. Biol. Chem. 271, 91359140[Abstract/Free Full Text]
- Liu, G., Thomas, L., Warren, R. A., Enns, C. A., Cunningham, C. C., Hartwig, J. H., and Thomas, G. (1997) J. Cell Biol. 139, 17191733[Abstract/Free Full Text]
- Molloy, S. S., Bresnahan, P. A., Leppla, S. H., Klimpel, K. R., and Thomas, G. (1992) J. Biol. Chem. 267, 1639616402[Abstract/Free Full Text]
- Krysan, D. J., Rockwell, N. C., and Fuller, R. S. (1999) J. Biol. Chem. 274, 2322923234[Abstract/Free Full Text]
- Gu, F., Crump, C. M., and Thomas, G. (2001) Cell. Mol. Life Sci. 58, 10671084[CrossRef][Medline]
[Order article via Infotrieve]
- Vischer, U. M., and Wagner, D. D. (1994) Blood 83, 35363544[Abstract/Free Full Text]
- Vey, M., Schafer, W., Berghofer, S., Klenk, H. D., and Garten, W. (1994) J. Cell Biol. 127, 18291842[Abstract/Free Full Text]
- Rehemtulla, A., and Kaufman, R. J. (1992) Blood 79, 23492355[Abstract/Free Full Text]
- Cao, J., Drews, M., Lee, H. M., Conner, C., Bahou, W. F., and Zucker, S. (1998) J. Biol. Chem. 273, 3474534752[Abstract/Free Full Text]
- Lippincott-Schwartz, J., Cole, N. B., Marotta, A., Conrad, P. A., and Bloom, G. S. (1995) J. Cell Biol. 128, 293306[Abstract/Free Full Text]
- Cao, J., Rehemtulla, A., Bahou, W., and Zucker, S. (1996) J. Biol. Chem. 271, 3017430180[Abstract/Free Full Text]
- Rehemtulla, A., Dorner, A. J., and Kaufman, R. J. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 82358239[Abstract/Free Full Text]
- Crabbe, T., Zucker, S., Cockett, M. I., Willenbrock, F., Tickle, S., O'Connell, J. P., Scothern, J. M., Murphy, G., and Docherty, A. J. (1994) Biochemistry 33, 66846690[CrossRef][Medline]
[Order article via Infotrieve]
- Knight, C. G., Willenbrock, F., and Murphy, G. (1992) FEBS Lett. 296, 263266[CrossRef][Medline]
[Order article via Infotrieve]
- Cao, J., Kozarekar, P., Pavlaki, M., Chiarelli, C., Bahou, W. F., and Zucker, S. (2004) J. Biol. Chem. 279, 1412914139[Abstract/Free Full Text]
- Zucker, S., Drews, M., Conner, C., Foda, H. D., DeClerck, Y. A., Langley, K. E., Bahou, W. F., Docherty, A. J., and Cao, J. (1998) J. Biol. Chem. 273, 12161222[Abstract/Free Full Text]
- Collier, I. E., Wilhelm, S. M., Eisen, A. Z., Marmer, B. L., Grant, G. A., Seltzer, J. L., Kronberger, A., He, C. S., Bauer, E. A., and Goldberg, G. I. (1988) J. Biol. Chem. 263, 65796587[Abstract/Free Full Text]
- Molloy, S. S., Thomas, L., VanSlyke, J. K., Stenberg, P. E., and Thomas, G. (1994) EMBO J. 13, 1833[Medline]
[Order article via Infotrieve]
- Lowenstein, P. R., Morrison, E. E., Bain, D., Shering, A. F., Banting, G., Douglas, P., and Castro, M. G. (1994) Eur. J. Neurosci. 6, 14531465[CrossRef][Medline]
[Order article via Infotrieve]
- Steiner, D. F., Smeekens, S. P., Ohagi, S., and Chan, S. J. (1992) J. Biol. Chem. 267, 2343523438[Free Full Text]
- Birkedal-Hansen, H., Moore, W. G., Bodden, M. K., Windsor, L. J., Birkedal-Hansen, B., DeCarlo, A., and Engler, J. A. (1993) Crit. Rev. Oral Biol. Med. 4, 197250[Abstract/Free Full Text]
- Paquette, B., Bisson, M., Therriault, H., Lemay, R., Pare, M., Banville, P., and Cantin, A. M. (2003) J. Steroid Biochem. Mol. Biol. 87, 6573[CrossRef][Medline]
[Order article via Infotrieve]
- Xue, M., Thompson, P., Kelso, I., and Jackson, C. (2004) Exp. Cell Res. 299, 119127[CrossRef][Medline]
[Order article via Infotrieve]
- Sang, Q. A., Bodden, M. K., and Windsor, L. J. (1996) J. Protein Chem. 15, 243253[Medline]
[Order article via Infotrieve]
- Crabbe, T., O'Connell, J. P., Smith, B. J., and Docherty, A. J. (1994) Biochemistry 33, 1441914425[CrossRef][Medline]
[Order article via Infotrieve]
- Deryugina, E. I., Ratnikov, B. I., Yu, Q., Baciu, P. C., Rozanov, D. V., and Strongin, A. Y. (2004) Traffic 5, 627641[CrossRef][Medline]
[Order article via Infotrieve]
- Wang, P., Tortorella, M., England, K., Malfait, A. M., Thomas, G., Arner, E. C., and Pei, D. (2004) J. Biol. Chem. 279, 1543415440[Abstract/Free Full Text]
- Nakayama, K. (1997) Biochem. J. 327, 625635[Medline]
[Order article via Infotrieve]
- Bassi, D. E., Mahloogi, H., and Klein-Szanto, A. J. (2000) Mol. Carcinog. 28, 6369[CrossRef][Medline]
[Order article via Infotrieve]
- Khatib, A. M., Siegfried, G., Chretien, M., Metrakos, P., and Seidah, N. G. (2002) Am. J. Pathol. 160, 19211935[Abstract/Free Full Text]
- Van de Ven, W. J., Roebroek, A. J., and Van Duijnhoven, H. L. (1993) Crit. Rev. Oncog. 4, 115136[Medline]
[Order article via Infotrieve]
- Mbikay, M., Sirois, F., Yao, J., Seidah, N. G., and Chretien, M. (1997) Br. J. Cancer 75, 15091514[Medline]
[Order article via Infotrieve]
- Cheng, M., Watson, P. H., Paterson, J. A., Seidah, N., Chretien, M., and Shiu, R. P. (1997) Int. J. Cancer 71, 966971[CrossRef][Medline]
[Order article via Infotrieve]
- Bassi, D. E., Mahloogi, H., Al Saleem, L., Lopez, D. C., Ridge, J. A., and Klein-Szanto, A. J. (2001) Mol. Carcinog. 31, 224232[CrossRef][Medline]
[Order article via Infotrieve]
- Schalken, J. A., Roebroek, A. J., Oomen, P. P., Wagenaar, S. S., Debruyne, F. M., Bloemers, H. P., and Van de Ven, W. J. (1987) J. Clin. Investig. 80, 15451549[Medline]
[Order article via Infotrieve]
- Walker, J. A., Molloy, S. S., Thomas, G., Sakaguchi, T., Yoshida, T., Chambers, T. M., and Kawaoka, Y. (1994) J. Virol. 68, 12131218[Abstract/Free Full Text]
- Leighton, M., and Kadler, K. E. (2003) J. Biol. Chem. 278, 1847818484[Abstract/Free Full Text]
- Kang, T., Zhao, Y. G., Pei, D., Sucic, J. F., and Sang, Q. X. (2002) J. Biol. Chem. 277, 2558325591[Abstract/Free Full Text]
- Pavlaki, M., and Zucker, S. (2003) Cancer Metastasis Rev. 22, 177203[CrossRef][Medline]
[Order article via Infotrieve]
This article has been cited by other articles:

|
 |

|
 |
 
B.-H. Koo, J.-M. Longpre, R. P. T. Somerville, J. P. Alexander, R. Leduc, and S. S. Apte
Regulation of ADAMTS9 Secretion and Enzymatic Activity by Its Propeptide
J. Biol. Chem.,
June 1, 2007;
282(22):
16146 - 16154.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. M. Hockenbery
MMPs in Unusual Places
Am. J. Pathol.,
October 1, 2006;
169(4):
1101 - 1103.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Si-Tayeb, A. Monvoisin, C. Mazzocco, S. Lepreux, M. Decossas, G. Cubel, D. Taras, J.-F. Blanc, D. R. Robinson, and J. Rosenbaum
Matrix Metalloproteinase 3 Is Present in the Cell Nucleus and Is Involved in Apoptosis
Am. J. Pathol.,
October 1, 2006;
169(4):
1390 - 1401.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Kato, C. Jeanneau, M. A. Tarp, A. Benet-Pages, B. Lorenz-Depiereux, E. P. Bennett, U. Mandel, T. M. Strom, and H. Clausen
Polypeptide GalNAc-transferase T3 and Familial Tumoral Calcinosis: SECRETION OF FIBROBLAST GROWTH FACTOR 23 REQUIRES O-GLYCOSYLATION
J. Biol. Chem.,
July 7, 2006;
281(27):
18370 - 18377.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2005 by the American Society for Biochemistry and Molecular Biology.