Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M409475200 on January 20, 2005

J. Biol. Chem., Vol. 280, Issue 12, 11887-11894, March 25, 2005
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
280/12/11887    most recent
M409475200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhao, L.
Right arrow Articles by Stein, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhao, L.
Right arrow Articles by Stein, R.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

The Islet {beta} Cell-enriched MafA Activator Is a Key Regulator of Insulin Gene Transcription*

Li Zhao{ddagger}, Min Guo{ddagger}, Taka-aki Matsuoka{ddagger}§, Derek K. Hagman¶, Susan D. Parazzoli¶, Vincent Poitout¶||, and Roland Stein{ddagger}**

From the {ddagger}Department of Molecular Physiology and Biophysics, Vanderbilt University School of Medicine, Nashville, Tennessee 37232, the Pacific Northwest Research Institute, Seattle, Washington 98122, and the ||Department of Medicine, University of Washington, Seattle, Washington 98195

Received for publication, August 18, 2004 , and in revised form, December 22, 2004.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The islet-enriched MafA, PDX-1, and BETA2 activators contribute to both {beta} cell-specific and glucose-responsive insulin gene transcription. To investigate how these factors impart activation, their combined impact upon insulin enhancer-driven expression was first examined in non-{beta} cell line transfection assays. Individual expression of PDX-1 and BETA2 led to little or no activation, whereas MafA alone did so modestly. MafA together with PDX-1 or BETA2 produced synergistic activation, with even higher insulin promoter activity found when all three proteins were present. Stimulation was attenuated upon compromising either MafA transactivation or DNA-binding activity. MafA interacted with endogenous PDX-1 and BETA2 in coimmunoprecipitation and in vitro GST pull-down assays, suggesting that regulation involved direct binding. Dominant-negative acting and small interfering RNAs of MafA also profoundly reduced insulin promoter activity in {beta} cell lines. In addition, MafA was induced in parallel with insulin mRNA expression in glucose-stimulated rat islets. Insulin mRNA levels were also elevated in rat islets by adenoviral-mediated expression of MafA. Collectively, these results suggest that MafA plays a key role in coordinating and controlling the level of insulin gene expression in islet {beta} cells.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Insulin is selectively expressed in the pancreatic {beta} cells of the islet of Langerhans. Restricted expression is due to a unique combination of factors that stimulate through conserved enhancer region sequences located approximately between nucleotides -340 and -90 relative to the transcription start site (1-4). Detailed analysis has revealed that activation is primarily controlled by PAX6, PDX-1, MafA, and BETA2 binding to the C2 (-317 to -311 bp), A3 (-201 to -196 bp), C1 (-126 to -101 bp), and E1 (-100 to -91 bp) elements, respectively (5, 6). These distinct factors are enriched in islet cells, with BETA2 (7, 8) and PAX6 (9) present in all islet cell types, PDX-1 in {beta} and a subset of {delta} cells (10), and only the recently isolated MafA protein exclusively in {beta} cells (11-13). Although MafA appears to be the major regulator of C1-mediated activation (11-13), the closely related MafB protein is found in a fraction of islet {beta} cells in vivo and is capable of activating insulin transcription in vitro (13). PDX-1, MafA, and BETA2 also control glucose-regulated transcription of the insulin gene, the principal metabolic regulator of {beta} cell function (8, 14-17).

Gene ablation experiments performed in mice on pax6, pdx-1, and BETA2 have established a critical function for each in pancreatic development. Thus, PDX-1 is essential for the growth of the endocrine and exocrine compartments, with pancreatic development arresting at the early post-bud stage in homozygous pdx-1 mutant mice, resulting in pancreatic agenesis (18, 19). In contrast, the loss of PAX6 and BETA2 affects only islet cell development, with the number of {alpha} cells dramatically reduced in pax6 gene knock-out mice (9), and a severe, but general loss in total islet cell number in the absence of BETA2 (7, 8). Human heterozygous carriers of dysfunctional mutations in PAX6 (20), BETA2 (21), and PDX-1 (22) also contribute to the development of type 2 diabetes, presumably due to direct effects on the transcription of genes associated with {beta} cell identity (i.e. {beta}-glucokinase, islet amyloid polypeptide, glucose transporter type 2, as well as insulin (23-28)). Unfortunately, the role MafA plays in {beta} cell development has not been determined. However, a significant part is strongly suggested by the exclusive presence of MafA in developing islet insulin producing cells and adult islet {beta} cells (13, 29), its importance in pdx-1 (30) and insulin gene transcription (11-13, 29), and the general association of proteins in the large Maf family with developmental processes (i.e. MafB (31), c-Maf (32, 33), and NRL (34)).

Islet-enriched activator binding promotes the assembly of the insulin transcription complex. This process is mediated by interactions between activators themselves and by contact with the RNA polymerase II transcriptional apparatus, or indirectly through bridging coactivators. Thus, PDX-1 and BETA2 binding to the p300 coactivator or its paralogue p300/cAMP response element binding protein-binding protein (CBP)1 provides a docking and recruitment interface with the general transcriptional machinery (27, 35, 36). In this study, MafA was found to functionally interact with PDX-1 and BETA2 to promote synergistic activation of insulin enhancer-driven reporter activity in non-{beta} cells. MafA was also shown to play a direct and principal role in insulin gene activation in {beta} cell lines, although p300/CBP was not involved in this response. In addition, insulin mRNA levels were found to increase in conjunction with MafA in rat islets. Our results suggest that MafA-mediated signaling is important for high level expression of the insulin gene in {beta} cells.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
DNA Constructs—The -238 insulin-firefly luciferase (LUC) expression plasmids contain wild-type rat insulin II gene sequences from bp -238 to +2 and PDX-1 (A3 and A1 (37)), BETA2 (E1 (38)), or MafA (C1 (29)) binding mutations. The construction of the cytomegalovirus (CMV) enhancer-driven MafA (13), PDX-1 (39), and BETA2 (36) expression vectors was described previously. MafA135-359 was made by PCR from wild type mouse MafA and subcloned into the polylinker of the CMV-driven expression vector, pcDNA3.1/Zeo(+) (Invitrogen). The arginine to alanine mutant at amino acid 265 in MafA was constructed in the CMV:MafA 1-359 vector using the QuikChangeTM site-directed mutagenesis kit (top: 5'-CCGACTGAAACAGAAGGCGCGCACGCTCAAG-3'; the mutated nucleotides are underlined) (Stratagene). GST:MafA chimeras of full-length, amino acids (aa) 1-233, and aa 233-359 of mouse MafA were generated by in-frame fusion with the glutathione S-transferase (GST) coding sequences in the pGEM-KG bacterial expression vector (Amersham Biosciences). The Gal4:MafA chimeras containing sequences from aa 1-359 (i.e. full-length) or aa 1-233 were constructed by subcloning PCR-amplified mouse MafA fragments into pSG424 (40) to create in-frame GAL4 DNA binding domain:MafA fusion proteins. The construction of the GAL4:BETA2 constructs containing the hamster full-length (1-355) or aa 156-355 of BETA2 were described previously (36). The CMV-driven wild type and p300 dl10 mutant (deletion of aa 1680-1811) have also been described (41). The adenovirus type 5 E1A expression plasmid encodes for the wild type 243-aa protein. The adenovirus-5 expressing MafA under the control of the CMV enhancer/promoter (AdV-CMV) was generated using the mouse MafA cDNA as described previously (42). The correctness of each construct was verified by restriction enzyme digestion and DNA sequence analysis.

Small interfering RNAs (siRNA) of MafA were expressed from the RNA polymerase III H1 gene promoter in the pSUPER mammalian expression vector (43). The targeted regions of murine MafA mRNA were selected using the online program available from Ambion Inc. (www.ambion.com/techlib/misc/siRNA_finder.html), and labeled relative to the nucleotides spanned from the ATG translation start codon. The following oligonucleotides were used for cloning into pSUPER (the MafA sequences are underlined): +64/+84 bp, 5'-GATCCCCAACGACTTCGACCTGATGAAGTTCAAGAGACTTCATCAGGTCGAAGTCGTTTTTTTGGAAA-3'; +82/+102, 5'-GATCCCCAAGTTCGAGGTGAAGAAGGAGTTCAAGAGACTCCTTCTTCACCTCGAACTTTTTTTGGAAA-3'; +955/+975, 5'-GATCCCCAAATACGAGAAGTTGGCGGGCTTCAAGAGAGCCCGCCAACTTCTCGTATTTTTTTTGGAAA-3'; +1054/+1074, 5'-GATCCCCAAAGGCGCACCCGACTTCTTTTTCAAGAGAAAAGAAGTCGGGTGCGCCTTTTTTTTGGAAA-3'.

Cell Line Transfections and Rat Islet Isolation—The non-{beta} (HeLa and HEK293) and {beta} ({beta}TC3 and MIN6) cell lines were grown in Dulbecco's modified Eagle's medium in the presence of 10% heat-inactivated fetal calf serum, 25 mM glucose, penicillin (100 units/ml), and streptomycin (100 µg/ml). Insulin -238 LUC (0.25 µg) was transfected with MafA, PDX-1, and/or BETA2 expression vectors (0.25 µg/each) using the Lipofectamine procedure (Invitrogen). The CMV-driven Renilla luciferase expression plasmid phRL-TK (Promega) was used as a recovery marker (2 ng), with 1 µg of total DNA used for each point. The Dual Luciferase assay (Promega) was performed 40-48 h after transfection according to the manufacturer's directions. Each experiment was repeated at least four times using at least two different plasmid preparations.

Rat islets were isolated by collagenase digestion from 6-week-old male Wistar rats (Harlan Sprague-Dawley, Indianapolis, IL) as described previously (44). After an overnight culture in RPMI 1640 containing 10% heat-inactivated fetal bovine serum, 100 units/ml penicillin, 100 µg/ml streptomycin, and 11 mM glucose, the islets were resuspended in fresh medium and incubated at 37 °C under the experimental conditions described in the figure legend.

Immunoprecipitation and Western Blotting—{beta}TC3 cells were lysed in radioimmune precipitation assay buffer (10 mM Tris-HCl, pH 8.0, 140 mM NaCl, 0.025% NaN3, 0.5% Triton X-100, 1% sodium deoxycholate, 0.1% SDS, 1 mM phenylmethylsulfonyl fluoride, 2 µg of aprotinin per milliliter), whereas rat islets were sonicated in ice-cold cell lysis buffer (50 mM HEPES (pH 7.5), 1% (v/v) Nonidet P-40, 2 mM activated sodium orthovanadate, 100 mM sodium fluoride, 10 mM sodium pyrophosphate, 4 mM EDTA, 1 mM phenylmethylsulfonyl fluoride, 1 µg/ml leupeptin, 1 µg/ml aprotinin). Cellular debris was removed from the lysed islet samples by centrifugation (14,000 rpm, 10 min, 4 °C). Extract protein was incubated overnight at 4 °C with normal rabbit immunoglobulin G (IgG) or affinity-purified anti-MafA peptide antiserum (Bethyl Laboratories, Inc., Montgomery, TX (13)). The proteins were immunoprecipitated with protein A-Sepharose beads (Sigma), washed three times with radioimmune precipitation assay buffer, subjected to SDS-polyacrylamide gel electrophoresis, and then electrotransferred onto Immobilon polyvinylidene difluoride membrane (Millipore, Bedford, MA). The blot was incubated for 1 h at 4 °C in blocking buffer (10 mM Tris, pH 8.0, 150 mM NaCl, 0.05% Tween 20, and 5% nonfat dry milk) and then at 4 °C overnight with either PDX-1, BETA2 (Santa Cruz Biotechnology Inc.), MafA (Bethyl Laboratories, TX), and TATA-binding protein (Santa Cruz Biotechnology Inc.) antiserum. The PDX-1 polyclonal antiserum was developed to N-terminal region (aa 1-75) epitopes (39). In the MafA siRNA experiment in 293 cells, lysates from CMV:MafA (100 ng)- and MafA siRNA-pSUPER (1 µg)-transfected cells were blotted and analyzed using anti-MafA antiserum. Antibody detection was performed using enhanced chemiluminescence (Pierce Biotechnology) after incubation with a horseradish peroxidase-conjugated secondary antibody.

In Vitro Translation and GST Binding Assays—GST:MafA 1-359, GST:MafA 1-233, and GST:MafA 233-359 fusion proteins were prepared as specified by the manufacturer (Amersham Biosciences). Translation reactions were performed using the TNT in vitro translation kit (Promega, Madison, WI.) with CMV:PDX-1, CMV:BETA2, and L-[35S]methionine. Labeled proteins were incubated with GST:MafA coupled to glutathione-Sepharose beads (Amersham Biosciences) for 1 h in binding buffer (50 mM Tris·HCl, pH 8.0, 150 mM NaCl, 0.1% Nonidet P-40, 2 mM EDTA, 10 mM MgCl2, 20 µM ZnCl2). The beads were washed four times with binding buffer, and the bound protein complexes were eluted with 1x gel loading buffer (50 mM Tris-HCl (pH 6.8), 100 mM dithiothreitol, 2% SDS, 0.1% bromphenol blue, 10% glycerol), resolved by SDS-10% polyacrylamide gel electrophoresis, and visualized by fluorography.

Electrophoretic Mobility Shift Assay—Batches of 350-500 islets each were washed in phosphate-buffered saline, resuspended in 400 µl of cold hypotonic buffer (10 mM HEPES (pH 7.9), 10 mM KCl, 1.5 mM MgCl2, 0.5 mM dithiothreitol, 0.1 mM EDTA, 0.1 mM EGTA, 0.5 mM phenylmethylsulfonyl fluoride, 0.5 µg/ml aprotinin, 10 µg/ml leupeptin, 1 µg/ml pepstatin), and allowed to swell on ice for 15 min before adding 25 µl of 10% (w/v) Nonidet P-40. After vortexing vigorously, the nuclei were pelleted by centrifugation (14,000 rpm, 1 min, and 4 °C) and resuspended in 50 µl of high salt buffer (20 mM HEPES (pH 7.9), 0.4 M NaCl, 0.2 mM dithiothreitol, 0.1 mM EDTA, 0.1 mM EGTA, 1 mM phenylmethylsulfonyl fluoride, 0.5 µg/ml aprotinin, 10 µg/ml leupeptin, and 1 µg/ml pepstatin) (17). Gel shift binding reactions (20 µl) were conducted with 5-10 µg of nuclear extract protein and radiolabeled probe at room temperature for 30 min in the binding buffer (5% (v/v) glycerol, 1 mM EDTA, 50 mM NaCl, 10 mM Tris-HCl pH 7.5, 1 mM dithiothreitol, 0.5 µg/µl poly(dI-dC)). Double-stranded oligonucleotide probes corresponding to the rat insulin II C1 (-126 TGGAAACTGCAGCTTCAGCCCCTCT -101) and E1 (-104 TCTGGCCATCTGCTGGATCCT -85) elements were annealed and labeled by end filling with the DNA Polymerase Large (Klenow) Fragment Kit (Promega) and [{alpha}-32P]dCTP (PerkinElmer Life Sciences). The identities of the MafA- and BETA2-containing complexes were determined by wild type element competition as well as super-shift analyses with {alpha}-MafA antisera. The binding complexes were resolved by electrophoretic separation on a 4.5% non-denaturing polyacrylamide gel and visualized by autoradiography.

Measurement of Preproinsulin mRNA Levels—Duplicate batches of 100 islets each were infected overnight with 105 plaque-forming units per islet of the CMV-driven MafA (AdV-MafA) or the firefly luciferase (AdV-Luc (45)) control adenovirus in RPMI 1640 containing 10% fetal bovine serum and 11.1 mM glucose. Islets were then transferred to fresh RPMI 1640 containing 10% fetal bovine serum and 16.7 mM glucose, and incubated at 37 °C for 72 h. Total cellular RNA was isolated using the TRIzol reagent (Invitrogen) and treated with the MessageClean kit to remove DNA (Gene Hunter Corp., Nashville, TN). The ribonuclease protection assay (RPA) was carried out with a 360-bp sequence of the rat II preproinsulin gene and a conserved 245-bp sequence of the mouse {beta}-actin gene using the Direct Protect Lysate RPA kit (Ambion, Austin, TX) (42), with the TaqMan-based reverse transcription-PCR performed using oligonucleotides to the rat preproinsulin II and {beta}-actin coding sequences described previously (45). This analysis was conducted with several independently treated islet preparations.

Statistical Analysis—The significance of the experimental findings was determined using analysis of variance with the least significance difference test (SAS9.1 statistical software, SAS Institute Inc, Carry, NC). A p value of <0.05 was considered significant.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
MafA Cooperates with PDX-1 and BETA2 to Induce Insulin-driven Transcription—Preventing PDX-1, BETA2, or MafA binding drastically reduces insulin enhancer-driven expression in {beta} cells, suggesting that these factors act in a synergistic fashion to mediate transcription. Although the exact mechanisms involved in control are unclear, experiments performed in non-{beta} cells imply that PDX-1 and BETA2 act together to cooperatively activate expression, a process augmented by the non-DNA binding p300 coactivator (27, 35, 36). Interestingly, MafA was recently shown to be the only islet-enriched transcription factor that is first expressed in the insulin-producing progenitors that eventually populate the islet (29). In contrast, PDX-1 and BETA2 are synthesized earlier and in a broader range of islet-hormone-producing cell types (8, 10, 19, 46). MafA is also capable of independently inducing endogenous insulin gene expression in an islet {alpha} cell line ({alpha}TC-6 (29)). These data imply that MafA serves a unique role in mediating insulin gene expression.

To test if MafA functionally interacts with other islet-enriched insulin activators, PDX-1 and BETA2 expression constructs were cotransfected with MafA and insulin enhancer/promoter-driven -238 LUC reporter constructs. These experiments were conducted in HeLa cells, a non-pancreatic cell line that does not produce insulin or islet-enriched transcription factors. As expected, wild type -238 LUC activity was not influenced by either PDX-1 or BETA2 alone (35), with MafA able to independently stimulate ~20-fold (Fig. 1) (13). Transactivation was stimulated in a synergistic manner when MafA was combined with either PDX-1 (Fig. 1B) or BETA2 (Fig. 1C). Additional enhancement of insulin-driven activity was also observed in the presence of all three factors (Fig. 1D). In general, PDX-1-, BETA2-, and MafA-mediated stimulation was dependent upon activator binding, because cooperativity with MafA was essentially lost in the PDX-1 (Fig. 1B, compare -238 WT responsiveness to the A3 and A1 mutants) and BETA2 (Fig. 1C) binding site mutants, whereas activation by MafA was greatly reduced in the C1 mutant (Fig. 1D). Cooperativity was also attenuated in MafA mutants deficient in activation (i.e. MafA 135-359) or DNA-binding domain (MafA R265A) function (Fig. 1E).



View larger version (21K):
[in this window]
[in a new window]
  		FIG. 1.
The actions of MafA, PDX-1, and BETA2 lead to cooperative activation of insulin-driven expression. A, schematic of the rat insulin II control region in -238 WT LUC showing the location of the PDX-1 (A3, -216/-207 bp; A1, -81/-77 bp), BETA2 (E1, -100/-91 bp), and MafA (C1, -115/-107 bp) control elements. B-D, HeLa cells were transfected with MafA (0.25 µg), PDX-1 (0.25 µg), and/or BETA2 (0.25 µg) expression vectors in the presence of wild type (WT) or dysfunctional binding mutants of PDX-1 (B), BETA2 (C), or MafA (D) in -238 LUC (0.25 µg). The low relative level of cooperativity observed in -238 mC1 in D is likely mediated through a poorer MafA binding site, like MR2 (29). The firefly luciferase activity of -238 LUC was normalized to a cotransfected Renilla luciferase control gene, phRL-TK Renilla luciferase (2 ng). The -fold stimulation (± S.E.) is calculated as normalized -238 LUC activity plus effector(s) divided by -238 LUC activity plus pcDNA3.1. *, p < 0.05 versus MafA alone. E, HeLa cells were transfected with -238 LUC (0.25 µg) and wild type (WT) or dysfunctional MafA mutants (0.25 µg), PDX-1 (0.25 µg), and/or BETA2 (0.25 µg) expression vectors. MafA 135-359 has very low activation potential due to deletion of most of the N-terminal activation domain, whereas gel shift DNA-binding activity is significantly reduced upon mutation of a basic region arginine to alanine in MafA R265A (data not shown). *, p < 0.05 versus MafA alone.

 
MafA, PDX-1, and BETA2 had the same influence on insulin-driven expression in non-islet baby hamster kidney and NIH 3T3 cell lines (data not shown). Together, these results imply that binding of MafA to the insulin enhancer profoundly impacts upon the transcriptional potentiation properties of other key activators, like PDX-1 and BETA2.

MafB Can Act with PDX-1 and BETA2 to Stimulate Insulin Gene Expression—MafB appears to be the only other member of the large Maf family normally expressed in islet cells (13). Unlike MafA, the MafB protein is predominately expressed in adult islet {alpha} cells (Ref. 13 and data not shown). However, MafB is also detected with MafA in the insulin-producing cells formed during the second and predominant phase of {beta} cell formation, as well as glucagon-producing {alpha} cells during pancreas organogenesis.2 Transfection studies performed with MafB, PDX-1, BETA2, and -238 WT LUC in HeLa cells demonstrated that this closely related large Maf protein also acts effectively with PDX-1 and BETA2 to stimulate insulin gene expression (Fig. 2). The variation in-fold activation between MafA and MafB reflects their different N-terminal activation domain potentials (MafB > MafA (13, 47)) and not the amount of large Maf activator produced within the experiment (data not shown). These data imply that both MafA and MafB can influence insulin transcription in islet {beta} cell progenitors. Because such cells are rare and unavailable for in vitro analysis, the studies below principally focused on determining the significance of MafA in insulin gene expression in islet {beta} cell lines, an islet {beta} cell model wherein only MafA is found (13).



View larger version (32K):
[in this window]
[in a new window]
  		FIG. 2.
MafB potentiates PDX-1- and BETA2-mediated transactivation of -238 WT. MafA activation of -238 WT LUC was compared with MafB in the presence of the listed effectors in HeLa cells. The normalized -fold activation ± S.E. was calculated as described in the legend to Fig. 1. *, p < 0.05 versus MafA or MafB alone.

 
MafA Binds Directly to PDX-1 and BETA2—Immunoprecipitation assays were performed in {beta}TC-3 cell extracts with MafA antiserum. Western blotting revealed that PDX-1 and BETA2 were coprecipitated with MafA (Fig. 3A). These complexes appear to be specific, because rabbit IgG did not precipitate either PDX-1 or BETA2. Interactions between MafA, PDX-1, and BETA2 were also detected in {beta} cell precipitation assays conducted with PDX-1 and BETA2 antisera.



View larger version (23K):
[in this window]
[in a new window]
  		FIG. 3.
MafA binds to PDX-1 and BETA2 in vivo. A, immunoprecipitation (IP) analysis was performed with {beta}TC-3 extracts and anti-MafA antisera or rabbit IgG (rIgG); the precipitates were Western-blotted (WB) with (left, top) anti-PDX-1 or (right, top) anti-BETA2 antibody. We also perform the IP with either anti-PDX-1 (left, bottom) or anti-BETA2 antibody (right, bottom) and WB with MafA antisera. The input illustrates the levels of PDX-1, BETA2 or MafA in 2% of the cell extract. B, radiolabeled (top) PDX-1 and (middle) BETA2 were incubated with purified GST control and GST: MafA fusion proteins bound to glutathione-Sepharose beads. Bound PDX-1 or BETA2 was then eluted, separated by 10% SDS-polyacrylamide gel electrophoresis, and detected by autoradiography. The input lane represents the volume fraction used in the binding assay. Bottom, the asterisk denotes the location of the GST:MafA chimera in a Coomassie Blue-stained 10% SDS-polyacrylamide gel.

 
To test if MafA directly interacted with PDX-1 and BETA2, the binding properties of these factors to GST:MafA affinity columns was analyzed under conditions in which the full-length, N-terminal activation (aa 1-233), and C-terminal DNA-binding/dimerization (aa 233-359) regions of MafA served as ligands. Both PDX-1 and BETA2 bound effectively to the full-length and C-terminal region columns, whereas less binding was detected in the eluates from the GST or GST:MafA 1-233 column (Fig. 3B). Together, these results demonstrated that MafA can directly bind to BETA2 and PDX-1 in vivo.

MafA Is Important for Insulin Expression in {beta} Cell Lines—The observation that MafA functionally and physically interacts with PDX-1 and BETA2 implies a pivotal role in promoting insulin transcription. If so, then reducing the functional levels of the activator should profoundly influence insulin gene expression in {beta} cells. To test this proposal, MafA activity in the mouse {beta}TC-3 and MIN6 {beta} cell lines was suppressed by expression of either a dominant-negative-acting form of MafA (MafA135-359) or siRNAs to MafA. The influence of these MafA effectors on -238 WT LUC activity was compared with a MafA site-debilitating mutant within this insulin-driven construct (i.e. C1 mutant).

MafA135-359, which lacks the N-terminal activation domain of this basic leucine-zipper containing DNA binding factor, markedly reduced -238 WT activity (Fig. 4A). Wild type MafA also slightly inhibited insulin-driven activity, presumably due to a dominant-negative effect produced by incomplete phosphorylation in this highly modified family of proteins (13, 17, 48). In addition, insulin-driven activity was decreased in MIN6 cells by siRNAs targeted to nucleotides 64-84 or 82-102 of the mouse MafA mRNA (Fig. 4B), which were the siRNAs that most effectively blocked MafA synthesis in transfection assays performed in non-islet 293 cells (Fig. 4C). In contrast, these siRNAs had little or no effect on the ubiquitously active simian virus-40 enhancer, nor did the siRNAs to MafA that only modestly reduced protein levels in 293 cells influence insulin-driven activation (i.e. 955-975 and 1054-1074 in Fig. 4, B and C). Importantly, the level of repression by either dominant-negative-acting MafA or the siRNAs was similar to the dysfunctional MafA element binding site mutant (Fig. 4), consistent with MafA serving a central role in insulin activation.



View larger version (23K):
[in this window]
[in a new window]
  		FIG. 4.
Reducing MafA activity levels causes a dramatic loss in insulin-driven activity in {beta} cells. -238 WT LUC (0.25 µg) was transfected into {beta}TC-3 and/or MIN6 cells with either MafA135-359 (1 µg) (A) or MafA siRNA expression constructs (64-84, 82-102, 955-975, and 1054-1074)) (1 µg) (B). The impact of these conditions on MafA-mediated activation was compared with a dysfunctional MafA binding site mutant in -238 LUC (-238 C1 mt). The normalized relative activity ± S.E. is the ratio of -238 LUC activity plus effector to the wild type reporter gene alone. *, p < 0.05 versus -238 WT LUC alone. C, Western blot analysis of 293 cells transfected with MafA (0.1 µg) and MafA siRNA (1 µg) expression constructs demonstrated that the 64-84 and 82-102 siRNAs to MafA were effective at reducing MafA protein levels. The endogenous {beta}-actin level was used to control for loading.

 
Unlike BETA2 and PDX-1, the p300 Coactivator Does Not Appear to Mediate MafA Stimulation—The non-DNA binding p300 coactivator and its paralogue CBP is involved in transducing signals between PDX-1, BETA2, and the basal RNA polymerase II apparatus (27, 35, 36). In addition to this bridging function, BETA2 is uniquely modified by the intrinsic acetyltransferase activity of p300/CBP and its associated factor, p300-associated factor resulting in enhanced DNA binding and transcriptional potency (49). To examine if MafA functionally interacts with p300, HeLa cells were cotransfected with expression plasmids producing p300 and either full-length or the N-terminal activation region of MafA fused in-frame to the DNA-binding domain of the Saccharomyces cerevisiae GAL4 transcription factor. The effect of p300 on Gal4:MafA activation was compared with GAL4:BETA2 chimeras containing the coactivator binding domain (i.e. Gal4:BETA2 and Gal4:BETA2 156-355 (36)). Gal4:MafA activity was not affected by p300, whereas the positive GAL4:BETA2 control was stimulated (Fig. 5). Furthermore, MafA-mediated activation was also not impacted by p300 dl10, a mutant coactivator that functions more effectively with BETA2 (36) and PDX-1 (35).



View larger version (28K):
[in this window]
[in a new window]
  		FIG. 5.
p300 does not interact with MafA. The transcriptional activity of the full-length and mutant GAL4:MafA fusion proteins were examined in the presence of p300 in HeLa cells. Control transfections with p300-responsive GAL4:BETA2 chimeras are shown (36). The MafA and BETA2 sequences within the mutant GAL4 chimeras are noted in parentheses. Each transfection contained GAL4:effector (0.25 µg), p300 or p300dll0 (0.25-1 µg), (GAL4)5E1bLUC (0.25 µg), and phRL-TK LUC (2 ng). Activity values ± S.E. are presented as the normalized activity of the GAL4 chimera with or without p300 divided by the GAL4 chimera alone. *, p < 0.05 versus GAL4:effector alone.

 
To more broadly define if MafA transactivation of insulin was influenced by p300, HeLa cells were cotransfected with -238 WT and MafA in the presence or absence of this coactivator. Activation by MafA was unaffected by p300, although the coactivator enhanced insulin enhancer-driven activity in the presence of MafA, PDX-1, and BETA2 (Fig. 6). However, stimulation by these effectors was essentially reduced to the level of MafA alone by adenovirus E1A (Fig. 6), a factor that inhibits protein-protein-mediated communication between p300/CBP and BETA2 (36) or PDX-1 (35). Collectively, the data strongly suggests that the p300/CBP coactivator does not directly influence MafA activation of the insulin gene in {beta} cells.



View larger version (16K):
[in this window]
[in a new window]
  		FIG. 6.
The p300 coactivator does not influence MafA-driven stimulation of the insulin gene. The -238 LUC reporter and expression vectors encoding for MafA (0.25 µg), BETA2 (0.25 µg), PDX-1 (0.25 µg), p300 (0.25 µg), and E1A (0.25 µg) were transfected into HeLa cells, as indicated. Values are expressed as the normalized-fold of effector stimulation ± S.E. relative to -238 LUC + MafA. *, p < 0.05 versus MafA alone.

 
Insulin Gene Expression Appears to Be Induced in Response to MafA in Islets—The most important regulator of insulin expression in islet {beta} cells is glucose, which stimulates insulin gene transcription, protein synthesis, and secretion. Glucose-induced transcription is dependent upon MafA in {beta} cell lines, a process mediated by increased DNA-binding factor levels (17). To determine if the MafA in islet {beta} cells also regulated glucose-stimulated insulin mRNA expression, isolated rat islets were cultured under simulating (16.7 mM) and non-simulating (2.8 mM) glucose concentrations for 24 h. Endogenous insulin mRNA levels were induced 2.5-fold under these conditions, whereas MafA DNA binding and protein levels were increased even more profoundly (Fig. 7). In contrast, neither the levels of the insulin E1 element activator, which contains the islet-enriched BETA2 protein (16), nor the ubiquitously distributed TATA-binding protein were affected (Fig. 7, A and B).



View larger version (19K):
[in this window]
[in a new window]
  		FIG. 7.
Islet MafA levels were induced in response to stimulating glucose treatment. A, gel shift binding reactions were conducted in the presence of insulin C1 and E1 element probes with nuclear extracts prepared after 24 h from 2.8 and 16.7 mM glucose-treated rat islet samples. As expected, the addition of {alpha}-Maf antiserum super-shifted the C1 element binding complex in lane 3, whereas in lane 4 the competition with 50-fold excess unlabeled probe eliminated MafA and BETA2:E47 binding to C1 and E1, respectively. Similar results were obtained in two replicate experiments. B, the relative change in MafA and the TATA-binding protein (TBP) was determined by Western analysis in the 2.8 and 16.7 mM glucose-treated rat islet nuclear extracts. The result presented is representative of five independent experiments. C, preproinsulin and {beta}-actin mRNA levels were measured by TaqMan reverse transcription-PCR. The results are expressed as the ratio of insulin to {beta}-actin mRNA levels, as normalized to the level at 2.8 mM glucose. Results are the average ± S.E. of three replicate experiments. *, p < 0.05.

 
The results in islets (Fig. 7) and {beta} cell lines (29) indicate that insulin mRNA expression increases in parallel with MafA (Fig. 5D). To examine this association in further detail, rat islets were infected with an adenovirus expressing MafA (AdV-MafA) or luciferase (AdV-LUC) and cultured for 72 h in the presence of 16.7 mM glucose. Insulin mRNA levels were increased selectively by 2-fold by AdV-MafA infection relative to {beta}-actin control levels (Fig. 8). Collectively, the islet data are not only consistent with MafA being a principal mediator of insulin gene transcription in {beta} cell in vivo but also imply that this factor may be limiting to transcription in islets.



View larger version (17K):
[in this window]
[in a new window]
  		FIG. 8.
Endogenous insulin mRNA levels are increased by overexpression of MafA in the rat islets. Isolated rat islets were infected with AdV-MafA or AdV-Luc and then cultured in 16.7 mM glucose for 72 h. Preproinsulin and {beta}-actin mRNA levels were measured in the ribonuclease protection assay. A, a representative experiment. B, the average ± S.E. of eight replicate experiments. The data are expressed as preproinsulin to {beta}-actin mRNA levels when normalized to Ad-Luc infected control conditions. *, p < 0.05.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
Expression of the mammalian insulin gene is restricted to pancreatic {beta} cells. Release of this hormone from the {beta} cell promotes the storage of metabolic fuels and is tightly regulated by nutritional conditions in vivo, with disturbances in production and release contributing to hyperglycemia in various types of diabetes. The mechanisms involved in driving {beta} cell-type-specific transcription appear to principally involve the cis-acting elements located within the proximal enhancer region. The activator factors binding to this region are thought to result in the recruitment of the general transcription apparatus to the nearby promoter, providing transcriptional synergy through interactions between activators and components of the basal transcription apparatus. In the present study, MafA was shown to act in conjunction with other known insulin enhancer regulatory factors (BETA2 and PDX-1) to promote synergistic transcription of the insulin gene in non-{beta} cell lines. Limiting MafA activity in {beta} cell lines was also found to compromise insulin transcription, whereas overexpression elevated steady-state insulin mRNA levels in islets. Together, these results suggest that MafA likely has a profound influence on transcription of the insulin gene in vivo.

The first molecular sign of pancreatic development is the restricted expression of PDX-1, which occurs prior to insulin transcription at embryonic day E8.5 (19, 46). PAX6 (9, 50) and BETA2 (8) are detected around E10, preceding the production of the first insulin-positive cells around E10.5. However, the few insulin-positive cells found at this time lack specific products required for mature islet {beta} cell function and are not believed to populate the islet (51, 52). Fully differentiated {beta} cells first appear around E13 at the start of a massive wave of {beta} cell differentiation termed the "secondary transition" (53). Because MafA is first detected in this insulin-producing cell population, we sought to determine if this factor cooperated with other insulin gene enhancer factors to stimulate transcription.

These studies focused on interactions with BETA2 and PDX-1, which have been shown to act together to mediate insulin activation (35, 54). Here we show that in transfected non-{beta} cells, MafA led to significantly higher insulin-driven activity when combined with BETA2 and PDX-1 (Fig. 1). The removal of MafA activity from {beta} cell lines also clearly supported the importance of this factor in insulin gene expression (Fig. 4). Thus, insulin reporter gene activity was reduced to a level approaching a dysfunctional MafA binding site mutant upon coexpression of the wild type insulin reporter with either a dominant negative-acting MafA (i.e. MafA135-359) or siRNAs targeted to nucleotides 64-84 or 82-102 of the MafA mRNA. Furthermore, endogenous islet insulin gene expression was shown to be induced in parallel with MafA in response to glucose stimulation or adenoviral mediated overexpression (Figs. 7 and 8). The ability of MafA to induce islet expression under these conditions is consistent with a defining role in controlling insulin transcription unit activity.

Strikingly, MafA is the only islet-enriched transcription factor expressed exclusively in islet {beta} cells or in such a restricted fashion during islet cell development (29). Collectively, these observations indicate that MafA is critical for the assembly and function of the insulin gene transcription complex. Although cooperative interactions with this factor likely lead to the high level of specificity in insulin gene activation and to a high level of transcriptional synergy in islet {beta} cells, MafA is not absolutely essential for expression. This conclusion is based upon the presence of insulin positive cells during the early stages of pancreatic development, prior to MafA expression (29). Furthermore, MafA is also not found in the few insulin-positive cells present in Nkx6.1 transcription factor null mice (29), which result in a profound and specific reduction in neogenesis of secondary transition {beta}-cells (55). These results led to the proposal that MafA acts downstream of Nkx6.1 during a late stage of {beta} cell formation. As a consequence, islet insulin expression will likely be severely compromised in MafA knock-out mice, although MafB may provide some level of compensation. Low level insulin gene expression is observed in insulin transcription factor knockdown mice (PAX6 (9), PDX-1 (19), and BETA2 (8)), demonstrating that interactions between a subset of these activator proteins provides some level of transcriptional activation.

The insulin activators not only function to induce localization of the basal transcriptional machinery to the promoter, but also by recruiting chromatin-modifying complexes. Thus, chromatin remodeling and covalent histone modifications are important for the function of transcriptional activators. For example, the acetylation of core histones by p300/CBP and PCAF, which are recruited to the insulin enhancer by PDX-1 and BETA2 (27, 49, 53), is thought to loosen the nucleosome structure and make available new factor binding sites by disrupting higher order chromatin structures (56, 57). It is not yet clear how MafA, PDX-1, and BETA2 function together to facilitate insulin gene transcription, although our results demonstrate that p300/CBP is not involved in MafA-mediated activation (Fig. 5). However, MafA may be involved in recruiting a distinct chromatin-modifying activity such as SWI/SNF, which uses the energy of ATP hydrolysis to alter nucleosome structure and/or facilitate nucleosome mobility (58).


   FOOTNOTES
 
* This work was supported by National Institutes of Health Grants P01-DK42502 (to R. S.) and R01-DK58096 (to V. P.), by Juvenile Diabetes Research Foundation Postdoctoral Grant 3-2001-678 (to T. M.), by an American Diabetes Association Thomas R. Lee Career Development Award (to V. P.), and by the Molecular Biology Core Laboratory of the Vanderbilt University Diabetes Research and Training Center (Public Health Service Grant P60 DK20593). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

§ Present address: Osaka University Graduate School of Medicine, Department of Internal Medicine and Therapeutics, 2-2 Yamadaoka, Suita, Osaka 565-0871, Japan. Back

** To whom correspondence should be addressed: Dept. of Molecular Physiology and Biophysics, Vanderbilt University School of Medicine, 723 Light Hall, Nashville, TN 37232. Tel.: 615-322-7026; Fax: 615-322-7236; E-mail: roland.stein{at}vanderbilt.edu.

1 The abbreviations used are: CBP, p300/cAMP response element binding protein-binding protein; LUC, luciferase; CMV, cytomegalovirus; aa, amino acid(s); GST, glutathione S-transferase; AdV, adenovirus; siRNA, small interference RNA; E, embryonic day. Back

2 I. Artner and R. Stein, unpublished observations. Back



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Karlsson, O., Edlund, T., Moss, J. B., Rutter, W. J., and Walker, M. D. (1987) Proc. Natl. Acad. Sci. U. S. A. 84, 8819-8823[Abstract/Free Full Text]
  2. Shieh, S. Y., and Tsai, M. J. (1991) J. Biol. Chem. 266, 16708-16714[Abstract/Free Full Text]
  3. Whelan, J., Poon, D., Weil, P. A., and Stein, R. (1989) Mol. Cell. Biol. 9, 3253-3259[Abstract/Free Full Text]
  4. Crowe, D. T., and Tsai, M. J. (1989) Mol. Cell. Biol. 9, 1784-1789[Abstract/Free Full Text]
  5. Ohneda, K., Ee, H., and German, M. (2000) Semin. Cell Dev. Biol. 11, 227-233[CrossRef][Medline] [Order article via Infotrieve]
  6. Melloul, D., Marshak, S., and Cerasi, E. (2002) Diabetologia 45, 309-326[CrossRef][Medline] [Order article via Infotrieve]
  7. Naya, F. J., Stellrecht, C. M., and Tsai, M. J. (1995) Genes Dev. 9, 1009-1019[Abstract/Free Full Text]
  8. Naya, F. J., Huang, H. P., Qiu, Y., Mutoh, H., DeMayo, F. J., Leiter, A. B., and Tsai, M. J. (1997) Genes Dev. 11, 2323-2334[Abstract/Free Full Text]
  9. Sander, M., Neubuser, A., Kalamaras, J., Ee, H. C., Martin, G. R., and Ger-man, M. S. (1997) Genes Dev. 11, 1662-1673[Abstract/Free Full Text]
  10. Guz, Y., Montminy, M. R., Stein, R., Leonard, J., Gamer, L. W., Wright, C. V., and Teitelman, G. (1995) Development 121, 11-18[Abstract]
  11. Olbrot, M., Rud, J., Moss, L. G., and Sharma, A. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, 6737-6742[Abstract/Free Full Text]
  12. Kataoka, K., Han, S. I., Shioda, S., Hirai, M., Nishizawa, M., and Handa, H. (2002) J. Biol. Chem. 277, 49903-49910[Abstract/Free Full Text]
  13. Matsuoka, T. A., Zhao, L., Artner, I., Jarrett, H. W., Friedman, D., Means, A., and Stein, R. (2003) Mol. Cell. Biol. 23, 6049-6062[Abstract/Free Full Text]
  14. Marshak, S., Totary, H., Cerasi, E., and Melloul, D. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 15057-15062[Abstract/Free Full Text]
  15. Petersen, H. V., Peshavaria, M., Pedersen, A. A., Philippe, J., Stein, R., Madsen, O. D., and Serup, P. (1998) FEBS Lett. 431, 362-366[CrossRef][Medline] [Order article via Infotrieve]
  16. Sharma, A., and Stein, R. (1994) Mol. Cell. Biol. 14, 871-879[Abstract/Free Full Text]
  17. Zhao, L., Cissell, M. A., Henderson, E., Colbran, R., and Stein, R. (2000) J. Biol. Chem. 275, 10532-10537[Abstract/Free Full Text]
  18. Jonsson, J., Carlsson, L., Edlund, T., and Edlund, H. (1994) Nature 371, 606-609[CrossRef][Medline] [Order article via Infotrieve]
  19. Offield, M. F., Jetton, T. L., Labosky, P. A., Ray, M., Stein, R. W., Magnuson, M. A., Hogan, B. L., and Wright, C. V. (1996) Development 122, 983-995[Abstract]
  20. Yasuda, T., Kajimoto, Y., Fujitani, Y., Watada, H., Yamamoto, S., Watarai, T., Umayahara, Y., Matsuhisa, M., Gorogawa, S., Kuwayama, Y., Tano, Y., Yamasaki, Y., and Hori, M. (2002) Diabetes 51, 224-230[Abstract/Free Full Text]
  21. Malecki, M. T., Jhala, U. S., Antonellis, A., Fields, L., Doria, A., Orban, T., Saad, M., Warram, J. H., Montminy, M., and Krolewski, A. S. (1999) Nat. Genet. 23, 323-328[CrossRef][Medline] [Order article via Infotrieve]
  22. Stoffers, D. A., Ferrer, J., Clarke, W. L., and Habener, J. F. (1997) Nat. Genet. 17, 138-139[CrossRef][Medline] [Order article via Infotrieve]
  23. Moates, J. M., Nanda, S., Cissell, M. A., Tsai, M. J., and Stein, R. (2003) Diabetes 52, 403-408[Abstract/Free Full Text]
  24. Watada, H., Kajimoto, Y., Miyagawa, J., Hanafusa, T., Hamaguchi, K., Matsuoka, T., Yamamoto, K., Matsuzawa, Y., Kawamori, R., and Yamasaki, Y. (1996) Diabetes 45, 1826-1831[Abstract]
  25. Waeber, G., Thompson, N., Nicod, P., and Bonny, C. (1996) Mol. Endocrinol. 10, 1327-1334[Abstract/Free Full Text]
  26. Serup, P., Jensen, J., Andersen, F. G., Jorgensen, M. C., Blume, N., Holst, J. J., and Madsen, O. D. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 9015-9020[Abstract/Free Full Text]
  27. Chakrabarti, S. K., James, J. C., and Mirmira, R. G. (2002) J. Biol. Chem. 277, 13286-13293[Abstract/Free Full Text]
  28. Cissell, M. A., Zhao, L., Sussel, L., Henderson, E., and Stein, R. (2003) J. Biol. Chem. 278, 751-756[Abstract/Free Full Text]
  29. Matsuoka, T. A., Artner, I., Henderson, E., Means, A., Sander, M., and Stein, R. (2004) Proc. Natl. Acad. Sci. U. S. A. 101, 2930-2933[Abstract/Free Full Text]
  30. Samaras, S. E., Zhao, L., Means, A., Henderson, E., Matsuoka, T. A., and Stein, R. (2003) J. Biol. Chem. 278, 12263-12270[Abstract/Free Full Text]
  31. Blanchi, B., Kelly, L. M., Viemari, J. C., Lafon, I., Burnet, H., Bevengut, M., Tillmanns, S., Daniel, L., Graf, T., Hilaire, G., and Sieweke, M. H. (2003) Nat. Neurosci. 6, 1091-1100[CrossRef][Medline] [Order article via Infotrieve]
  32. Kim, J. I., Li, T., Ho, I. C., Grusby, M. J., and Glimcher, L. H. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 3781-3785[Abstract/Free Full Text]
  33. MacLean, H. E., Kim, J. I., Glimcher, M. J., Wang, J., Kronenberg, H. M., and Glimcher, L. H. (2003) Dev. Biol. 262, 51-63[CrossRef][Medline] [Order article via Infotrieve]
  34. Mears, A. J., Kondo, M., Swain, P. K., Takada, Y., Bush, R. A., Saunders, T. L., Sieving, P. A., and Swaroop, A. (2001) Nat. Genet. 29, 447-452[CrossRef][Medline] [Order article via Infotrieve]
  35. Qiu, Y., Guo, M., Huang, S., and Stein, R. (2002) Mol. Cell. Biol. 22, 412-420[Abstract/Free Full Text]
  36. Qiu, Y., Sharma, A., and Stein, R. (1998) Mol. Cell. Biol. 18, 2957-2964[Abstract/Free Full Text]
  37. Peshavaria, M., Gamer, L., Henderson, E., Teitelman, G., Wright, C. V., and Stein, R. (1994) Mol. Endocrinol. 8, 806-816[Abstract/Free Full Text]
  38. Robinson, G. L., Peshavaria, M., Henderson, E., Shieh, S. Y., Tsai, M. J., Teitelman, G., and Stein, R. (1994) J. Biol. Chem. 269, 2452-2460[Abstract/Free Full Text]
  39. Peshavaria, M., Henderson, E., Sharma, A., Wright, C. V., and Stein, R. (1997) Mol. Cell. Biol. 17, 3987-3996[Abstract]
  40. Lillie, J. W., and Green, M. R. (1989) Nature 338, 39-44[CrossRef][Medline] [Order article via Infotrieve]
  41. Lee, J. S., Galvin, K. M., See, R. H., Eckner, R., Livingston, D., Moran, E., and Shi, Y. (1995) Genes Dev. 9, 1188-1198[Abstract/Free Full Text]
  42. Kelpe, C. L., Moore, P. C., Parazzoli, S. D., Wicksteed, B., Rhodes, C. J., and Poitout, V. (2003) J. Biol. Chem. 278, 30015-30021[Abstract/Free Full Text]
  43. Brummelkamp, T. R., Bernards, R., and Agami, R. (2002) Science 296, 550-553[Abstract/Free Full Text]
  44. Briaud, I., Harmon, J. S., Kelpe, C. L., Segu, V. B., and Poitout, V. (2001) Diabetes 50, 315-321[Abstract/Free Full Text]
  45. Wicksteed, B., Herbert, T. P., Alarcon, C., Lingohr, M. K., Moss, L. G., and Rhodes, C. J. (2001) J. Biol. Chem. 276, 22553-22558[Abstract/Free Full Text]
  46. Ahlgren, U., Jonsson, J., and Edlund, H. (1996) Development 122, 1409-1416[Abstract]
  47. Nishizawa, M., Kataoka, K., and Vogt, P. K. (2003) Oncogene 22, 7882-7890[CrossRef][Medline] [Order article via Infotrieve]
  48. Benkhelifa, S., Provot, S., Nabais, E., Eychene, A., Calothy, G., and Felder-Schmittbuhl, M. P. (2001) Mol. Cell. Biol. 21, 4441-4452[Abstract/Free Full Text]
  49. Qiu, Y., Guo, M., Huang, S., and Stein, R. (2004) J. Biol. Chem. 279, 9796-9802[Abstract/Free Full Text]
  50. St-Onge, L., Sosa-Pineda, B., Chowdhury, K., Mansouri, A., and Gruss, P. (1997) Nature 387, 406-409[CrossRef][Medline] [Order article via Infotrieve]
  51. Oster, A., Jensen, J., Serup, P., Galante, P., Madsen, O. D., and Larsson, L. I. (1998) J. Histochem. Cytochem. 46, 707-715[Abstract/Free Full Text]
  52. Pang, K., Mukonoweshuro, C., and Wong, G. G. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 9559-9563[Abstract/Free Full Text]
  53. Pictet, R., and Rutter, W. J. (1972) Handbook of Physiology (Steiner, D. F., and Frenkel, N., eds) pp. 25-66, Williams and Wilkins, Baltimore, MD
  54. Glick, E., Leshkowitz, D., and Walker, M. D. (2000) J. Biol. Chem. 275, 2199-2204[Abstract/Free Full Text]
  55. Sander, M., Sussel, L., Conners, J., Scheel, D., Kalamaras, J., Dela Cruz, F., Schwitzgebel, V., Hayes-Jordan, A., and German, M. (2000) Development 127, 5533-5540[Abstract]
  56. Mizzen, C. A., and Allis, C. D. (1998) Cell Mol. Life Sci. 54, 6-20[CrossRef][Medline] [Order article via Infotrieve]
  57. Grunstein, M. (1997) Nature 389, 349-352[CrossRef][Medline] [Order article via Infotrieve]
  58. Kingston, R. E., and Narlikar, G. J. (1999) Genes Dev. 13, 2339-2352[Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 Nucleic Acids ResHome page
Y. Yang, B. H.-J. Chang, S. L. Samson, M. V. Li, and L. Chan
The Kruppel-like zinc finger protein Glis3 directly and indirectly activates insulin gene transcription
Nucleic Acids Res., May 1, 2009; 37(8): 2529 - 2538.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
W. Chen, S. Begum, L. Opare-Addo, J. Garyu, T. F. Gibson, A. L. M. Bothwell, V. E. Papaioannou, and K. C. Herold
Promotion of {beta}-Cell Differentiation in Pancreatic Precursor Cells by Adult Islet Cells
Endocrinology, February 1, 2009; 150(2): 570 - 579.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
C. Shao and M. H. Cobb
Sumoylation Regulates the Transcriptional Activity of MafA in Pancreatic {beta} Cells
J. Biol. Chem., January 30, 2009; 284(5): 3117 - 3124.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
S. Guo, R. Burnette, L. Zhao, N. L. Vanderford, V. Poitout, D. K. Hagman, E. Henderson, S. Ozcan, B. E. Wadzinski, and R. Stein
The Stability and Transactivation Potential of the Mammalian MafA Transcription Factor Are Regulated by Serine 65 Phosphorylation
J. Biol. Chem., January 9, 2009; 284(2): 759 - 765.
[Abstract] [Full Text] [PDF]

Home page
 J Mol EndocrinolHome page
C. C Martin, B. P Flemming, Y. Wang, J. K Oeser, and R. M O'Brien
Foxa2 and MafA regulate islet-specific glucose-6-phosphatase catalytic subunit-related protein gene expression
J. Mol. Endocrinol., November 1, 2008; 41(5): 315 - 328.
[Abstract] [Full Text] [PDF]

Home page
 J EndocrinolHome page
I. Artner, Y. Hang, M. Guo, G. Gu, and R. Stein
MafA is a dedicated activator of the insulin gene in vivo
J. Endocrinol., August 1, 2008; 198(2): 271 - 279.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
H.-Y. Seo, Y. D. Kim, K.-M. Lee, A.-K. Min, M.-K. Kim, H.-S. Kim, K.-C. Won, J.-Y. Park, K.-U. Lee, H.-S. Choi, et al.
Endoplasmic Reticulum Stress-Induced Activation of Activating Transcription Factor 6 Decreases Insulin Gene Expression via Up-Regulation of Orphan Nuclear Receptor Small Heterodimer Partner
Endocrinology, August 1, 2008; 149(8): 3832 - 3841.
[Abstract] [Full Text] [PDF]

Home page
 Genes Dev.Home page
J. M. Oliver-Krasinski and D. A. Stoffers
On the origin of the {beta} cell
Genes & Dev., August 1, 2008; 22(15): 1998 - 2021.
[Abstract] [Full Text] [PDF]

Home page
 J EndocrinolHome page
H.-W. Wang, M. Muguira, W.-D. Liu, T. Zhang, C. Chen, R. Aucoin, M. B Breslin, and M. S Lan
Identification of an INSM1-binding site in the insulin promoter: negative regulation of the insulin gene transcription
J. Endocrinol., July 1, 2008; 198(1): 29 - 39.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Endocrinol.Home page
T.-a. Matsuoka, H. Kaneto, R. Stein, T. Miyatsuka, D. Kawamori, E. Henderson, I. Kojima, M. Matsuhisa, M. Hori, and Y. Yamasaki
MafA Regulates Expression of Genes Important to Islet {beta}-Cell Function
Mol. Endocrinol., November 1, 2007; 21(11): 2764 - 2774.
[Abstract] [Full Text] [PDF]

Home page
 Endocr. Rev.Home page
M. C. Jorgensen, J. Ahnfelt-Ronne, J. Hald, O. D. Madsen, P. Serup, and J. Hecksher-Sorensen
An Illustrated Review of Early Pancreas Development in the Mouse
Endocr. Rev., October 1, 2007; 28(6): 685 - 705.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
S.-i. Han, S. Aramata, K. Yasuda, and K. Kataoka
MafA Stability in Pancreatic {beta} Cells Is Regulated by Glucose and Is Dependent on Its Constitutive Phosphorylation at Multiple Sites by Glycogen Synthase Kinase 3
Mol. Cell. Biol., October 1, 2007; 27(19): 6593 - 6605.
[Abstract] [Full Text] [PDF]

Home page
 J BiochemHome page
K. Kataoka
Multiple Mechanisms and Functions of Maf Transcription Factors in the Regulation of Tissue-Specific Genes
J. Biochem., June 1, 2007; 141(6): 775 - 781.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
I. Artner, B. Blanchi, J. C. Raum, M. Guo, T. Kaneko, S. Cordes, M. Sieweke, and R. Stein
MafB is required for islet beta cell maturation
PNAS, March 6, 2007; 104(10): 3853 - 3858.
[Abstract] [Full Text] [PDF]

Home page
 DiabetesHome page
K.-G. Park, K.-M. Lee, H.-Y. Seo, J.-H. Suh, H.-S. Kim, L. Wang, K.-C. Won, H.-W. Lee, J.-Y. Park, K.-U. Lee, et al.
Glucotoxicity in the INS-1 Rat Insulinoma Cell Line Is Mediated by the Orphan Nuclear Receptor Small Heterodimer Partner
Diabetes, February 1, 2007; 56(2): 431 - 437.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
N. L. Vanderford, S. S. Andrali, and S. Ozcan
Glucose Induces MafA Expression in Pancreatic Beta Cell Lines via the Hexosamine Biosynthetic Pathway
J. Biol. Chem., January 19, 2007; 282(3): 1577 - 1584.
[Abstract] [Full Text] [PDF]

Home page
 DiabetesHome page
C. W. Hay and K. Docherty
Comparative Analysis of Insulin Gene Promoters: Implications for Diabetes Research
Diabetes, December 1, 2006; 55(12): 3201 - 3213.
[Abstract] [Full Text] [PDF]

Home page
 Eur J EndocrinolHome page
M. E Cerf
Transcription factors regulating {beta}-cell function.
Eur. J. Endocrinol., November 1, 2006; 155(5): 671 - 679.
[Abstract] [Full Text] [PDF]

Home page
 J. Nutr.Home page
V. Poitout, D. Hagman, R. Stein, I. Artner, R. P. Robertson, and J. S. Harmon
Regulation of the Insulin Gene by Glucose and Fatty Acids
J. Nutr., April 1, 2006; 136(4): 873 - 876.
[Abstract] [Full Text] [PDF]

Home page
 J EndocrinolHome page
J. Le Lay and R. Stein
Involvement of PDX-1 in activation of human insulin gene transcription
J. Endocrinol., February 1, 2006; 188(2): 287 - 294.
[Abstract] [Full Text] [PDF]

Home page
 DiabetesHome page
I. Artner, J. Le Lay, Y. Hang, L. Elghazi, J. C. Schisler, E. Henderson, B. Sosa-Pineda, and R. Stein
MafB: An Activator of the Glucagon Gene Expressed in Developing Islet {alpha}- and {beta}-Cells
Diabetes, February 1, 2006; 55(2): 297 - 304.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
280/12/11887    most recent
M409475200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhao, L.
Right arrow Articles by Stein, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhao, L.
Right arrow Articles by Stein, R.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2005 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement