Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M412650200 on January 27, 2005

J. Biol. Chem., Vol. 280, Issue 12, 11665-11674, March 25, 2005
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
280/12/11665    most recent
M412650200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mandell, K. J.
Right arrow Articles by Parkos, C. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mandell, K. J.
Right arrow Articles by Parkos, C. A.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Junctional Adhesion Molecule 1 Regulates Epithelial Cell Morphology through Effects on {beta}1 Integrins and Rap1 Activity*

Kenneth J. Mandell{ddagger}, Brian A. Babbin, Asma Nusrat, and Charles A. Parkos

From the Epithelial Pathobiology Research Unit, Department of Pathology and Laboratory Medicine, Emory University School of Medicine, Atlanta, Georgia 30322

Received for publication, November 9, 2004 , and in revised form, January 3, 2005.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Epithelial tight junctions form a selectively permeable barrier to ions and small molecules. Junctional adhesion molecule 1 (JAM1/JAM-A/F11R) is a tight junction-associated transmembrane protein that has been shown to participate in the regulation of epithelial barrier function. In a recent study, we presented evidence suggesting that JAM1 homodimer formation is critical for epithelial barrier function (Mandell, K. J., McCall, I. C., and Parkos, C. A. (2004) J. Biol. Chem. 279, 16254–16262). Here we have used small interfering RNA to investigate the effect of the loss of JAM1 expression on epithelial cell function. Consistent with our previous study, knockdown of JAM1 was observed to increase paracellular permeability in epithelial monolayers. Interestingly, knockdown of JAM1 also produced dramatic changes in cell morphology, and a similar effect was observed with expression of a JAM1 mutant lacking the putative homodimer interface. Further studies revealed that JAM1 knockdown decreased cell-matrix adhesion and spreading on matrix proteins that are ligands of {beta}1 integrins. These changes were characterized by a decrease in {beta}1 integrin protein levels and loss of {beta}1 integrin staining at the cell surface. Immunolabeling of cells for the small GTPase Rap1, a known activator of {beta}1 integrins, revealed colocalization of Rap1 with JAM1 at intercellular junctions, and knockdown of JAM1 resulted in decreased Rap1 activity. Lastly, knockdown of Rap1b resulted in diminished {beta}1 integrin expression and altered cell morphology analogous to that observed with knockdown of JAM1. Together, these results suggest that JAM1 regulates epithelial cell morphology and {beta}1 integrin expression by modulating activity of the small GTPase Rap1.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Epithelial cells constitute a physiologic barrier that regulates paracellular diffusion of water, ions, and small molecules. Intercellular junctions, particularly tight junctions (TJs),1 play an important role in the regulation of epithelial barrier function (1). Disruption of tight junctions is a common feature of many inflammatory diseases (1–4), and loss of specific tight junction proteins has been shown to be predictive of invasion and metastasis of epithelial cancers (5–7). Thus, investigation of the regulation of TJs is highly relevant to understanding the function of epithelial cells and the pathophysiology of many human diseases.

In polarized epithelial cells, the TJ is comprised of a complex network of proteins that encircles the cell at the apical-most portion of the lateral membrane (8, 9). Three major families of transmembrane proteins are found in the TJ: claudins, occludin, and immunoglobulin superfamily proteins such as junctional adhesion molecules (JAMs) and coxsackie-adenovirus receptor (8, 9). In addition to transmembrane proteins, TJ complexes contain scaffolding proteins, enzymes, transcription factors, and cytoskeleton-associated proteins located immediately subjacent to the membrane (8, 9). Numerous studies have shown that this diverse group of transmembrane and cytosolic proteins plays a key role in the regulation of the structure and function of TJs.

Junctional adhesion molecule 1 (JAM1/JAM-A/F11R) is the first in a family of immunoglobulin superfamily proteins found in tight junctions of epithelial cells and endothelial cells as well as on the surface of hematopoeitic cells, such as platelets and leukocytes (10–16). Studies from our laboratory and others have demonstrated a key role of JAM1 in TJ assembly and epithelial barrier function. In addition, investigators have reported a role for JAM1 in a variety of other cellular processes, including platelet aggregation (15, 16, 19–22), leukocyte transmigration (11, 23, 24), and angiogenesis (25, 26). Lastly, JAM1 has also been implicated in attachment of reovirus, a murine pathogen closely related viruses that cause diarrhea in humans (27–29). Although JAM1 has been implicated in a diverse array of cellular processes, much remains to be learned about the molecular basis for its function in cells.

The JAM1 protein consists of an extracellular domain with two Ig-like loops, a single membrane-spanning region, and a short cytoplasmic tail terminating in a PDZ-binding motif. Evidence suggests that N-terminal Ig-like loop of JAM1 contains critical epitopes important for functions such as TJ assembly, platelet aggregation, and reovirus binding (17, 18, 20, 28, 30). Various investigators have reported that JAM1 can form homodimers through this N-terminal Ig loop and that homophilic interactions are important for its function in cells (17, 18, 29–31). In our previous study, antibodies to JAM1 were observed to inhibit the recovery of epithelial barrier function after TJ disassembly and block homophilic binding of JAM1 in vitro (17). Epitope mapping experiments revealed that these function-blocking antibodies bound to the N-terminal Ig-like loop of JAM1 in a region that overlaps the putative homodimer interface (17, 29, 31). In addition to extracellular adhesive interactions, evidence suggests that the cytoplasmic tail of JAM1 mediates interactions important for its function in cells. For example, the C-terminal PDZ-binding motif has been reported to bind various junction-associated scaffold proteins such as ZO-1, AF-6, ASIP, and CASK (32–36). Although these PDZ proteins are thought to be important for processes such as tight junction assembly and regulation of cell polarity, the functional significance of specific interactions between JAM1 and these PDZ proteins is still not well understood.

Many studies have used antibodies, peptides, and recombinant protein directed at the extracellular domain of JAM1 to disrupt JAM1 function in cells (11, 13, 18–20, 23–25, 28, 30). Recently small interfering RNA (siRNA) was used to investigate the role of JAM1 in angiogenesis (26), and a JAM1 knockout mouse model was developed to study dendritic cell trafficking (37). No study to date, however, has examined how the loss of JAM1 expression specifically affects epithelial cell functions, with respect to regulation of barrier function or any other cellular properties. In our present study, we employed a siRNA-based approach to investigate the effect of JAM1 knockdown in epithelial cells. Consistent with previous studies, we observed that knockdown of JAM1 increased epithelial monolayer permeability as evidenced by decreased transepithelial resistance (TER) and increased FITC-dextran flux. In addition, we now report that: (i) knockdown of JAM1 altered epithelial cell morphology, (ii) knockdown of JAM1 inhibited cell-matrix interactions, (iii) knockdown of JAM1 decreased {beta}1 integrin protein levels and abolished {beta}1 integrin staining at the cell membrane, and (iv) knockdown of JAM1 inhibited activity of the small GTPase Rap1, a known activator of {beta}1 integrins. Consistent with these siRNA-based studies, a stable cell line expressing a JAM1 truncation mutant lacking the homodimer interface demonstrated altered cell morphology with decreased {beta}1 integrin expression and Rap1 activity. In addition, knockdown of Rap1b was observed to affect cell morphology and {beta}1 integrin expression in a manner similar to knockdown of JAM1. Together these results support previous studies implicating JAM1 in regulation of barrier function and support the functional significance of JAM1 homophilic interactions. Our new findings suggest that JAM1 expression affects pathways that regulate cell morphology, {beta}1 integrin expression, and activity of the small GTPase Rap1.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Cell Culture—SK-CO15 colonic epithelial cells (38) were grown in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum, 2 mM L-glutamine, 100 IU of penicillin, 100 µg/ml streptomycin, 15 mM HEPES, and 1% nonessential amino acids (Cellgro). The cells were subcultured and harvested with 0.05% trypsin with EDTA in Hanks' balanced salt solution. For maintenance of stable cell lines expressing the DL1 mutant, growth medium was supplemented with 0.5 mg/ml G418 (Cellgro).

siRNA—The 21-nucleotide JAM1 target sequence AAAGATGGGATAGTGATGCCT was identified based on standard design parameters involving target length, molar percentage of guanine and cytosine bases content, and melting temperature (39). A BLAST search was performed to ensure that the JAM1 siRNA target sequence did not cross-react with other known human genes. Custom chemically synthesized duplex siRNA against JAM1 was obtained from Dharmacon. In addition, nontargeting control siRNA (Scramble II Duplex) and validated siRNA against Lamin A/C, cyclophilin B, Rap1a, and Rap1b were obtained from Dharmacon. All of the siRNA transfections were performed using Lipofectamine 2000 (Invitrogen) in Opti-MEM I medium (Invitrogen) according to the manufacturer's protocol with a final siRNA concentration of 40 nM.

Antibodies—Mouse monoclonal antibodies J10.4, J3F.1, and 1H2A9 and a rabbit polyclonal antibody to the JAM1 ectodomain were raised in our laboratory (13). Mouse monoclonal antibody to E-cadherin (HECD-1) was used as described previously (40). All of the additional primary antibodies were obtained commercially: rabbit anti-JAM1 (Zymed Laboratories Inc.), mouse anti-ZO-1 (Zymed Laboratories Inc.), mouse anti-{beta}1 integrin (Santa Cruz), rabbit anti-{beta}1 integrin (Chemicon), rabbit anti-{beta}4 (Chemicon), and rabbit-anti-Rap1 (Upstate). Horseradish peroxidase-conjugated secondary antibodies were obtained from Jackson ImmunoResearch, and fluorescently labeled secondary antibodies were obtained from Molecular Probes.

Stable Cell Lines—Production of the plasmid encoding the JAM1 truncation mutant lacking the N-terminal Ig-like loop (DL1) was described previously (17). SK-CO15 cells were transfected with the DL1 construct or empty vector (pIRES2-EGFP) using Lipofectamine 2000 (Invitrogen) according to the manufacturer's protocol. The cells were passaged multiple times in selection medium containing 0.5 mg/ml G418 (Cellgro) and then enriched by flow-assisted cell sorting by gating on the IRES-EGFP reporter.

Barrier Function Assays—SK-CO15 cells were grown on polyester membranes with 0.4-µm pore size and 0.33-cm2 surface area (Costar). Three days after transfection with siRNA, transepithelial resistance and FITC-dextran flux assays were performed as described previously (17, 41). In brief, transepithelial resistance to passive ion flux was measured using an EVOMX voltmeter with an STX2 electrode (World Precision Instruments). For FITC-dextran flux assays, the cells were switched from normal growth medium to Hanks' balanced salt solution containing calcium and magnesium (HBSS+). FITC-dextran size 4 kDa (Sigma) was added to the upper Transwell chamber at a final concentration of 1 mg/ml. The cells were incubated for 90 min at 37 °C, 50-µl samples were removed from the bottom chamber, and fluorescence was measured in a microplate reader (FluoStar).

Cell Adhesion and Spreading Assays—Assays for cell adhesion and spreading were performed according to established protocols (42). In brief, the cells were washed in phosphate-buffered saline then left in calcium-free medium for 20 min to disrupt cell junctions. The cells were washed with phosphate-buffered saline and briefly treated with trypsin/EDTA to detach cells. Harvested cells were washed, centrifuged, and resuspended in HBSS+ supplemented with 0.2% bovine serum albumin. Microplates were coated with collagen I, collagen IV, or fibronectin (BD Biosciences) at 5 µg/ml overnight at 4 °C and then blocked in 2% bovine serum albumin/phosphate-buffered saline for 1 h prior to the addition of cells. The cells were added at 5 x 104/96-well and incubated for 1 h at 37 °C. The cells were washed five times in HBSS+ to remove nonadherent cells, then fixed with ethanol, and stained with crystal violet. Cell adhesion was then assessed in a microplate reader by absorbance at A570.

Spreading assays were performed as described above using 1 x 104 cells/well in a microtiter plate. The images were captured using phase contrast microscopy, and the cells were counted manually. A cell was identified as "nonspreading" if it was round in shape and exhibited a bright, clearly defined edge surrounding the entire circumference of the cell. A cell was considered "spreading" if it had a polygonal shape or had visible evidence of filopodia-like extensions. The percentage of spreading was calculated as the number of spreading cells divided by the total number of cells in that field. Six fields of view were counted for each group.

Western Blots—The cells were homogenized in lysis buffer containing 20 mM Tris, 50 mM NaCl, 2 mM EDTA, 2 mM EGTA, 1% sodium deoxycholate, 1% Triton X-100, and 0.1% SDS, pH 7.4. Lysis buffer was supplemented with protease and phosphatase inhibitor cocktails containing 4-(2-aminoethyl)benzenesulfonyl fluoride hydrochloride (AEBSF), pepstatin A, E-64, bestatin, leupeptin, aprotinin, microcystin LR, cantharidin, (-)-p-bromotetramisole, sodium vanadate, sodium molybdate, sodium tartrate, and imidazole (1:100 dilution; Sigma). The lysates were then cleared by centrifugation and immediately boiled in SDS sample buffer. SDS-PAGE and immunoblots were performed by standard methods. All of the immunoblots were probed for actin to ensure equal protein loading.

Immunofluorescence Microscopy—The cells were grown on Transwell filters or glass coverslips, fixed in ethanol, and blocked in 1% bovine serum albumin in HBSS+. Primary antibodies were diluted in blocking buffer and incubated with cells for 1 h at room temperature. The cells were washed twice in HBSS+ and then incubated in fluorescently labeled secondary antibodies for 1 h at room temperature. The cells were washed twice with HBSS+ and mounted in Prolong Antifade Agent (Molecular Probes). Confocal fluorescence images were captured using a Zeiss laser scanning microscope. For costaining of Rap1 with JAM1, the cells were pretreated with a cytoskeleton stabilization buffer (0.5% Triton X-100, 10 mM MES, 3 mM MgCl2, 140 mM KCl, 2 mM EGTA, 280 mM sucrose, 1 µg/ml phalloidin) to enhance junctional staining (43). The cells were fixed with 4% paraformaldehyde and permeabilized with 0.5% Triton X-100. Immunolabeling was performed as described above. For some applications, the nuclei were counterstained with TO-PRO 3 nucleic acid stain (Molecular Probes).

Rap1 Activation Assays—Detection of active Rap1 was performed using a standard pull-down procedure (44). Briefly, the cells were lysed on ice in lysis buffer (50 mM Tris-HCl, pH 7.4, 0.5 M NaCl, 1% Nonidet P-40, 2.5 mM MgCl2, and 10% glycerol) supplemented with protease and phosphatase inhibitor cocktails (1:100; Sigma). The lysates were clarified by centrifugation and then incubated with agarose beads conjugated with Ral GDS-Rap-binding domain (Upstate) for 45 min at 4 °C. The beads were washed three times in lysis buffer, resuspended in 2x reducing SDS sample buffer, and boiled for 5 min. The entire sample, including beads, was then loaded into each well for separation by SDS-PAGE, and active Rap1 was detected by immunoblot.

Statistical Methods—The data are presented as sample means with error bars indicating the standard error of the mean. The p values were calculated using a Student's t test.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
Knockdown of JAM1 Enhances Paracellular Permeability— Evidence suggests that the extracellular domain of JAM1 plays an important role in the regulation of epithelial barrier function and TJ assembly (17, 18). In our present study, we use a siRNA-based approach to examine how the loss of endogenous JAM1 expression affects epithelial barrier function. Confluent SK-CO15 epithelial cell monolayers were transfected with siRNA directed against JAM1 or control siRNA. As shown in Fig. 1A, junctional staining for JAM1 in cell monolayers was significantly reduced by treatment with JAM1 siRNA. In addition, knockdown of JAM1 protein was confirmed by Western blot (Fig. 1B). To determine whether the loss of JAM1 affected barrier function, TER measurements were performed in cell monolayers treated with siRNA. As shown in Fig. 1C, an 80% decrease in TER was observed in cells treated with JAM1 siRNA compared with control siRNA (p < 1 x 10-8). To demonstrate that the effect of JAM1 siRNA on TER was specifically due to the loss of JAM1 expression, two other JAM1 siRNAs were synthesized and tested for effects on barrier function. All three siRNAs against JAM1 significantly reduced TER (data not shown). To demonstrate that the effect of JAM1 siRNA on TER was not simply the result of a general effect of protein knockdown; the cells were transfected with siRNA against other proteins that would not be expected to affect barrier function. As shown in Fig. 1C, siRNA against Lamin A/C did not significantly affect TER, nor did siRNA against cyclophilin B (data not shown). These results suggest that the effect of JAM1 siRNA on TER was specifically due to the knockdown of JAM1.



View larger version (39K):
[in this window]
[in a new window]
  		FIG. 1.
Knockdown of JAM1 by siRNA disrupts epithelial barrier function. SK-CO15 epithelial cell monolayers were transfected with siRNA targeting JAM1 or control siRNA. A, immunofluorescence analysis by confocal microscopy revealed decreased JAM1 protein at intercellular junctions after transfection with JAM1 siRNA. B, Western blots revealed that JAM1 siRNA treatment decreased total cellular JAM1 protein levels. Actin is shown as a control for equal protein loading. C, to assess the effect of JAM1 knockdown on paracellular ion flux, TER was measured in monolayers treated with JAM1 siRNA and compared with monolayers treated with control siRNA. Cell monolayers were also treated with Lamin A/C siRNA to demonstrate that knockdown of an irrelevant protein does not affect TER. * indicates p < 1 x 10-8 for comparison between JAM1 siRNA and the control. D, to investigate the effect of the JAM1 knockdown on paracellular macromolecule flux, FITC-dextran (size, 4 kDa) flux was measured in cell monolayers treated with JAM1 siRNA and compared with controls. * indicates p < 5 x 10-4.

 
TER is considered an indicator of passive paracellular ion flux. Having observed that knockdown of JAM1 decreased TER, experiments were also performed to examine the effect of JAM1 knockdown on FITC-dextran (4 kDa) flux, a measure of paracellular permeability to macromolecules. As shown in Fig. 1D, monolayers treated with JAM1 siRNA were 5-fold more permeable to FITC-dextran than control cells (p < 5 x 10-4). Together these results suggest that, in addition to decreasing TER, knockdown of JAM1 increases paracellular diffusion of macromolecules.

JAM1 Expression Affects Epithelial Cell Morphology—To optimize conditions for siRNA transfection, a variety of cell densities were initially tested. Interestingly, when cells were transfected with JAM1 siRNA at low densities (<30% confluent), dramatic changes in cell morphology were observed that were not observed in confluent monolayers. As shown in Fig. 2A, cells treated with control siRNA formed cohesive clusters typical of epithelial cells (control siRNA). In contrast, cultures treated with JAM1 siRNA appeared to lose their cohesive phenotype, exhibiting stellate-shaped morphology with long filopodia-like extensions (Fig. 2A, JAM1 siRNA). To determine whether this effect on epithelial cell morphology was specific to knockdown of JAM1, two other JAM1 siRNA targets were tested, and similar changes in morphology were observed (data not shown). To demonstrate that this was not a generic effect of knockdown of any protein, cells were treated with siRNA directed at Lamin A/C and cyclophilin B. No changes in morphology, however, were observed with Lamin A/C or cyclophilin B (data not shown). Thus, knockdown of JAM1 appeared to have a specific effect on epithelial cell morphology that was not observed with control siRNA or with siRNA targeting other irrelevant proteins.



View larger version (146K):
[in this window]
[in a new window]
  		FIG. 2.
Changes in epithelial cell morphology with knockdown of JAM1 and overexpression of a JAM1 truncation mutant. A, subconfluent cultures of SK-CO15 epithelial cells were transfected with siRNA against JAM1 or control siRNA. Phase contrast microscopy revealed marked changes in cell morphology with knockdown of JAM1. As shown, control siRNA-treated cells formed tightly aggregated clusters typical of epithelial cells, whereas JAM1 siRNA-treated cells were seen as stellate-shaped cells with long filopodia-like projections. B, SK-CO15 epithelial cells stably expressing a JAM1 truncation mutant (DL1) demonstrated morphologic changes similar to those observed with JAM1 knockdown. Control cells transfected with empty vector formed typical epithelial clusters. Scale bar, 40 µm.

 
To further investigate the effect of JAM1 expression on epithelial cell morphology, SK-CO15 cells were stably transfected with DNA encoding a JAM1 mutant lacking the N-terminal Ig-like loop (DL1), which lacks the putative homodimer interface. As shown in Fig. 2B, cells expressing the empty vector (Control Plasmid) formed cohesive epithelial clusters, whereas cells expressing the DL1 mutant (DL1 Mutant) lost the cohesive epithelial phenotype, forming spindle-shaped cells with long filopodia-like extensions. These morphologic changes bore striking similarity to those seen with JAM1 knockdown, lending further support to the notion that JAM1 expression affects epithelial cell morphology.

Effects of JAM1 Knockdown on Cell-Matrix Adhesion and Spreading—Given that the knockdown of JAM1 was observed to affect epithelial cell morphology, experiments were performed to investigate whether these morphologic changes involved changes in cell-matrix interactions. Epithelial cells bind to a variety of extracellular matrix proteins, including collagen I, collagen IV, fibronectin, and laminins. Preliminary adhesion experiments revealed that SK-CO15 cells adhered to collagen I, collagen IV, and fibronectin with high affinity and less so to laminins (data not shown). Further experiments were therefore conducted using only collagen I, collagen IV, and fibronectin.

To determine whether knockdown of JAM1 affected cell-matrix adhesion, cells were treated with siRNA directed at JAM1 or control siRNA. Three days post-transfection, the cells were harvested and incubated in wells coated with collagen I, collagen IV, or fibronectin. After a 1-h incubation, the wells were washed, and the bound cells were quantified by crystal violet staining. As shown on Fig. 3A, treatment with JAM1 siRNA significantly reduced cell adhesion to collagen I, collagen IV, and fibronectin as compared with controls (p < 5 x 10-3 for all three comparisons). In addition to cell-matrix adhesion experiments, experiments were performed to assess the effect of JAM1 knockdown on cell spreading on specific matrices. Spreading experiments were performed as described for the adhesion assays, but cells were added to each well at a 5-fold lower density to allow for spreading and to facilitate observation of morphology of individual cells. As illustrated in Fig. 3C, significant differences in cell spreading on collagen I were observed between JAM1 siRNA-treated cells and controls. In control cultures, the majority of cells appeared either polygonal in shape or had visible evidence of filopodia extensions (Fig. 3C, Control siRNA). In contrast, a large proportion of the JAM1 siRNA-treated cells were round in appearance, demonstrating a bright, uniform phase-contrasted ring surrounding the entire cell (Fig. 3C, JAM1 siRNA). To quantify these changes, the number of round and spreading cells was counted from a series of images for each culture, and the percentage of spreading cells was calculated accordingly. As shown in Fig. 3B, cell spreading on collagen I was reduced from 92% in the control group to 54% in the JAM1 siRNA group (p < 1 x 10-8). Similar differences in cell spreading were also seen with collagen IV and fibronectin (data not shown). It should be noted that trypan blue and propidium iodide exclusion tests were performed and confirmed that the round cells seen in Fig. 3C were viable and not undergoing apoptosis (data not shown). Together, these results suggest that JAM1 knockdown affects cell adhesion and cell spreading on specific extracellular matrix components.



View larger version (78K):
[in this window]
[in a new window]
  		FIG. 3.
Effect of JAM1 knockdown on cell-matrix adhesion and cell spreading. A, SK-CO15 epithelial cells were treated with siRNA against JAM1 (dark bars) or control siRNA (light bars) and loaded into microtiter plates coated with collagen I, collagen IV, or fibronectin. After 1 h of incubation, the wells were washed repeatedly to remove nonadherent cells, and the remaining adherent cells were fixed and stained with crystal violet. Cell adhesion was assessed in a microplate reader by determining A570. Bovine serum albumin-coated wells were used as a negative control. * indicates p < 5 x 10-3 for each comparison. B, SK-CO15 cells treated with JAM1 siRNA or control siRNA were incubated in wells coated with collagen I, but weakly adherent cells were not washed off. The images were captured by phase contrast microscopy, and the percentage of spreading cells was calculated as the number of spreading cells/field divided by the total number of cells/field. * indicates p < 1 x 10-8. C, phase contrast images illustrating an increased number of round, nonspreading cells in cultures treated with JAM1 siRNA as compared with the control.

 
Knockdown of JAM1 and Expression of a JAM1 Truncation Mutant Decrease {beta}1 Integrin Levels—Having observed that JAM1 knockdown affected cell-matrix adhesion and cell spreading on specific extracellular matrix components (Fig. 3), experiments were performed to identify adhesion molecules that may mediate this effect. More specifically, {beta}1 integrins are expressed on epithelial cells and are known to mediate binding to broad group of extracellular matrix components, including collagen I, collagen IV, and fibronectin (45). Experiments were therefore performed to determine whether {beta}1 integrin expression was affected by the knockdown of JAM1.

To test the hypothesis that knockdown of JAM1 disrupts {beta}1 integrin expression, immunoblots were performed with lysate from SK-CO15 cells treated with JAM1 siRNA or control siRNA. As shown in Fig. 4, cells treated with JAM1 siRNA had significantly less total {beta}1 integrin compared with control cells. Likewise, {beta}1 integrin expression was also reduced in cells expressing the JAM1 truncation mutant (Fig. 4, DL1) as compared with cells expressing empty vector (Fig. 4, Control). In contrast to the changes in {beta}1 integrins, knockdown of JAM1 or expression of the DL1 mutant did not affect levels of {beta}4 integrins, E-cadherin, or ZO-1 (Fig. 4). The lack of change in {beta}4 integrins suggests that the observed effect on {beta}1 integrins is not a generalized effect on all epithelial integrins. In addition, the lack of change in E-cadherin and ZO-1 argues against this being a global change in cell phenotype as seen with epithelial-mesenchymal transition (46). These results suggest that JAM1 expression specifically affects {beta}1 integrin protein levels, and this is consistent with the observed differences in cell-matrix adhesion and spreading presented in Fig. 3.



View larger version (23K):
[in this window]
[in a new window]
  		FIG. 4.
Decreased {beta}1 integrin protein levels with knockdown of JAM1 and overexpression of a JAM1 truncation mutant. Lysates were prepared from SK-CO15 cells treated with JAM1 siRNA or control siRNA and from cells stably expressing a JAM1 truncation mutant lacking the N-terminal Ig-like loop (DL1) or empty vector (Control). Levels of JAM1, {beta}1 integrin, {beta}4 integrin, ZO-1, and E-cadherin proteins were assessed by Western blot. Actin is shown as a loading control. Note that two bands are seen for cells expressing the DL1 mutant: the high molecular mass band corresponding to endogenous JAM1 and the low molecular mass band corresponding to the DL1 mutant. In addition, the polyclonal antibody against {beta}1 integrin reacts with both the 115-kDa precursor and 130-kDa mature protein, resulting in two bands (67).

 
JAM1 Expression Affects the Cellular Localization of {beta}1 Integrins—In addition to examining changes in {beta}1 integrin protein levels (Fig. 4), experiments were performed to determine whether JAM1 knockdown affects the cellular localization of {beta}1 integrins. SK-CO15 cultures were treated with siRNA directed at JAM1 or control siRNA, and localization of JAM1 and {beta}1 integrins was assessed by confocal fluorescence microscopy. As shown in Fig. 5, JAM1 and {beta}1 integrin colocalized in the lateral cell membrane in control cells (top panels). In cells treated with JAM1 siRNA, however, no lateral cell membrane staining of {beta}1 integrins was observed, and {beta}1 integrins were visible in intracellular vesicle-like structures (Fig. 5, bottom panels). A similar lack of lateral cell membrane-associated {beta}1 integrin was also observed in cells expressing the JAM1 truncation mutant DL1 (data not shown). Overall, these results suggest that JAM1 expression affects the cellular localization of {beta}1 integrins, and these differences are consistent with the observed effect of JAM1 knockdown on cell-matrix adhesion and spreading (Fig. 3).



View larger version (49K):
[in this window]
[in a new window]
  		FIG. 5.
Knockdown of JAM1 affects the cellular localization of {beta}1 integrins. Confocal immunofluorescence microscopy was used to investigate the effect of JAM1 knockdown on {beta}1 integrin localization in subconfluent SK-CO15 epithelial cell cultures. In cells treated with control siRNA, {beta}1 integrin (green) and JAM1 (red) were observed to colocalize in the lateral membrane at points of cell contact (bottom panel). In cells treated with JAM1 siRNA, JAM1 expression was not detectable, and {beta}1 integrin was observed in intracellular vesicle-like structures with no staining observed in the lateral membrane. The nuclei are shown in blue in the merged images. Scale bar, 5 µm.

 
Knockdown of JAM1 Decreases Rap1 Activity—Ras GTPases are family of small GTP-binding proteins known to regulate cell-matrix interactions and integrin function (47). Of these Ras family members, Rap1 has specifically been linked to {beta}1 integrin activation not only in hematopoeitic cells (44, 48–52) but also more recently in epithelial cells (53). Furthermore, evidence suggests that Rap1 can interact with AF-6 (54–57), a junction-associated scaffold protein reported to bind JAM1 via its C-terminal PDZ domain (33). Given that Rap1 is known to activate {beta}1 integrins and to interact with putative binding partner of JAM1, we sought to investigate whether Rap1 activity was affected by knockdown of JAM1. Before assaying Rap1 activity, however, the expression of Rap1 in SK-CO15 epithelial cells was confirmed by confocal immunofluorescence microscopy. As shown in Fig. 6, JAM1 and Rap1 colocalized at intercellular junctions in confluent SK-CO15 monolayers. These results demonstrate that JAM1 and Rap1 are localized in close proximity at intercellular junctions, and this is consistent with reports that they may interact within a common scaffold protein AF-6.



View larger version (39K):
[in this window]
[in a new window]
  		FIG. 6.
Rap1 colocalizes with JAM1 at intercellular junctions. Confluent SK-CO15 monolayers were pretreated with a cytoskeleton stabilization buffer containing 1% Triton X-100, fixed, and labeled with antibodies against JAM1 and Rap1. Immunofluorescent confocal microscopy revealed colocalization of JAM1 (green) and Rap1 (red) at intercellular junctions. Scale bar, 5 µm.

 
To investigate whether knockdown of JAM1 affects Rap1 activity, SK-CO15 cells were treated with either JAM1 siRNA or control siRNA, and active GTP-Rap1 was isolated from cell lysates using a standard pull-down procedure (44). As shown in Fig. 7, knockdown of JAM1 by siRNA dramatically reduced levels of active Rap1 compared with the control, and total Rap1 levels were unchanged. Similar experiments were also performed using cells expressing the JAM1 truncation mutant DL1. As with JAM1 knockdown, expression of the JAM1 mutant DL1 markedly decreased Rap1 activity compared with the control, whereas total Rap1 levels remained unchanged (Fig. 7). Taken together, these results suggest that knockdown of JAM1 or expression of a truncated form of JAM1 lacking the putative homodimer interface specifically decreased Rap1 activity in epithelial cells. Given that Rap1 is known to activate {beta}1 integrins, the observed decrease in Rap1 activity is consistent with the effects of JAM1 knockdown on cell-matrix interactions (Fig. 3) and {beta}1 integrin expression (Figs. 4 and 5).



View larger version (18K):
[in this window]
[in a new window]
  		FIG. 7.
Knockdown of JAM1 and overexpression of a JAM1 truncation mutant decrease Rap1 activity. Lysates were prepared from SK-CO15 epithelial cells treated with JAM1 siRNA or control siRNA or from SK-CO15 cells stably transfected with a JAM1 truncation mutant (DL1) or empty vector (Control). Pull-down assays were performed to isolate active GTP-bound Rap1. Western blots for Rap1 revealed decreased levels of active Rap1 in cells treated with JAM1 siRNA and in cells expressing the JAM1 mutant. No change in the total Rap1 level was observed with JAM1 siRNA treatment or with JAM1 mutant overexpression. Note that in lanes containing active GTP-Rap1, a doublet was observed with bands at 24 and 22 kDa. These bands are thought to represent phosphorylated and unphosphorylated forms of the Rap1 protein (68).

 
Knockdown of Rap1b Affects Epithelial Cell Morphology and {beta}1 Integrin Expression—Given that knockdown of JAM1 and expression of the DL1 mutant were observed to decrease Rap1 activity (Fig. 7), experiments were performed to determine whether the loss of Rap1 expression would recapitulate the effects of JAM1 knockdown on cell morphology and {beta}1 integrin expression. Subconfluent SK-CO15 epithelial cell cultures were transfected with siRNA directed against Rap1b, Rap1a, or control siRNA. As illustrated in Fig. 8A, siRNA directed against Rap1b markedly altered cell morphology. Compared with control cells, which formed cohesive epithelial clusters, Rap1b siRNA-treated cells became stellate-shaped with long filopodia-like extensions, closely resembling the morphology of cells treated with JAM1 siRNA (Fig. 8A). In contrast to results obtained with Rap1b siRNA, transfection with siRNA against Rap1a resulted in no significant effects on cellular morphology (data not shown). To confirm knockdown of Rap1b, Western blots were performed. As shown in Fig. 8B, total Rap1 levels were reduced by treatment with Rap1b siRNA, and a decrease in total {beta}1 integrin levels was observed with knockdown of Rap1b. In addition, confocal immunofluorescence microscopy demonstrated that knockdown of Rap1b effectively abolished staining of {beta}1 integrins at intercellular junctions (Fig. 8C). Overall, these results support previous studies suggesting the importance of Rap1 in the regulation of epithelial cell morphology and {beta}1 integrin expression (47, 53). More importantly, the changes in cell morphology and {beta}1 integrin expression induced by Rap1b knockdown are analogous to those seen with JAM1 knockdown and expression of the DL1 mutant (Figs. 2, 4, and 5). Given that knockdown of JAM1 and expression of the DL1 mutant were also observed to decrease Rap1 activity (Fig. 7), these results suggest that Rap1 may mediate the effects of JAM1 on cell morphology and {beta}1 integrins.



View larger version (72K):
[in this window]
[in a new window]
  		FIG. 8.
Knockdown of Rap1b affects {beta}1 integrin expression and cell morphology in a manner similar to that observed with knockdown of JAM1. SK-CO15 epithelial cells were treated with siRNA against Rap1b. A, knockdown of Rap1b induced morphologic changes closely resembling that of cells treated with JAM1 siRNA. Scale bar, 40 µm. B, knockdown of Rap1b decreased total {beta}1 integrin levels as assessed by Western blot. C, immunofluorescent confocal images revealed absence of {beta}1 integrins at cell junctions in cells treated with Rap1b siRNA as compared with controls exhibiting strong junctional {beta}1 integrin staining. Scale bar, 10 µm.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
Consistent with previous antibody-based studies, we observed that knockdown of JAM1 resulted in enhanced paracellular permeability. In addition, we report a novel observation involving the effect of JAM1 knockdown on epithelial cell morphology and {beta}1 integrin expression and activity. Similar effects on cell morphology and {beta}1 integrins expression were also seen in cells stably expressing a JAM1 mutant lacking the putative homodimer interface. Confocal immunofluorescence microscopy revealed that JAM1 colocalized with the small GTPase Rap1, a known activator of {beta}1 integrins, and knockdown of JAM1 and overexpression of a JAM1 mutant both resulted in decreased Rap1 activity. Lastly, knockdown of Rap1b was shown to alter cellular morphology and to decrease {beta}1 integrin expression and localization at cell junctions in manner analogous to that seen with JAM1 knockdown. Our results provide new evidence to support a role for JAM1 in regulation of epithelial cell morphology and {beta}1 integrin expression and to suggest that the small GTPase Rap1 mediates this effect.

Knockdown of JAM1 Increases Epithelial Permeability—In our previous study, we observed that antibodies to JAM1 inhibited the recovery of barrier function after TJ disassembly, and evidence suggests that these function-blocking antibodies bind to a region of JAM1 critical for homodimer formation (13, 17, 18). In our present study, we observed that knockdown of JAM1 by siRNA dramatically decreased TER and increased FITC-dextran flux (Fig. 1). Such effects appear to be specifically related to a loss of JAM1 expression, because siRNA directed at Lamin A/C (Fig. 1) and cyclophilin B (not shown) did not affect TER. Overall, our results suggest that JAM1 expression is critical for epithelial barrier function, and these results are consistent with previous antibody-based studies.

It was recently reported that transfection with siRNA at high concentrations (~330 nM) may induce nonspecific interferon-like responses via activation of toll-like receptor 3 (TLR3) (58). In our present study, however, siRNA was delivered at concentrations well below the level reported to be toxic (40 nM). In addition, enzyme-linked immunosorbent assays were performed to assess interleukin 8 secretion, a known indicator of the TLR3 response, and JAM1 siRNA treatment was not observed to enhance interleukin 8 secretion as compared with other siRNA controls (data not shown). These results suggest that the effect of JAM1 siRNA on barrier function was not attributable to a TLR3-mediated response.

JAM1 Expression Affects Epithelial Cell Morphology, Adhesion, and Spreading—In optimizing conditions for siRNA transfections, we observed a marked change in morphology when low density cultures of SK-CO15 cells were treated with JAM1 siRNA (Fig. 2A). As discussed above, multiple siRNA controls were employed to confirm that these changes were not due to off-target effects or TLR3-mediated inflammatory responses. In addition to siRNA-based experiments, changes in cell morphology were also observed in cells stably expressing a JAM1 truncation mutant lacking the N-terminal Ig-like loop, the same region that contains the putative homodimer interface (29, 31) (Fig. 2B). Together these observations suggest that JAM1 expression is important for regulation of epithelial cell morphology. These results also support the significance of JAM1 homodimer formation for its function in cells (17, 29–31).

Given the observed changes in cell morphology (Fig. 2), experiments were conducted to determine whether these morphologic changes involved changes in cell-matrix interactions. As illustrated in Fig. 3A, knockdown of JAM1 by siRNA decreased cell-matrix adhesion on collagen I, collagen IV, and fibronectin. In addition, knockdown of JAM1 was observed to reduce cell spreading on collagen I (Fig. 3, B and C). Because decreased cell-matrix interactions and altered morphology were observed concurrently in response to JAM1 knockdown, it is possible that the morphologic changes are a direct consequence of altered adhesion and spreading. However, it is also possible that the changes in morphology and matrix interactions result from disruption of a common pathway. For example, knockdown of JAM1 could potentially influence the cytoskeleton in a manner that affects both cell morphology and expression of adhesion molecules critical for cell-matrix interactions. In this study, we observed changes in Rap1 activity with JAM1 knockdown and mutant overexpression (Fig. 7). Although Rap1 is known to regulate {beta}1 integrin activity, evidence also suggests Rap1 is involved in cytoskeletal regulation (59). Thus, it is possible that the JAM1-related changes in cell morphology involve changes in both {beta}1 integrin activity and cytoskeletal dynamics, both of which may be mediated by the small GTPase Rap1.

Overall, our results suggest that JAM1 plays a role in regulating cell-matrix interactions in epithelial cells, which is consistent with a recent report that knockdown of JAM1 affects endothelial cell adhesion and migration on vitronectin (26). These effects of JAM1 expression in endothelial cells appeared to be mediated by interactions between JAM1 and the integrin {alpha}V{beta}3 (vitronectin receptor) (25, 26). In our present study, we tested whether SK-CO15 epithelial cells adhered to vitronectin, and only minimal adhesion was observed (data not shown). Lack of binding to vitronectin is consistent with reports that {beta}3 integrins are not expressed in many intestinal epithelial cell lines (60). Although we recognize that there are major differences between endothelial cells and epithelial cells, our results support the notion that JAM1 expression affects integrin-mediated adhesion to specific extracellular matrix proteins in both epithelial and endothelial systems.

JAM1 Expression Affects {beta}1 Integrin Expression and Localization in Cells—{beta}1 integrins are a family of heterodimeric cell adhesion molecules known to mediate interaction with the extracellular matrix and play an important role in regulation of cell adhesion and spreading (45). Knockdown of JAM1 was observed to decrease cell adhesion on collagen I, collagen IV, and fibronectin, which are known ligands of {beta}1 integrins (Fig. 3). Western blots revealed that knockdown of JAM1 reduced total {beta}1 integrin levels compared with the siRNA control (Fig. 4), and similar effects were seen in cells expressing the JAM1 truncation mutant lacking the N-terminal Ig-like loop (Fig. 4). Consistent with the observed changes in total {beta}1 integrin protein, confocal microscopy revealed a loss of {beta}1 integrin in the lateral membranes of cells treated with JAM1 siRNA (Fig. 5). Although {beta}1 integrin staining was relatively weak in cells treated with JAM1 siRNA, {beta}1 integrin was visible in cytoplasmic vesicle-like structures (Fig. 5). Although the mechanism responsible for these changes in {beta}1 integrins remains unclear, the observed loss of surface {beta}1 integrin is consistent with decreased cell-matrix adhesion and spreading seen with knockdown of JAM1 (Fig. 3).

In interpreting the observed changes in {beta}1 integrin levels and localization, it is important to consider that knockdown of JAM1 by siRNA did not affect total {beta}4 integrin, ZO-1, or E-cadherin levels (Fig. 4). The lack of change in {beta}4 integrin levels suggests that the effect of JAM1 on cell-matrix adhesion is mediated specifically through changes in {beta}1 integrins and not integrins as a whole. In addition, E-cadherin is considered to be a marker of epithelial differentiation, so the lack of changes in E-cadherin levels (Fig. 5) suggests that the morphologic changes associated with JAM1 knockdown are not due to a gross change in the epithelial phenotype such as epithelial-mesenchymal transition (46). In addition, cells treated with JAM1 siRNA were tested for expression of vimentin, a known mesenchymal marker, but no vimentin expression was detected (data not shown). Together these results suggest that the morphologic changes observed with JAM1 knockdown specifically involved changes in {beta}1 integrins and not broad changes in gene expression affecting the epithelial phenotype.

Knockdown of JAM1 Affects Rap1 Activity—Our results suggest that changes in {beta}1 integrins may play an important role in mediating the effects of JAM1 knockdown on epithelial cell morphology. To date, no known connection between JAM1 and {beta}1 integrins has been established. Some studies suggest that JAM1 interacts directly with {beta}2 integrins on leukocytes (23) and with {beta}3 integrins in endothelial cells (25), but no direct interactions between JAM1 and {beta}1 integrin have been reported in epithelial cells or any other cells known to express JAM1. To investigate the possibility of direct interactions between {beta}1 integrin and JAM1 in SK-CO15 cells, we performed coimmunoprecipitation experiments, but no evidence of direct interaction between {beta}1 integrin and JAM1 was observed (data not shown). Given that JAM1 and {beta}1 integrins did not appear to interact directly, experiments were then performed to investigate potential mechanisms by which JAM1 expression may indirectly affect {beta}1 integrins.

Studies have shown that the cytoplasmic tail of JAM1 can bind to various PDZ-containing proteins, including ZO-1, AF-6, Par3, and CASK (32–36). It is therefore possible that the cytoplasmic tail of JAM1 mediates interactions with PDZ-containing proteins that affect {beta}1 integrin expression and activity. For example, evidence suggests that AF-6 affects activity of Rap1 (55), a small GTPase known to activate {beta}1 integrins (47). In addition, staining of SK-CO15 monolayers revealed that Rap1 colocalizes with JAM1 at intercellular junctions (Fig. 6). We therefore sought to investigate whether Rap1 activity was affected by the knockdown of JAM1. As shown in Fig. 7, treatment of cells with siRNA against JAM1 or stable expression of a JAM1 truncation mutant produced dramatic decreases in Rap1 activity. In addition, knockdown of Rap1b by siRNA produced similar effects on epithelial morphology and {beta}1 integrin expression as observed with knockdown of JAM1. Interestingly, Rap1a is 95% homologous to Rap1b (61), but knockdown of Rap1a did not appear to affect cell morphology (data not shown). It is not clear why knockdown of the Rap1b isoform would have this effect and not Rap1a, but perhaps this phenomenon reflects differences in their targeting or localization in epithelial cells.

To date, no clear biochemical link between Rap1 and JAM1 has been established. One potential mechanism of interaction could be through the PDZ-containing protein AF-6, which has been reported to interact with both Rap1 (54–57) and JAM1 (33). Although AF-6 is an attractive candidate for connecting JAM1 to the Rap1 pathway, AF-6 is one of many PDZ-containing proteins expressed at cell junctions. Rap1 has also been shown to bind to PDZ-GEFs, a family of GTP exchange factors specific for Rap1, and to contain PDZ domains (62). PDZ-GEFs were originally described in Caenorhabditis elegans (63) and subsequently in Drosophila (64). Evidence suggest that PDZ-GEFs are expressed abundantly in brain tissue (65, 66), but expression and localization of PDZ-GEFs in intestinal epithelial cells has yet to be investigated. Future studies may explore the expression and localization of Rap1-associated PDZ proteins in epithelial cells and investigate whether such proteins mediate interactions with JAM1 that affect {beta}1 integrin activity and epithelial morphology.

In summary, we have shown that loss of JAM1 expression or introduction of a JAM1 mutant lacking the putative homodimer interface resulted in dramatic alterations in epithelial cell morphology. Such changes were accompanied by decreased {beta}1 integrin expression and reduction in Rap1 activity, a known activator of {beta}1 integrins. As illustrated in the schematic in Fig. 9, we speculate that the loss of JAM1 expression or disruption of JAM1 dimerization affects PDZ proteins such as AF-6, whose binding to JAM1 is required for activation of Rap1 and {beta}1 integrin expression. Although not specifically addressed in this study, we predict that Rap1-dependent cytoskeletal changes may also contribute to the effects of JAM1 on cell morphology. Further studies will help to better define the signaling pathways that mediate JAM1 function in epithelial cells.



View larger version (20K):
[in this window]
[in a new window]
  		FIG. 9.
Schematic diagram of how JAM1 may regulate epithelial cell function. The N-terminal Ig-like loop of JAM1 has been shown to mediate homodimer formation and regulate its function in epithelial cells (17, 18, 29–31), and the cytoplasmic tail of JAM1 has been reported to interact with junction-associated PDZ proteins such as AF-6 (33). Evidence suggests that AF-6 also interacts with Rap1 (54–57), a small GTPase known to activate {beta}1 integrins and regulate cytoskeletal dynamics (44,48–53,59). In this study, we report that that the loss of JAM1 expression or deletion of the JAM1 dimerization domain causes dramatic changes in epithelial cell morphology associated with decreased Rap1 activity and down-regulation and mislocalization of {beta}1 integrins. As shown in the figure, these findings could be explained if the loss of JAM1 or disruption of JAM1 dimerization at the cell surface (A) disrupts PDZ-mediated binding of AF-6/Rap1 complexes (B), which in turn impairs expression of {beta}1 integrins (C). Although not directly addressed in this study, we predict that Rap1-dependent cytoskeletal changes (D) may also contribute to the effects of JAM1 on epithelial morphology.

 

   FOOTNOTES
 
* This work was supported by National Institutes of Health Grants R01 DK72564, R01 DK61379, R01 DK59888 and DDRDC DK64399 and by an award from the American Heart Association, Southeast Affiliate. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

{ddagger} To whom correspondence should be addressed: Epithelial Pathobiology Research Unit, Dept. of Pathology and Laboratory Medicine, Emory University School of Medicine, 615 Michael St., Rm. 125, Atlanta, GA 30322. Tel.: 404-727-8541; Fax: 404-727-8538; E-mail: kjmande{at}emory.edu.

1 The abbreviations used are: TJ, tight junction; JAM, junctional adhesion molecule; siRNA, small interfering RNA; TER, transepithelial resistance; FITC, fluorescein isothiocyanate; HBSS, Hanks' balanced salt solution; MES, 4-morpholineethanesulfonic acid; TLR, toll-like receptor. Back


   ACKNOWLEDGMENTS
 
We thank Susan Voss and Denice Esterly for tissue culture expertise and Andrei Ivanov, Matthew Whalin, and Matthew Palmer for assistance in preparing this manuscript.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Madara, J. L., Parkos, C., Colgan, S., Nusrat, A., Atisook, K., and Kaoutzani, P. (1992) Ann. N. Y. Acad. Sci. 664, 47-60[Medline] [Order article via Infotrieve]
  2. Fasano, A. (2000) Ann. N. Y. Acad. Sci. 915, 214-222[Medline] [Order article via Infotrieve]
  3. Godfrey, R. W. (1997) Microsc. Res. Tech. 38, 488-499[CrossRef][Medline] [Order article via Infotrieve]
  4. Huber, J. D., Egleton, R. D., and Davis, T. P. (2001) Trends Neurosci. 24, 719-725[CrossRef][Medline] [Order article via Infotrieve]
  5. Martin, T. A., and Jiang, W. G. (2001) Histol. Histopathol. 16, 1183-1195[Medline] [Order article via Infotrieve]
  6. Hoover, K. B., Liao, S. Y., and Bryant, P. J. (1998) Am. J. Pathol. 153, 1767-1773[Abstract/Free Full Text]
  7. Tobioka, H., Isomura, H., Kokai, Y., Tokunaga, Y., Yamaguchi, J., and Sawada, N. (2004) Hum. Pathol. 35, 159-164[CrossRef][Medline] [Order article via Infotrieve]
  8. Tsukita, S., Furuse, M., and Itoh, M. (2001) Nat. Rev. Mol. Cell. Biol. 2, 285-293[CrossRef][Medline] [Order article via Infotrieve]
  9. Matter, K., and Balda, M. S. (2003) Nat. Rev. Mol. Cell. Biol. 4, 225-236[CrossRef][Medline] [Order article via Infotrieve]
  10. Malergue, F., Galland, F., Martin, F., Mansuelle, P., Aurrand-Lions, M., and Naquet, P. (1998) Mol. Immunol. 35, 1111-1119[CrossRef][Medline] [Order article via Infotrieve]
  11. Martin-Padura, I., Lostaglio, S., Schneemann, M., Williams, L., Romano, M., Fruscella, P., Panzeri, C., Stoppacciaro, A., Ruco, L., Villa, A., Simmons, D., and Dejana, E. (1998) J. Cell Biol. 142, 117-127[Abstract/Free Full Text]
  12. Williams, L. A., Martin-Padura, I., Dejana, E., Hogg, N., and Simmons, D. L. (1999) Mol. Immunol. 36, 1175-1188[CrossRef][Medline] [Order article via Infotrieve]
  13. Liu, Y., Nusrat, A., Schnell, F. J., Reaves, T. A., Walsh, S., Pochet, M., and Parkos, C. A. (2000) J. Cell Sci. 113, 2363-2374[Abstract]
  14. Gupta, S. K., Pillarisetti, K., and Ohlstein, E. H. (2000) IUBMB Life 50, 51-56[Medline] [Order article via Infotrieve]
  15. Naik, U. P., Ehrlich, Y. H., and Kornecki, E. (1995) Biochem. J. 310, 155-162[Medline] [Order article via Infotrieve]
  16. Sobocka, M. B., Sobocki, T., Banerjee, P., Weiss, C., Rushbrook, J. I., Norin, A. J., Hartwig, J., Salifu, M. O., Markell, M. S., Babinska, A., Ehrlich, Y. H., and Kornecki, E. (2000) Blood 95, 2600-2609[Abstract/Free Full Text]
  17. Mandell, K. J., McCall, I. C., and Parkos, C. A. (2004) J. Biol. Chem. 279, 16254-16262[Abstract/Free Full Text]
  18. Liang, T. W., DeMarco, R. A., Mrsny, R. J., Gurney, A., Gray, A., Hooley, J., Aaron, H. L., Huang, A., Klassen, T., Tumas, D. B., and Fong, S. (2000) Am. J. Physiol. 279, C1733-C1743
  19. Kornecki, E., Walkowiak, B., Naik, U. P., and Ehrlich, Y. H. (1990) J. Biol. Chem. 265, 10042-10048[Abstract/Free Full Text]
  20. Babinska, A., Kedees, M. H., Athar, H., Sobocki, T., Sobocka, M. B., Ahmed, T., Ehrlich, Y. H., Hussain, M. M., and Kornecki, E. (2002) Thromb. Haemostasis 87, 712-721[Medline] [Order article via Infotrieve]
  21. Babinska, A., Kedees, M. H., Athar, H., Ahmed, T., Batuman, O., Ehrlich, Y. H., Hussain, M. M., and Kornecki, E. (2002) Thromb. Haemostasis 88, 843-850[Medline] [Order article via Infotrieve]
  22. Ozaki, H., Ishii, K., Arai, H., Horiuchi, H., Kawamoto, T., Suzuki, H., and Kita, T. (2000) Biochem. Biophys. Res. Commun. 276, 873-878[CrossRef][Medline] [Order article via Infotrieve]
  23. Ostermann, G., Weber, K. S., Zernecke, A., Schroder, A., and Weber, C. (2002) Nat. Immunol. 3, 151-158[CrossRef][Medline] [Order article via Infotrieve]
  24. Del Maschio, A., De Luigi, A., Martin-Padura, I., Brockhaus, M., Bartfai, T., Fruscella, P., Adorini, L., Martino, G., Furlan, R., De Simoni, M. G., and Dejana, E. (1999) J. Exp. Med. 190, 1351-1356[Abstract/Free Full Text]
  25. Naik, M. U., Mousa, S. A., Parkos, C. A., and Naik, U. P. (2003) Blood 102, 2108-2114[Abstract/Free Full Text]
  26. Naik, M. U., Vuppalanchi, D., and Naik, U. P. (2003) Arterioscler. Thromb. Vasc. Biol. 23, 2165-2171[Abstract/Free Full Text]
  27. Barton, E. S., Forrest, J. C., Connolly, J. L., Chappell, J. D., Liu, Y., Schnell, F. J., Nusrat, A., Parkos, C. A., and Dermody, T. S. (2001) Cell 104, 441-451[CrossRef][Medline] [Order article via Infotrieve]
  28. Forrest, J. C., Campbell, J. A., Schelling, P., Stehle, T., and Dermody, T. S. (2003) J. Biol. Chem. 278, 48434-48444[Abstract/Free Full Text]
  29. Prota, A. E., Campbell, J. A., Schelling, P., Forrest, J. C., Watson, M. J., Peters, T. R., Aurrand-Lions, M., Imhof, B. A., Dermody, T. S., and Stehle, T. (2003) Proc. Natl. Acad. Sci. U. S. A. 100, 5366-5371[Abstract/Free Full Text]
  30. Bazzoni, G., Martinez-Estrada, O. M., Mueller, F., Nelboeck, P., Schmid, G., Bartfai, T., Dejana, E., and Brockhaus, M. (2000) J. Biol. Chem. 275, 30970-30976[Abstract/Free Full Text]
  31. Kostrewa, D., Brockhaus, M., D'Arcy, A., Dale, G. E., Nelboeck, P., Schmid, G., Mueller, F., Bazzoni, G., Dejana, E., Bartfai, T., Winkler, F. K., and Hennig, M. (2001) EMBO J. 20, 4391-4398[CrossRef][Medline] [Order article via Infotrieve]
  32. Bazzoni, G., Martinez-Estrada, O. M., Orsenigo, F., Cordenonsi, M., Citi, S., and Dejana, E. (2000) J. Biol. Chem. 275, 20520-20526[Abstract/Free Full Text]
  33. Ebnet, K., Schulz, C. U., Meyer Zu Brickwedde, M. K., Pendl, G. G., and Vestweber, D. (2000) J. Biol. Chem. 275, 27979-27988[Abstract/Free Full Text]
  34. Ebnet, K., Suzuki, A., Horikoshi, Y., Hirose, T., Meyer Zu Brickwedde, M. K., Ohno, S., and Vestweber, D. (2001) EMBO J. 20, 3738-3748[CrossRef][Medline] [Order article via Infotrieve]
  35. Itoh, M., Sasaki, H., Furuse, M., Ozaki, H., Kita, T., and Tsukita, S. (2001) J. Cell Biol. 154, 491-497[Abstract/Free Full Text]
  36. Martinez-Estrada, O. M., Villa, A., Breviario, F., Orsenigo, F., Dejana, E., and Bazzoni, G. (2001) J. Biol. Chem. 276, 9291-9296[Abstract/Free Full Text]
  37. Cera, M. R., Del Prete, A., Vecchi, A., Corada, M., Martin-Padura, I., Motoike, T., Tonetti, P., Bazzoni, G., Vermi, W., Gentili, F., Bernasconi, S., Sato, T. N., Mantovani, A., and Dejana, E. (2004) J. Clin. Invest. 114, 729-738[CrossRef][Medline] [Order article via Infotrieve]
  38. Lisanti, M. P., Caras, I. W., Davitz, M. A., and Rodriguez-Boulan, E. (1989) J. Cell Biol. 109, 2145-2156[Abstract/Free Full Text]
  39. Elbashir, S. M., Harborth, J., Lendeckel, W., Yalcin, A., Weber, K., and Tuschl, T. (2001) Nature 411, 494-498[CrossRef][Medline] [Order article via Infotrieve]
  40. Ivanov, A. I., Nusrat, A., and Parkos, C. A. (2004) Mol. Biol. Cell 15, 176-188[Abstract/Free Full Text]
  41. Sanders, S. E., Madara, J. L., McGuirk, D. K., Gelman, D. S., and Colgan, S. P. (1995) Epithelial Cell Biol. 4, 25-34[Medline] [Order article via Infotrieve]
  42. Yokosaki, Y., Palmer, E. L., Prieto, A. L., Crossin, K. L., Bourdon, M. A., Pytela, R., and Sheppard, D. (1994) J. Biol. Chem. 269, 26691-26696[Abstract/Free Full Text]
  43. Cramer, L. P., Briggs, L. J., and Dawe, H. R. (2002) Cell Motil Cytoskeleton 51, 27-38[CrossRef][Medline] [Order article via Infotrieve]
  44. Franke, B., Akkerman, J. W., and Bos, J. L. (1997) EMBO J. 16, 252-259[CrossRef][Medline] [Order article via Infotrieve]
  45. Plow, E. F., Haas, T. A., Zhang, L., Loftus, J., and Smith, J. W. (2000) J. Biol. Chem. 275, 21785-21788[Free Full Text]
  46. Blanco, D., Vicent, S., Elizegi, E., Pino, I., Fraga, M. F., Esteller, M., Saffiotti, U., Lecanda, F., and Montuenga, L. M. (2004) Lab. Invest. 84, 999-1012[CrossRef][Medline] [Order article via Infotrieve]
  47. Kinbara, K., Goldfinger, L. E., Hansen, M., Chou, F. L., and Ginsberg, M. H. (2003) Nat. Rev. Mol. Cell. Biol. 4, 767-776[Medline] [Order article via Infotrieve]
  48. Woulfe, D., Jiang, H., Mortensen, R., Yang, J., and Brass, L. F. (2002) J. Biol. Chem. 277, 23382-23390[Abstract/Free Full Text]
  49. Larson, M. K., Chen, H., Kahn, M. L., Taylor, A. M., Fabre, J. E., Mortensen, R. M., Conley, P. B., and Parise, L. V. (2003) Blood 101, 1409-1415[Abstract/Free Full Text]
  50. Kinashi, T., and Katagiri, K. (2004) Immunol. Lett. 93, 1-5[CrossRef][Medline] [Order article via Infotrieve]
  51. Kinashi, T., Aker, M., Sokolovsky-Eisenberg, M., Grabovsky, V., Tanaka, C., Shamri, R., Feigelson, S., Etzioni, A., and Alon, R. (2004) Blood 103, 1033-1036[Abstract/Free Full Text]
  52. Reedquist, K. A., Ross, E., Koop, E. A., Wolthuis, R. M., Zwartkruis, F. J., van Kooyk, Y., Salmon, M., Buckley, C. D., and Bos, J. L. (2000) J. Cell Biol. 148, 1151-1158[Abstract/Free Full Text]
  53. Enserink, J. M., Price, L. S., Methi, T., Mahic, M., Sonnenberg, A., Bos, J. L., and Tasken, K. (2004) J. Biol. Chem. 279, 44889-44896[Abstract/Free Full Text]
  54. Boettner, B., Harjes, P., Ishimaru, S., Heke, M., Fan, H. Q., Qin, Y., Van Aelst, L., and Gaul, U. (2003) Genetics 165, 159-169[Abstract/Free Full Text]
  55. Su, L., Hattori, M., Moriyama, M., Murata, N., Harazaki, M., Kaibuchi, K., and Minato, N. (2003) J. Biol. Chem. 278, 15232-15238[Abstract/Free Full Text]
  56. Boettner, B., Herrmann, C., and Van Aelst, L. (2001) Methods Enzymol. 332, 151-168[CrossRef][Medline] [Order article via Infotrieve]
  57. Boettner, B., Govek, E. E., Cross, J., and Van Aelst, L. (2000) Proc. Natl. Acad. Sci. U. S. A. 97, 9064-9069[Abstract/Free Full Text]
  58. Kariko, K., Bhuyan, P., Capodici, J., and Weissman, D. (2004) J. Immunol. 172, 6545-6549[Abstract/Free Full Text]
  59. Caron, E. (2003) J. Cell Sci. 116, 435-440[Abstract/Free Full Text]
  60. Stutzmann, J., Bellissent-Waydelich, A., Fontao, L., Launay, J. F., and Simon-Assmann, P. (2000) Microsc. Res. Tech. 51, 179-190[CrossRef][Medline] [Order article via Infotrieve]
  61. D'Silva, N. J., Mitra, R. S., Zhang, Z., Kurnit, D. M., Babcock, C. R., Polverini, P. J., and Carey, T. E. (2003) J. Cell. Physiol. 196, 532-540[CrossRef][Medline] [Order article via Infotrieve]
  62. Kuiperij, H. B., de Rooij, J., Rehmann, H., van Triest, M., Wittinghofer, A., Bos, J. L., and Zwartkruis, F. J. (2003) Biochim. Biophys. Acta 1593, 141-149[Medline] [Order article via Infotrieve]
  63. Liao, Y., Kariya, K., Hu, C. D., Shibatohge, M., Goshima, M., Okada, T., Watari, Y., Gao, X., Jin, T. G., Yamawaki-Kataoka, Y., and Kataoka, T. (1999) J. Biol. Chem. 274, 37815-37820[Abstract/Free Full Text]
  64. Lee, J. H., Cho, K. S., Lee, J., Kim, D., Lee, S. B., Yoo, J., Cha, G. H., and Chung, J. (2002) Mol. Cell. Biol. 22, 7658-7666[Abstract/Free Full Text]
  65. Rebhun, J. F., Castro, A. F., and Quilliam, L. A. (2000) J. Biol. Chem. 275, 34901-34908[Abstract/Free Full Text]
  66. Mino, A., Ohtsuka, T., Inoue, E., and Takai, Y. (2000) Genes Cells 5, 1009-1016[Abstract]
  67. Bellis, S. L., Newman, E., and Friedman, E. A. (1999) J. Cell. Physiol. 181, 33-44[CrossRef][Medline] [Order article via Infotrieve]
  68. Lapetina, E. G., Lacal, J. C., Reep, B. R., and Molina y Vedia, L. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 3131-3134[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 Arterioscler. Thromb. Vasc. Bio.Home page
X. Li, M. Stankovic, B. P.-L. Lee, M. Aurrand-Lions, C. N. Hahn, Y. Lu, B. A. Imhof, M. A. Vadas, and J. R. Gamble
JAM-C Induces Endothelial Cell Permeability Through Its Association and Regulation of {beta}3 Integrins
Arterioscler. Thromb. Vasc. Biol., August 1, 2009; 29(8): 1200 - 1206.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Biol. CellHome page
E. A. Severson, W. Y. Lee, C. T. Capaldo, A. Nusrat, and C. A. Parkos
Junctional Adhesion Molecule A Interacts with Afadin and PDZ-GEF2 to Activate Rap1A, Regulate {beta}1 Integrin Levels, and Enhance Cell Migration
Mol. Biol. Cell, April 1, 2009; 20(7): 1916 - 1925.
[Abstract] [Full Text] [PDF]

Home page
 J. Cell Sci.Home page
M. R. Cera, M. Fabbri, C. Molendini, M. Corada, F. Orsenigo, M. Rehberg, C. A. Reichel, F. Krombach, R. Pardi, and E. Dejana
JAM-A promotes neutrophil chemotaxis by controlling integrin internalization and recycling
J. Cell Sci., January 15, 2009; 122(2): 268 - 277.
[Abstract] [Full Text] [PDF]

Home page
 JCBHome page
A.-C. Luissint, P. G. Lutz, D. A. Calderwood, P.-O. Couraud, and S. Bourdoulous
JAM-L-mediated leukocyte adhesion to endothelial cells is regulated in cis by {alpha}4{beta}1 integrin activation
J. Cell Biol., December 15, 2008; 183(6): 1159 - 1173.
[Abstract] [Full Text] [PDF]

Home page
 ReproductionHome page
G. A Tarulli, S. J Meachem, S. Schlatt, and P. G Stanton
Regulation of testicular tight junctions by gonadotrophins in the adult Djungarian hamster in vivo
Reproduction, June 1, 2008; 135(6): 867 - 877.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Biol. CellHome page
E. A. Severson, L. Jiang, A. I. Ivanov, K. J. Mandell, A. Nusrat, and C. A. Parkos
Cis-Dimerization Mediates Function of Junctional Adhesion Molecule A
Mol. Biol. Cell, May 1, 2008; 19(5): 1862 - 1872.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
M. U. Naik, T. U. Naik, A. T. Suckow, M. K. Duncan, and U. P. Naik
Attenuation of Junctional Adhesion Molecule-A Is a Contributing Factor for Breast Cancer Cell Invasion
Cancer Res., April 1, 2008; 68(7): 2194 - 2203.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Gastrointest. Liver Physiol.Home page
L. T. Braiterman, S. Heffernan, L. Nyasae, D. Johns, A. P. See, R. Yutzy, A. McNickle, M. Herman, A. Sharma, U. P. Naik, et al.
JAM-A is both essential and inhibitory to development of hepatic polarity in WIF-B cells
Am J Physiol Gastrointest Liver Physiol, February 1, 2008; 294(2): G576 - G588.
[Abstract] [Full Text] [PDF]

Home page
 JEMHome page
M. G. Laukoetter, P. Nava, W. Y. Lee, E. A. Severson, C. T. Capaldo, B. A. Babbin, I. R. Williams, M. Koval, E. Peatman, J. A. Campbell, et al.
JAM-A regulates permeability and inflammation in the intestine in vivo
J. Exp. Med., December 24, 2007; 204(13): 3067 - 3076.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
B. A. Babbin, A. J. Jesaitis, A. I. Ivanov, D. Kelly, M. Laukoetter, P. Nava, C. A. Parkos, and A. Nusrat
Formyl Peptide Receptor-1 Activation Enhances Intestinal Epithelial Cell Restitution through Phosphatidylinositol 3-Kinase-Dependent Activation of Rac1 and Cdc42
J. Immunol., December 15, 2007; 179(12): 8112 - 8121.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Biol. CellHome page
P. Nava, M. G. Laukoetter, A. M. Hopkins, O. Laur, K. Gerner-Smidt, K. J. Green, C. A. Parkos, and A. Nusrat
Desmoglein-2: A Novel Regulator of Apoptosis in the Intestinal Epithelium
Mol. Biol. Cell, November 1, 2007; 18(11): 4565 - 4578.
[Abstract] [Full Text] [PDF]

Home page
 J Am Coll CardiolHome page
R. C. Becker
Emerging Paradigms, Platforms, and Unifying Themes in Biomarker Science
J. Am. Coll. Cardiol., October 30, 2007; 50(18): 1777 - 1780.
[Full Text] [PDF]

Home page
 Arterioscler. Thromb. Vasc. Bio.Home page
P. F. Bradfield, S. Nourshargh, M. Aurrand-Lions, and B. A. Imhof
JAM Family and Related Proteins in Leukocyte Migration (Vestweber Series)
Arterioscler. Thromb. Vasc. Biol., October 1, 2007; 27(10): 2104 - 2112.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
G. Konopka, J. Tekiela, M. Iverson, C. Wells, and S. A. Duncan
Junctional Adhesion Molecule-A Is Critical for the Formation of Pseudocanaliculi and Modulates E-cadherin Expression in Hepatic Cells
J. Biol. Chem., September 21, 2007; 282(38): 28137 - 28148.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
K. J. Mandell, L. Berglin, E. A. Severson, H. F. Edelhauser, and C. A. Parkos
Expression of JAM-A in the Human Corneal Endothelium and Retinal Pigment Epithelium: Localization and Evidence for Role in Barrier Function
Invest. Ophthalmol. Vis. Sci., September 1, 2007; 48(9): 3928 - 3936.
[Abstract] [Full Text] [PDF]

Home page
 J. Leukoc. Biol.Home page
R. Vaschetto, J. Grinstein, L. Del Sorbo, A. A. Khine, S. Voglis, E. Tullis, A. S. Slutsky, and H. Zhang
Role of human neutrophil peptides in the initial interaction between lung epithelial cells and CD4+ lymphocytes
J. Leukoc. Biol., April 1, 2007; 81(4): 1022 - 1031.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
C. Fuse, Y. Ishida, T. Hikita, T. Asai, and N. Oku
Junctional Adhesion Molecule-C Promotes Metastatic Potential of HT1080 Human Fibrosarcoma
J. Biol. Chem., March 16, 2007; 282(11): 8276 - 8283.
[Abstract] [Full Text] [PDF]

Home page
 JEMHome page
V. V. Orlova, M. Economopoulou, F. Lupu, S. Santoso, and T. Chavakis
Junctional adhesion molecule-C regulates vascular endothelial permeability by modulating VE-cadherin-mediated cell-cell contacts
J. Exp. Med., November 27, 2006; 203(12): 2703 - 2714.
[Abstract] [Full Text] [PDF]

Home page
 J. Nutr.Home page
A. Perez-Bosque, C. Amat, J. Polo, J. M. Campbell, J. Crenshaw, L. Russell, and M. Moreto
Spray-Dried Animal Plasma Prevents the Effects of Staphylococcus aureus Enterotoxin B on Intestinal Barrier Function in Weaned Rats
J. Nutr., November 1, 2006; 136(11): 2838 - 2843.
[Abstract] [Full Text] [PDF]

Home page
 J. Leukoc. Biol.Home page
S. Nourshargh, F. Krombach, and E. Dejana
The role of JAM-A and PECAM-1 in modulating leukocyte infiltration in inflamed and ischemic tissues
J. Leukoc. Biol., October 1, 2006; 80(4): 714 - 718.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
B. A. Babbin, W. Y. Lee, C. A. Parkos, L. M. Winfree, A. Akyildiz, M. Perretti, and A. Nusrat
Annexin I Regulates SKCO-15 Cell Invasion by Signaling through Formyl Peptide Receptors
J. Biol. Chem., July 14, 2006; 281(28): 19588 - 19599.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
K. J. Mandell, G. P. Holley, C. A. Parkos, and H. F. Edelhauser
Antibody blockade of junctional adhesion molecule-a in rabbit corneal endothelial tight junctions produces corneal swelling.
Invest. Ophthalmol. Vis. Sci., June 1, 2006; 47(6): 2408 - 2416.
[Abstract] [Full Text] [PDF]

Home page
 J. Virol.Home page
M. S. Maginnis, J. C. Forrest, S. A. Kopecky-Bromberg, S. K. Dickeson, S. A. Santoro, M. M. Zutter, G. R. Nemerow, J. M. Bergelson, and T. S. Dermody
{beta}1 Integrin Mediates Internalization of Mammalian Reovirus
J. Virol., March 15, 2006; 80(6): 2760 - 2770.
[Abstract] [Full Text] [PDF]

Home page
 J. Cell Sci.Home page
M. U. Naik and U. P. Naik
Junctional adhesion molecule-A-induced endothelial cell migration on vitronectin is integrin {alpha}v{beta}3 specific
J. Cell Sci., February 1, 2006; 119(3): 490 - 499.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Biol. CellHome page
A. Sakurai, S. Fukuhara, A. Yamagishi, K. Sako, Y. Kamioka, M. Masuda, Y. Nakaoka, and N. Mochizuki
MAGI-1 Is Required for Rap1 Activation upon Cell-Cell Contact and for Enhancement of Vascular Endothelial Cadherin-mediated Cell Adhesion
Mol. Biol. Cell, February 1, 2006; 17(2): 966 - 976.
[Abstract] [Full Text] [PDF]

Home page
 J. Cell Sci.Home page
M. E. Osler, M. S. Chang, and D. M. Bader
Bves modulates epithelial integrity through an interaction at the tight junction
J. Cell Sci., October 15, 2005; 118(20): 4667 - 4678.
[Abstract] [Full Text] [PDF]

Home page
 JCBHome page
A. E.E. Mertens, T. P. Rygiel, C. Olivo, R. van der Kammen, and J. G. Collard
The Rac activator Tiam1 controls tight junction biogenesis in keratinocytes through binding to and activation of the Par polarity complex
J. Cell Biol., September 26, 2005; 170(7): 1029 - 1037.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
M. Corada, S. Chimenti, M. R. Cera, M. Vinci, M. Salio, F. Fiordaliso, N. De Angelis, A. Villa, M. Bossi, L. I. Staszewsky, et al.
Junctional adhesion molecule-A-deficient polymorphonuclear cells show reduced diapedesis in peritonitis and heart ischemia-reperfusion injury
PNAS, July 26, 2005; 102(30): 10634 - 10639.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
A. Khandoga, J. S. Kessler, H. Meissner, M. Hanschen, M. Corada, T. Motoike, G. Enders, E. Dejana, and F. Krombach
Junctional adhesion molecule-A deficiency increases hepatic ischemia-reperfusion injury despite reduction of neutrophil transendothelial migration
Blood, July 15, 2005; 106(2): 725 - 733.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
280/12/11665    most recent
M412650200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mandell, K. J.
Right arrow Articles by Parkos, C. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mandell, K. J.
Right arrow Articles by Parkos, C. A.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2005 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement