Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M409580200 on January 6, 2005

J. Biol. Chem., Vol. 280, Issue 13, 12573-12584, April 1, 2005
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
280/13/12573    most recent
M409580200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Maxwell, M. A.
Right arrow Articles by Muscat, G. E. O.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Maxwell, M. A.
Right arrow Articles by Muscat, G. E. O.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Nur77 Regulates Lipolysis in Skeletal Muscle Cells

EVIDENCE FOR CROSS-TALK BETWEEN THE {beta}-ADRENERGIC AND AN ORPHAN NUCLEAR HORMONE RECEPTOR PATHWAY*

Megan A. Maxwell{ddagger}, Mark E. Cleasby§, Angus Harding¶, Annika Stark¶, Gregory J. Cooney§, and George E. O. Muscat{ddagger}||

From the Institute for Molecular Bioscience {ddagger}Division of Molecular Genetics and Development and Division of Molecular Cell Biology, University of Queensland, St. Lucia Queensland 4072 and §Diabetes and Obesity Research Program, Garvan Institute of Medical Research, 384 Victoria St., Darlinghurst, New South Wales 2010 Australia

Received for publication, August 20, 2004 , and in revised form, January 1, 2005.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Skeletal muscle is a major mass peripheral tissue that accounts for ~40% of total body weight and 50% of energy expenditure and is a primary site of glucose disposal and fatty acid oxidation. Consequently, muscle has a significant role in insulin sensitivity, obesity, and the blood-lipid profile. Excessive caloric intake is sensed by the brain and induces {beta}-adrenergic receptor ({beta}-AR)-mediated adaptive thermogenesis. {beta}-AR null mice develop severe obesity on a high fat diet. However, the target gene(s), target tissues(s), and molecular mechanism involved remain obscure. We observed that 30–60 min of {beta}-AR agonist (isoprenaline) treatment of C2C12 skeletal muscle cells strikingly activated (>100-fold) the expression of the mRNA encoding the nuclear hormone receptor, Nur77. In contrast, the expression of other nuclear receptors that regulate lipid and carbohydrate metabolism was not induced. Stable transfection of Nur77-specific small interfering RNAs (siNur77) into skeletal muscle cells repressed endogenous Nur77 mRNA expression. Moreover, we observed attenuation of gene and protein expression associated with the regulation of energy expenditure and lipid homeostasis, for example AMP-activated protein kinase {gamma}3, UCP3, CD36, adiponectin receptor 2, GLUT4, and caveolin-3. Attenuation of Nur77 expression resulted in decreased lipolysis. Finally, in concordance with the cell culture model, injection and electrotransfer of siNur77 into mouse tibialis cranialis muscle resulted in the repression of UCP3 mRNA expression. This study demonstrates regulatory cross-talk between the nuclear hormone receptor and {beta}-AR signaling pathways. Moreover, it suggests Nur77 modulates the expression of genes that are key regulators of skeletal muscle lipid and energy homeostasis. In conclusion, we speculate that Nur77 agonists would stimulate lipolysis and increase energy expenditure in skeletal muscle and suggest selective activators of Nur77 may have therapeutic utility in the treatment of obesity.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Obesity and fat deposition are primarily controlled by food intake and energy expenditure. Obesity has been linked to the development of heart disease, cancer, and stroke, the top three causes of death in the United States, and has recently been recognized by the World Health Organization as one of the top 10 global health problems. Moreover, obesity leads to metabolic syndrome X, a disorder that includes elevated levels of triglycerides and low density lipoprotein (bad) cholesterol, low levels of high density lipoprotein (good) cholesterol, impaired fasting glucose, and hypertension (2). These are cardiovascular risk factors for diseases such as atherosclerosis and type II diabetes. More than 65% of United States adults are overweight, and >30% of adults (greater than 61 million people) are clinically obese (1, 2).

Diet, lifestyle, metabolism, and genetics are the most significant factors in controlling weight. Current obesity therapies perform modestly and are aimed at central appetite suppression and reduced fat absorption. Recent research suggests that therapeutic strategies which control satiety, reduce cellular energy stores, and increase adaptive thermogenesis and lipid catabolism provide new hope in the quest for novel anti-obesity drugs (1, 2).

Mechanisms exist that sense dietary excess and trigger increases in energy expenditure in an effort to preserve the fat mass set point. This process is responsive to cold and diet and results in the uncoupling of fuel oxidation from ATP synthesis, with the energy/proton gradient released in the form of heat rather than ATP production and is, thus, termed "adaptive thermogenesis."

Known components of the energy expenditure system include leptin, leptin receptor, {alpha}-melanocyte-stimulating hormone, melanocortin-4 receptor, and the {beta}-adrenergic receptors ({beta}-ARs).1 However, many questions remain unanswered, including the hardwiring of the central neural circuits regulating energy balance, the efferent pathways, target tissues, target genes, and intracellular mechanisms involved (Refs. 3 and 4 and references therein).

The sympathetic nervous system (SNS) is an important efferent pathway that has been implicated in the control of adaptive thermogenesis. The evidence includes the following. Cold and diet induce increases in SNS activity, epinephrine stimulates energy expenditure, brown fat (a thermogenic target tissue) is heavily innervated by the SNS, and thermogenic activity is dependent on an intact SNS. {beta}-ARs and agonists transmit the thermogenic signals to peripheral tissues and mediate SNS activity (for review, see Refs. 3–5). Based on the above findings, a model has been proposed by Lowell and Bachman (3) that highlights the key aspects of adrenergic-induced thermogenesis: diet -> brain -> SNS -> {beta}-ARs -> target tissue -> thermogenesis.

The uncoupling proteins (UCP1–3) allow proton "leakage" across the inner mitochondrial membrane for the purpose of heat generation at the expense of coupled ATP production. The mechanism of adaptive thermogenesis in response to cold exposure has been elucidated and involves UCP1, which is highly expressed in brown fat. Knock-out experiments in rodents have demonstrated that UCP1 and brown fat mediate cold-induced thermogenesis; however, these animals are not obese and are resistant to diet-induced obesity (6). Knock-out mouse models of the UCP1 homologs, UCP2 and -3 (which are expressed in white adipose and skeletal muscle), have not provided clarification for a role in maintaining energy expenditure in that their responses to cold and high fat feeding are normal, and they show normal body weight and cold tolerance (for review, see Refs. 3 and references therein; Refs. 7–10). However, some resolution and understanding of the potential mechanisms controlling diet-induced thermogenesis has come from {beta}-AR-less mice that are obese and completely lack both cold and diet-induced thermogenesis, indicating that {beta}-AR play a role in both responses (5). However, identification of the target tissues relevant to diet-induced thermogenesis has remained elusive, and the possibilities include skeletal muscle, white adipose tissue, and liver, all of which are innervated by the SNS (3, 5).

Skeletal muscle is one of the most metabolically demanding major mass peripheral tissues that accounts for 50% of energy expenditure. Moreover, this lean tissue relies heavily on fatty acids as an energy source, accounts for 75% of glucose disposal, and is involved in cholesterol efflux. Consequently, muscle has a significant role in insulin sensitivity and the blood-lipid profile. These facts alone suggest that muscle has an important role in obesity and suggest muscle may have an important role in diet-induced modulation of energy expenditure.

The orphan nuclear hormone receptor NR4A subgroup is expressed in skeletal muscle, and intriguingly, NR4A1/Nur77 induction by {beta}-AR agonists has been described in a single report (11). As mentioned above, the {beta}-AR pathways have been implicated in responses to diet-induced thermogenesis. Moreover, skeletal muscle is rapidly emerging as a critical target tissue in the battle against obesity (12, 13), metabolic syndrome X (14), type II diabetes (15), and dyslipidemia (12–14, 16). Nuclear hormone receptors (NRs) in skeletal muscle, for example LXR (17) and PPAR{alpha} (18), -{beta}/{delta} (14) and -{gamma} (15), have been shown to be involved in enhancing insulin-stimulated glucose disposal rate, decreasing triglycerides, and increasing lipid catabolism, cholesterol efflux, and plasma high density lipoprotein C levels. Hence, understanding the link between the Nur77 orphan nuclear receptor, the {beta}-adrenergic response, and energy expenditure (adaptive thermogenesis) has important implications for obesity.

This study focuses on the molecular regulation of gene expression involved in lipid and energy homeostasis in skeletal muscle cells by orphan nuclear receptors. We hypothesize that Nur77 (NR4A1) is involved in mediating {beta}-AR signaling and that skeletal muscle is a critical target tissue in the regulation of energy expenditure.

Our investigation utilizes small interfering RNA (siRNA)-mediated knock-out of Nur77 in skeletal muscle cells to understand the regulatory role of a {beta}-AR agonist-induced nuclear hormone receptor in this major mass peripheral tissue. 30–60 min {beta}-AR agonist treatment of muscle cells strikingly activated (>100-fold) the expression of the mRNA encoding Nur77. In contrast, the expression of the other nuclear receptors was not induced. Furthermore, the study demonstrates that Nur77 is necessary for the expression of a subgroup of genes involved in energy balance and expenditure, including AMPK{gamma}3 and UCP3. This is consistent with the observation that this orphan nuclear receptor is hypersensitive to adrenergic stimulation.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Cell Culture—Mouse myogenic C2C12 cells were cultured in growth medium (Dulbecco's modified Eagle's medium supplemented with 10% heat-inactivated Serum Supreme (BioWhittaker, Edward Keller Pty Ltd., Hallam, Victoria, Australia)) in 6% CO2. Myoblasts were differentiated into post-mitotic multinucleated myotubes by 5 days of serum withdrawal (i.e. cultured in Dulbecco's modified Eagle's medium supplemented with 2% horse serum). Cells were harvested at the indicated time points, usually 120 h (5 days) after mitogen withdrawal, unless indicated differently. African green monkey kidney COS-1 cells were grown in Dulbecco's modified Eagle's medium supplemented with 10% heat-inactivated fetal calf serum. For the {beta}-adrenergic agonist experiments, myotubes were treated with 100 nM isoprenaline hydrochloride (Calbiochem) or the vehicle control, ethanol, for the indicated time intervals.

Transient Transfections—Each well of a 24-well plate of COS-1 cells (~60% confluence) was transfected with a total of ~0.6 µg of DNA using the liposome-mediated transfection procedure as described previously (13). Cells were transfected using a DOTAP (N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium methyl sulfate and Metafectene (Biontex Laboratories GmbH, Munich, Germany) liposome mixture in 1x HEPES-buffered saline (42 mM HEPES, 275 mM NaCl, 10 mM KCl, 0.4 mM Na2HPO4, 11 mM dextrose (pH 7.1)). The DNA/DOTAP/Metafectene mixture was added to the cells in 0.6 ml of Dulbecco's modified Eagle's medium supplemented with 5% fetal calf serum. 16 h later the culture medium was changed, and after a further 24 h the cells were harvested for the assay of luciferase activity. Values are expressed as relative light units ± S.D. and were derived from a minimum of two independent experiments composed of six replicates.

C2C12 Stable Transfection—Myogenic C2C12 cells cultured in growth medium were transfected with pSilencer 2.1-siNur77(DE) by the liposome-mediated procedure. The cells were then grown for another 24 h to allow cell recovery and neomycin resistance expression before G418 selection. After 10–14 days of selection with 500 µg/ml G418 (Invitrogen) in culture medium, the polyclonal pool (>50 G418-resistant colonies) of stable transfectants were cultured and maintained on 50 or 250 µg/ml G418 medium.

RNA Extraction and cDNA Synthesis—Total RNA was extracted from C2C12 cells and tibialis cranialis muscles (after grinding and homogenization of muscle tissue) using TRI-Reagent (Sigma-Aldrich) according to manufacturer's protocol. This was followed by DNase treatment with 2 units of Turbo DNase (Ambion, Austin, TX) for 1 h followed by heating to 75 °C for 10 min to inactivate the DNase. RNA for quantitative real time PCR was further purified using the RNeasy RNA extraction kit (Qiagen, Clifton Hill, Victoria, Australia) according to manufacturer's instructions. RNA was quantitated using UV spectrophotometry, and complementary DNA was synthesized from 3 µg of total RNA using an oligo(dT)18 primer and Superscript III reverse transcriptase (Invitrogen) according to the manufacturer's instructions.

Quantitative Real Time (Q-RT)-PCR—Target cDNA levels were analyzed by Q-RT-PCR in 25-µl reactions containing either 1x SYBR green (ABI, Warrington, UK) or Taqman PCR master mix (ABI, Branchburg, NJ), 200 nM each forward and reverse primers or 1x Assay-on-Demand Taqman primers (ABI, Foster City, CA), and the equivalent of 0.3 µl of cDNA. Using an ABI Prism 7000 sequence detection system, PCR was conducted over 45 cycles of 95 °C for 15 s and 60 °C for 1 min preceded by an initial 95 °C for 10 min to activate the Amplitaq Gold DNA polymerase. The relative level of expression or fold change and associated errors were calculated using the guidelines described by Bookout and Mangelsdorf (19) on the Nuclear Receptor Signaling Atlas website (NURSA) (www.nursa.org/index.cfm) in accord with the accepted Q-PCR standards for National Institutes of Health-supported NURSA research.

Primers—Primers used for Q-RT-PCR analysis of the mRNA populations have been described in detail (13), with the exception of primers designed for the detection of Nur77 using SYBR green (Nur77-F, TGATGTTCCCGCCTTTGC; Nur77-R, CAATGCGATTCTGCAGCTCTT). Assay-on-demand primer/probe sets for Nur77, AMPK{gamma}1, and AMPK{gamma}3 (Applied Biosystems) were also used for Taqman real time PCR.

Plasmids—POMC-tkLUC, pSG5-Nur77, and pSG5 have been described previously (20, 21). The pairs of oligonucleotides used for cloning the Nur77 siRNA targets into the pSilencer 2.1 and 3.1 vector were as follows: AB region, GATCCCGCTTCCAGCCGTCCCAGCTTTTCAAGAGAAAGCTGGGACGGCTGGAAGTTTTTTGGAAA and AGCTTTTCCAAAAAACTTCCAGCCGTCCCAGCTTTCTCTTGAAAAGCTGGGACGGCTGGAAGCGG; DE region, GATCCCGTCCCTGGCTTCATTGAGCTTTCAAGAGAAGCTCAATGAAGCCAGGGATTTTTTGGAAA and AGCTTTTCCAAAAAATCCCTGGCTTCATTGAGCTTCTCTTGAAAGCTCAATGAAGCCAGGGACGG. These pairs of oligonucleotides were annealed and cloned into both the pSilencer 2.1 neo and pSilencer 3.1 neo expression vectors (Ambion, Austin, TX) as per the manufacturer's protocol.

In Vivo Electrotransfer into Mice—Plasmid vectors were propagated in ampicillin-selective media. DNA was extracted, purified using endotoxin-free maxi-prep kits (Qiagen Pty Ltd., Doncaster, Victoria, Australia), and re-suspended in sterile 0.9% saline. Anesthesia was induced in mice using 5% halothane in oxygen and maintained with 1–2% halothane in oxygen with administration of 5 mg/kg ketoprofen to provide post-operative analgesia. The hindlimbs of mice were shaved and prepared with a chlorhexidine-ethanol solution, and one tibialis cranialis muscle was injected in oblique fashion transcutaneously along their length with 30 µl of saline containing 0.5 mg/ml of each vector (pEGFP and pSilencer 2.1-siNur77(DE)) using a 29-gauge needle. The injection was immediately followed by the application of a pair of caliper electrodes across the injected leg connected to an ECM-830 electroporator device (BTX, Holliston, MA). Eight 20-ms pulses of 200 V/cm at a frequency of 1 Hz were administered as described previously (22). The other tibialis cranialis muscle was injected in the same fashion with the appropriate control vectors (pEGFP and pSilencer 2.1 negative) and electroporated using the same procedure. After recovery, animals were monitored daily for body weight and general condition. No adverse effects on the animals were noted during the experiment. One week after electrotransfer mice were killed, and the tibialis cranialis muscles were collected and immediately frozen in liquid nitrogen and stored at –70 °C for subsequent analysis.

Western Blotting—Cell lysates normalized for protein concentration and resolved on SDS-PAGE gels were transferred to polyvinylidene difluoride or nitrocellulose membranes using semidry transfer. The molecular mass of resolved proteins was determined by comparison with Precision Plus markers (Bio-Rad). The membranes were probed with anti-CPT1-m (CPT1, muscle) polyclonal antibody (Alpha Diagnostic International, Inc., San Antonio, TX), anti-GLUT4 polyclonal antibody (a gift of Prof. David James, Garvan Institute of Medical Research), and anti-CAV3 monoclonal antibody (BD Transduction Laboratories, San Jose, CA) followed by appropriate horseradish peroxidase-conjugated secondary antibodies (Zymed Laboratories Inc., San Francisco, CA). The horseradish peroxidase conjugate was detected using enhanced chemiluminescence (SuperSignal West Pico Chemiluminescent substrate, Pierce), and immunoreactivity was visualized by autoradiography.

Lipolysis Assay—Triglyceride hydrolysis (lipolysis) was assessed in C2C12 cells and the C2C12:siNur77 cells using the adipolysis assay kit (Chemicon Australia Pty Ltd., Boronia, Victoria, Australia) as per the manufacturer's instructions. Briefly, C2C12 cells and C2C12-siNur77 cells were differentiated for 5 days, the culture media was removed, and the monolayer was washed twice with wash solution (Hanks' balanced salt solution). 250 µl of incubation solution (Hanks' balanced salt solution + 2% bovine serum albumin) was added to the wells in triplicate, and cells were incubated for 1, 3, and 6 h. At each time point the incubation solution was removed and stored at –20 °C until analyzed. To measure lipolysis, 200 µl of free glycerol assay reagent was added to 25 µl of culture supernatants and glycerol standards and incubated for 15 min, and the absorbance was read at 540 nm. A standard curve constructed from the glycerol standards was used to calculate the concentration of glycerol in the culture supernatants.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Nur77 mRNA Is Expressed in Skeletal Muscle Cells and Induced during Myogenesis—To elucidate the functional role of Nur77 in skeletal muscle, we initially investigated the expression of Nur77 mRNA relative to GAPDH in the mouse C2C12 myoblast cell line. Proliferating C2C12 myoblasts can be induced to biochemically and morphologically differentiate into post-mitotic multinucleated myotubes by serum withdrawal in culture over a 48–96-h period (Fig. 1A).



View larger version (34K):
[in this window]
[in a new window]
  		FIG. 1.
Nur77 mRNA is expressed and induced during myogenesis in skeletal muscle cells. A, schematic illustration of the cell culture model. Proliferating myoblasts were differentiated into post-mitotic multinucleated myotubes by 5 days of serum withdrawal. B–K, Q-RT-PCR analysis of mRNA expression during skeletal myogenesis. RNA extracted from C2C12 PMB and MT5 was reverse-transcribed to cDNA and analyzed by Q-RT-PCR for each target gene. Results were normalized to GAPDH and presented as number of target transcripts per GAPDH transcript ±S.D. B, Nur77 mRNA levels; C, myogenin mRNA levels; D, troponin I type 1 (slow) (TNNI1) mRNA levels; E, troponin I type 2 (fast) TNNI2 mRNA levels; F, UCP3 mRNA levels; G, LPL mRNA levels; H, GLUT4 mRNA levels; I, fatty acid translocase (FAT)/CD36 mRNA levels; J, AMPK{gamma}3 mRNA levels; K, CAV3 mRNA levels.

 
We utilized the ABI Taqman Nur77 primer set and also used the GenBankTM sequences of Nur77 to design specific primers for the SYBR green mediated amplification of mouse Nur77 by quantitative real time PCR using total RNA isolated from proliferating and differentiated C2C12 cells. Total RNA was isolated from proliferating myoblasts and post-mitotic myotubes after 5 days (MT5) of serum withdrawal and converted to cDNA, and the expression levels of various genes was then examined by real time PCR.

We observed that Nur77 is weakly expressed in proliferating myoblasts; however, the transcript is induced ~4 fold relative to GAPDH mRNA as the cells exit the cell cycle and fuse to form differentiated multinucleated myotubes that have acquired a muscle-specific phenotype (Fig. 1B). Concomitant with this increase in Nur77 mRNA was the striking induction of the slow (type I, TNNI1) and fast (type II, TNNI2) isoforms of the contractile protein, troponin I, relative to GAPDH mRNA (Fig. 1, D and E). Moreover, we observed the significant induction of myogenin mRNA that encodes the hierarchical bHLH regulator (Fig. 1C). These data confirmed that the cells had terminally differentiated. Furthermore, we observed the induction of the mRNAs encoding UCP3 (Fig. 1F), LPL (Fig. 1G), the GLUT4 transporter (Fig. 1H), the fatty acid translocase, CD36 (Fig. 1I), the type II/glycolytic muscle specific AMPK{gamma}3 (Fig. 1J), and caveolin 3 (CAV3, Fig. 1K). These are examples of mRNAs encoding proteins involved in the regulation of energy expenditure and lipid and carbohydrate metabolism (as described in Table I). In summary, these data demonstrate that the mRNA transcript encoding Nur77 was expressed in C2C12 cells in a differentiation-dependent manner, concomitant with the acquisition of a contractile and metabolic phenotype.


View this table:
[in this window]
[in a new window]
  		TABLE I
Key target genes in this study

 
{beta}-Adrenergic Agonist Treatment Transiently Induces Nur77 mRNA Expression in Skeletal Muscle Cells—We utilized the C2C12 cell culture model to examine whether regulatory cross-talk occurred between the {beta}-adrenergic and nuclear hormone receptor signaling pathways in skeletal muscle. There has been a single report describing the induction of Nur77 by adrenergic agonists in muscle (11), and a second manuscript reported that epinephrine induced Nur77 in the brain (23); however, these single observations have not been reproduced in the literature.

Therefore, to investigate and substantiate these conclusions, we treated differentiated post-mitotic skeletal muscle myotubes with the {beta}-adrenergic agonist, isoprenaline (and the vehicle, ethanol) for 30, 45, 60, 120, and 240 min and subsequently isolated total RNA. Q-RT-PCR was utilized to examine the expression of mRNAs encoding Nur77 and a number of other nuclear hormone receptors that regulate lipid homeostasis. Interestingly, we observed that the mRNA encoding Nur77 was dramatically induced (>100-fold) after 30–60 min of incubation with isoprenaline (Fig. 2). Activation of expression was transient and declined after 60 min of treatment. There was a slight induction of Nur77 with ethanol alone, a response that has been noted in another report (24), and this is not surprising given that Nur77 has been implicated as a stress-response gene (25). Furthermore, we examined the expression of many other nuclear hormone receptors that have been demonstrated to regulate lipid and carbohydrate metabolism, including ERR-1, PPAR{alpha}, -{beta}/{delta}, and -{gamma}, LXR{alpha} and -{beta}, Rev-erb{alpha}, RVR, ROR{alpha}, and COUP-TFI and II. In contrast to the striking induction of Nur77, the expression of the mRNAs encoding the NRs above did not respond to {beta}-adrenergic agonist treatment (Table II).



View larger version (12K):
[in this window]
[in a new window]
  		FIG. 2.
{beta}-Adrenergic agonist (isoprenaline) treatment transiently induces Nur77 expression in skeletal muscle cells. C2C12 MT5 cells were treated with vehicle (ethanol) or isoprenaline for 30, 45, 60, 180, and 240 min. Levels of Nur77 mRNA were quantitated by Q-RT-PCR. Expression was normalized and presented as the number of target transcripts per 18 S transcript ± S.D.

 


View this table:
[in this window]
[in a new window]
  		TABLE II
Relative expression of nuclear hormone receptors after vehicle and isoprenaline treatment, presented as the number of target transcripts per 18 S transcript

 
In summary, these data clearly demonstrate that {beta}-adrenergic agonists selectively and dramatically activated the mRNA encoding Nur77 (and not other nuclear receptors). This suggests that {beta}-adrenergic agonists and Nur77 may have a unique regulatory footprint in skeletal muscle cells and demonstrates cross-talk between the {beta}-adrenergic and an orphan nuclear hormone receptor pathway.

Nur77-siRNA Expression Attenuates Nur77-mediated Gene Expression and Represses Endogenous Levels of Nur77 mRNA—To understand the biological role of Nur77 in skeletal muscle lipid and energy homeostasis and to identify the metabolic target genes of this orphan receptor in muscle cells, we proceeded to examine the effect of ablation. This would provide a tool for elucidating the consequences of {beta}-AR-mediated induction of Nur77. Furthermore, the analysis of the C2C12-siNur77 cell line would ascertain the extent of cross-talk between the {beta}-adrenergic and Nur77-signaling pathways in the context of target genes and metabolic pathways.

We utilized RNA interference to achieve targeted silencing of Nur77 using double-stranded siRNA expression as the triggering agent. Two siRNA target sequences were chosen using the siRNA target finder on the Ambion web site (www.ambion.com/techlib/misc/siRNA_finder.html). The selected siRNAs (Fig. 3A) were cloned into the Silencer 2.1 and 3.1 plasmid expression vectors, driven, respectively, by the U6 and H1 RNA polymerase III promoters. The efficacy of the cloned siRNAs and their ability to attenuate trans-activation of the native Nur77-dependent heterologous reporter gene (Fig. 3B) in the presence of exogenous and overexpressed Nur77 was analyzed. This demonstrated that the Silencer 2.1 plasmid driving the siRNA targeting the C-terminal DE region (encoding the putative ligand binding domain of Nur77) most successfully attenuated Nur77-dependent gene expression.



View larger version (16K):
[in this window]
[in a new window]
  		FIG. 3.
Nur77 siRNA attenuates Nur77-dependent trans-activation and represses the endogenous levels of Nur77 mRNA expression. A, diagrammatic representation of Nur77 depicting the location of the N- and C-terminal siRNAs. B, pSG5-Nur77 and either pSilencer 2.1 negative or pSilencer 2.1-Nur77(DE) were co-transfected with POMCx5-TKLuc into COS-1 cells. Mean luciferase activity is expressed as relative light units (RLU) ± S.D. (n = 6). C, Q-RT-PCR analyses of Nur77 mRNA levels in native C2C12 and C2C12-siNur77 myotubes, with expression normalized and presented as the number of target transcripts per GAPDH transcript ± S.D. aa, amino acid.

 
We stably transfected C2C12 cells with the Silencer 2.1-siNur77(DE) vector and isolated a polyclonal pool of G418-resistant colonies (comprised of >50 G418 resistant colonies and, henceforth, denoted as C2C12-siNur77). Q-RT-PCR demonstrated the C2C12-siNur77 cells expressed reduced levels (~10-fold) of the Nur77 mRNA transcript relative to the native C2C12 cells (Fig. 3C). In conclusion, the C2C12-siNur77 cell line displayed attenuated Nur77 mRNA expression.

Exogenous Nur77-siRNA Represses the Expression of the mRNAs Encoding Genes That Regulate Lipid and Energy Homeostasis—The C2C12 in vitro cell culture system has been extensively used to investigate the regulation of lipid homeostasis (12, 13, 17, 26–30). Moreover, the physiological validation of the cell culture model with respect to the control of lipid metabolism by LXR and PPARs in the mouse (14, 17, 18, 31, 32) corroborates the utility of this model system.

Hence, we proceeded to examine the effect of attenuating Nur77 mRNA expression on the expression of genes involved in lipid and energy homeostasis (see Table I). We compared expression in the siNur77-expressing stable cell line relative to the wild type C2C12 cell line. Specifically, both cell lines were induced to differentiate into post-mitotic multinucleated myotubes by mitogen withdrawal in culture over a 5-day period and isolated total RNA from the native and siNur77-expressing cell line for Q-RT-PCR analysis.

Initially, we examined the expression of markers indicative of differentiation to ascertain whether the siNur77 cell line retained the potential to morphologically and biochemically differentiate. Over a 5-day period the C2C12-siNur77 cell line retained the potential to morphologically differentiate. Moreover, the induction and activation of myogenin (Fig. 4A), troponin I slow (Fig. 4B, TNNI1), and troponin I fast (Fig. 4C, TNNI2) mRNA expression after serum withdrawal demonstrated that the cell line biochemically differentiated. Furthermore, we examined the relative expression of myogenin and TNNI1 and -2 in wild type C2C12 versus C2C12-siNur77 myotubes after 5 days of serum withdrawal. We observed that myogenin mRNA expression (Fig. 4D) was increased ~2-fold, whereas TNNI1 (Fig. 4E) and TNNI2 (Fig. 4F) mRNA expression were down-regulated ~3-fold.



View larger version (14K):
[in this window]
[in a new window]
  		FIG. 4.
The C2C12-siNur77 cell line acquires biochemical markers of skeletal muscle. A, B, and C, Q-RT-PCR analyses of myogenin and troponin I type I (slow) and II (fast) mRNA levels, respectively, in the C2C12-siNur77 cell line. D, E, and F, Q-RT-PCR analyses of myogenin and troponin I type I (slow) and II (fast) mRNA levels, respectively, in the native C2C12 and the C2C12-siNur77 cell line. Expression was normalized and presented as number of target transcripts per GAPDH transcript ±S.D. PMB, proliferating myoblasts; MT5, post-mitotic myotubes after 5 days.

 
For the sake of brevity we will only show the graphical data for a number of genes; the complete list of genes examined and their relative expression are presented in Table III. In the context of lipid and fatty acid absorption we observed significant (~8-fold) repression of the mRNA encoding fatty acid translocase (FAT/CD36, Fig. 5A) relative to the changes observed in the biochemical markers of differentiation. Moreover, the noteworthy repression of CD36 was highlighted by the minor changes (<2.5-fold) observed for fatty acid-binding protein 3 (FABP-3) and 4 (FABP-4) in the siNur77-expressing cell line, respectively (see Table III), similar to the minor changes observed in the biochemical markers of differentiation. These negligible alterations in the siNur77-expressing cell line correlated with the subtle up and down variations observed in the biochemical markers of differentiation, in contrast to the dramatic repression of CD36 mRNA expression.


View this table:
[in this window]
[in a new window]
  		TABLE III
Relative mRNA expression and -fold change for genes involved in metabolism from native C2C12 and C2C12-siNur77 cells

MCAD, medium chain acyl-CoA dehydrogenase; ADRP, adipocyte differentiation-related protein; FAS, fatty acid synthase; FABP, fatty acid-binding protein; PDK, pyruvate dehydrogenase kinase; SCD, stearoyl-CoA desaturase; ACS4, acyl-CoA synthetase 4; ABC, ATP binding cassette; PGC-1, peroxisome proliferator-activated receptor gamma, coactivator 1; GYG1, glycogenin.

 



View larger version (24K):
[in this window]
[in a new window]
  		FIG. 5.
Expression profiling by Q-RT-PCR of mRNAs involved in metabolism; analyses of the wild type native C2C12 cells and the C2C12-siNur77 cells. Q-RT-PCR analysis of endogenous mRNA expression encoding enzymes/proteins involved in lipid homeostasis, energy expenditure, etc. (described in Table I). The results were normalized and presented as the number of target transcripts per GAPDH transcript ±S.D. The category in Table I to which these genes belong is indicated. Lipid absorption, fatty acid translocase (CD36/FAT) (A); sugar uptake, GLUT4 (B) and GLUT5 (C); energy expenditure, UCP2 (D) and UCP3 (E); lipid catabolism, adiponectin receptor 2 (AdipoR2)(F) and AdipoR1 (G); energy balance, AMPK{gamma}3 (H) and AMPK{gamma}1 (I); lipid efflux and storage, CAV3 (J).

 
The expression of the mRNA encoding the glucose transporter, GLUT4, was repressed ~10-fold (Fig. 5B) in the siNur77-expressing cell line. In contrast, the expression of the mRNA encoding the fructose transporter, GLUT5, was unchanged by Nur77 attenuation (Fig. 5C, Table III).

In the context of the regulation of energy expenditure and energy balance, we examined the expression of several genes (see Tables I and III). The expression of a small subgroup of genes emerged as being clearly dependent on Nur77 expression. For example, the mRNAs encoding UCP3 and AMPK{gamma}3 (preferentially expressed in glycolytic fast muscle fibers) were significantly repressed (~6–20-fold; Fig. 5, D and H) in the siNur77-expressing cell line relative to the ~2-fold changes observed in the markers of differentiation (Fig. 4, D–F, Table III). Consistent with the effects on this subgroup of genes, we observed that adiponectin receptor 2 (Fig. 5F) (but not adiponectin receptor 1; Fig. 5G) was repressed ~4-fold). This receptor for the anti-diabetic adipokine Acrp30/adiponectin has been reported to activate AMPK and fatty acid oxidation.

Interestingly, the mRNA encoding the hierarchical regulator of lipogenesis, sterol regulatory element binding protein-1c (SREBP-1c), was increased ~4-fold; this is consistent with abrogation of AMPK{gamma}3 mRNA expression, which in animals leads to excessive triglyceride accumulation (33). Surprisingly, the lipogenic downstream target genes including stearoyl-CoA desaturase 1 and 2 and fatty acid synthase (see Table III) were not affected in the siNur77-expressing cell line. The expression of the transcripts encoding LPL, muscle type carnitine palmitoyltransferase-1, medium chain acyl-CoA dehydrogenase, and acyl-CoA synthetase-4 (ACS4), which are involved in lipid catabolism and preferential fuel utilization, were not affected in the siNur77-expressing cell line (see Tables I and III).

Additionally, we did not observe any changes in the expression of mRNAs encoding ATP binding cassette A1, ATP binding cassette A8/G1), apolipoprotein E, adipophilin, and glycogenin-1 (see Tables I and III), involved in cholesterol homeostasis and lipid and glucose storage in the cells expressing the siNur77. However, we observed that the mRNA encoding caveolin-3, which has been implicated in lipid transport and storage (34, 35), was significantly suppressed (~13-fold, Fig. 5J) in the siNur77 cell line.

Furthermore, we examined the expression of many other nuclear hormone receptors that have been demonstrated to regulate lipid and carbohydrate metabolism, including ERR-1, PPAR{alpha}, -{beta}/{delta}, and -{gamma}, LXR{alpha} and -{beta}, Rev-erb{alpha}, RVR (Rev-erb{beta}), ROR{alpha}, and COUP-TFI and -II and found that siNur77 expression did not affect the expression of the mRNAs encoding the other orphan NRs.

We utilized Western analysis to confirm that some of the critical changes in mRNA expression translated to changes in protein expression. For example, we examined the expression of caveolin 3 and GLUT4 expression in the native C2C12 and the siNur77-expressing cells because the mRNAs encoding these proteins were significantly repressed in the C2C12: siNur77 cell line. As a control we also examined the protein expression of CPT-1 because the mRNA encoding this enzyme was not affected by attenuation of Nur77 expression. Consistent with the mRNA expression profiling, we observed significant suppression of caveolin 3 and GLUT4 protein expression in the siNur77-expressing cells (Fig. 6, A and B), whereas CPT-1 protein expression remained unchanged (Fig. 6C).



View larger version (15K):
[in this window]
[in a new window]
  		FIG. 6.
CAV3 and GLUT4 protein levels are reduced and CPT-1 protein levels remain unchanged in C2C12 and C2C12-siNur77 cells. Total protein was extracted from C2C12 and C2C12-siNur77 cells, and 20 µg was resolved by SDS-PAGE. Separated proteins were transferred to polyvinylidene difluoride membranes, and immunoreactive proteins were detected using a monoclonal antibody to CAV3 and polyclonal GLUT4 and CPT-1 antibodies. CAV3 (A), GLUT4 (B), and CPT-1 (C) are shown as indicated (arrowhead) in each panel together with the molecular mass of the resolved protein standards (in kDa). Panel D, {alpha}-tubulin (input control for protein loading). WT, wild type.

 
In summary, the expression of a subgroup of genes involved in glucose absorption, lipid homeostasis, and the regulation of energy balance including GLUT4, CD36, CAV3, AMPK{gamma}3, adiponectin receptor 2, and UCP3 emerged as clearly dependent on Nur77 expression. The Nur77-specific dependence of this subgroup of metabolic genes was underscored by the observation that related genes, for example GLUT5, UCP2, AMPK{gamma}1, and adiponectin receptor 1, were refractory to a reduction in Nur77 expression.

Lipolysis Is Reduced in the siNur77-expressing Cells—Our study demonstrated that that a subgroup of genes that include adiponectin receptor 2, UCP3, and AMPK{gamma}3 are repressed in the C2C12:siNur77 cell line. Studies in a variety of animal models suggest that suppression of these genes would lead to a reduction in fatty acid oxidation, reduced lipid utilization, and lipolysis. For example, muscle-specific overexpression of UCP3 leads to preferential lipid utilization (36, 37), adiponectin receptor 2 activation leads to increased {beta}-oxidation (38), and AMPK{gamma}3 null mice exhibit triglyceride accumulation (33).

To test this hypothesis in our cell culture system we examined lipolysis (triglyceride hydrolysis) in the native C2C12 cells and in the siNur77-expressing cells. Lipolysis/triglyceride breakdown was measured by examining glycerol release into the cell culture supernatant after 1-, 3-, and 6-h incubations. We utilized the Chemicon adipolysis kit to measure lipolysis and observed that glycerol release was significantly reduced from the C2:siNur77 cell line relative to the native C2C12 cell line (Fig. 7). This demonstrates that attenuation of Nur77 expression results in reduced lipolysis in skeletal muscle cells.



View larger version (13K):
[in this window]
[in a new window]
  		FIG. 7.
Triglyceride hydrolysis is reduced in the siNur77-expressing cells. C2C12 cells and C2C12-siNur77 cells were differentiated for 5 days and assessed for triglyceride hydrolysis using a commercial lipolysis assay (Chemicon). Supernatants from cells incubated for 1, 3, and 6 h were assayed for free glycerol. Results are expressed as nmol of glycerol released/ml/h (mean ± S.D. of individual wells, n = 3). Statistical significance was assessed using Student's t test. p < 0.05 (*), p < 0.01 (**); p < 0.001 (***), compared with wild-type C2C12 cells.

 
Expression of Nur77 siRNA in Mouse Tibialis Muscle Leads to Repression of UCP3 mRNA Expression—To examine whether the effects and changes observed in the skeletal muscle cell culture model were reflected in an in vivo animal model, we injected and electroporated mouse tibialis muscle with the Nur77 siRNA expression vector. Specifically, the right hindlimb tibialis cranialis muscle of three mice was injected in oblique fashion transcutaneously with the pSilencer 2.1 siNur77 expression using a 29-gauge needle followed by electrotransfer as described (22). The left hindlimb tibialis cranialis muscle was injected with the pSilencer 2.1 control vector and electroporated using the same procedure. One week after electrotransfer mice were sacrificed, the tibialis cranialis muscles were collected, and RNA was harvested for subsequent analysis. Expression of pSilencer 2.1-siNur77 produced an ~2-fold repression in Nur77 mRNA expression in the right tibialis cranialis muscle relative to the left muscle injected with the control silencer vector only (Fig. 8A). In agreement with the cell culture model, we observed a repression in UCP3 mRNA expression (Fig. 8B). This data confirmed that a key change reported in the cell culture model, viz. a down-regulation of UCP3 expression, was confirmed in mouse skeletal muscle.



View larger version (15K):
[in this window]
[in a new window]
  		FIG. 8.
UCP3 mRNA expression is repressed in mouse muscles transiently expressing Nur77 siRNA. Mouse tibialis cranialis muscles were injected and electroporated with a Nur77 siRNA expression vector or negative control vector. Muscles were collected 1 week later and processed for RNA, and the level of Nur77 and UCP3 mRNA expression was determined by Q-RT-PCR. Values obtained from three animals were pooled, normalized, and expressed as the number of target transcripts per 18 S transcript ±S.D.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
Genetic, molecular, and biochemical studies have clearly demonstrated that {beta}-adrenergic agonists and {beta}-ARs are involved in the regulation of cold- and diet-induced thermogenesis and induce increases in energy expenditure (3–5). However, the target tissues, UCP1-independent mechanisms, and molecular pathways involved in diet-induced thermogenesis have not been resolved and remain a controversial area. One favorable hypothesis suggests that a putative target tissue(s) of the sympathetic nervous system (liver, skeletal muscle, and/or white adipose) mediates the diet and {beta}-adrenergic-induced increases in energy expenditure and thermogenesis (3). The observation that Nur77/NR4A1 is dramatically and transiently induced in skeletal muscle cells by isoprenaline, a {beta}-adrenergic agonist, prompted us to examine the metabolic role of this receptor in skeletal muscle cells.

The expression of Nur77 in skeletal muscle, a peripheral lean tissue that has a significant role in energy expenditure, glucose disposal, and {beta}-oxidation, led us to investigate the role of Nur77 in skeletal muscle cells with respect to the expression of genes involved in metabolism. Recent publications utilizing the C2C12 cell culture system suggest it is an ideal paradigm to investigate the regulation of lipid homeostasis in skeletal muscle (12, 13, 17, 27–30). Furthermore, our initial observation that isoprenaline treatment elicited a dramatic response in Nur77 mRNA expression coupled to the specific and selective induction of this orphan nuclear receptor (in contrast to other nuclear receptors involved in metabolism and metabolic disease) underscored the distinctive cross-talk between the adrenergic and orphan nuclear receptor pathways in skeletal muscle cells (Fig. 9). Our study demonstrates that a subgroup of genes (that includes adiponectin receptor 2, UCP3, AMPK{gamma}3, CAV3, CD36, and GLUT4) involved in the regulation of energy balance and expenditure are dependent on the expression of Nur77. The Nur77-specific dependence of this subgroup of metabolic genes was highlighted by the observation that related genes, for example GLUT5, UCP-2, AMPK{gamma}1, and adiponectin receptor 1, were refractory to a reduction in Nur77 expression. These observations of cross-talk between Nur77 and the adrenergic pathways and the identification of this Nur77-dependent subgroup of genes is entirely consistent with the phenotype of the {beta}-AR null/{beta}-less mice (5), which develop severe obesity on a high fat diet due to a deficiency in diet-induced thermogenesis and energy balance.



View larger version (23K):
[in this window]
[in a new window]
  		FIG. 9.
Schematic representation of the regulatory cross-talk between the adrenergic signaling pathway and the nuclear hormone receptor NR4A1/Nur77 in skeletal muscle. The brain responds to signals from the diet, and neural infrastructure controlling energy expenditure is stimulated, which increases sympathetic activity. The nuclear hormone receptor, NR4A1/Nur77, is involved in mediating the adrenergic response in skeletal muscle. This underscores the physiological importance of regulatory cross-talk between these two critical pathways in energy homeostasis.

 
The mice lacking all three known {beta}123-ARs (denoted "{beta}-less mice") have a reduced metabolic rate and develop mild obesity, and these mice are unresponsive to cold and {beta}-agonist stimulation. Oxygen consumption does not change in response to physiological cold exposure or pharmacological stimulation, and as mentioned above, the {beta}-less mice develop severe obesity on a high fat diet. The diet-induced increase in oxygen consumption is conspicuously absent in the {beta}-less mice, in contrast to the 20% increase in oxygen consumption observed in wild type mice after 5 days (5). Finally, linkage and association studies have implicated the {beta}-adrenergic receptors in the accumulation of abdominal and visceral fat, which is consistent with the obesity risk in individuals with {beta}-AR mutations, deletions, and polymorphisms (39–44).

Unfortunately, the target tissue of sympathetically mediated diet-induced adaptive thermogenesis remains obscure. Brown adipose tissue (a sympathetically innervated tissue that expresses UCP1) was thought to be the target tissue for diet-induced thermogenesis; however, the observation that the UCP1 –/– mouse phenotype is compromised for cold-induced thermogenesis but resistant to diet-induced obesity (6) has challenged this theory. Undoubtedly, {beta}-ARs are required for diet-induced thermogenesis, and possible explanations involve UCP-2/3-dependent mechanisms and other sympathetically innervated target tissues, for example skeletal muscle, liver, or white adipose tissue (3).

In the context of this investigation a single report in the literature suggested that {beta}-adrenergic agonists in cultured skeletal muscle cells transiently induce Nur77 mRNA expression (11). This observation was dramatically confirmed in our current study. However, the role of Nur77 in the regulation of energy balance and uncoupling in skeletal muscle (or any other major mass peripheral tissue), potential Nur77 target genes, and the mechanism of action in this metabolically demanding major mass lean tissue has remained obscure.

Our investigation has highlighted the unique and selective cross-talk between the adrenergic and orphan nuclear receptor pathways in skeletal muscle cells. Our study demonstrated that a subgroup of genes (including adiponectin receptor 2, AMPK{gamma}3, UCP3, CAV3, CD36, and GLUT4) involved in the regulation of energy homeostasis is demonstrably dependent on the expression of Nur77 in skeletal muscle cells. Moreover, in initial animal studies we confirmed that attenuation of Nur77 expression in mouse tibialis muscle leads to reduced UCP3 expression. The relationship of this Nur77-dependent subgroup of genes is consistent with the phenotype of the obese {beta}-AR less null mice. A number of studies have investigated ectopic and muscle-specific overexpression of UCP3 in transgenic mice and in cell culture (45–47). These investigations have reported (i) increased rates of energy expenditure, (ii) preferential lipid utilization and lipolysis, (iii) resistance to high fat diet-induced weight gain and obesity in the context of hyperphagic behavior, (iv) lower fasting plasma glucose and insulin levels, (v) increased glucose tolerance and clearance rate, and (vi) adaptive thermogenesis. These studies emphasize the regulatory role of UCP3 in metabolic efficiency/energy expenditure and thermogenesis and in preferential substrate utilization. We hypothesize that the effects of Nur77 agonists on skeletal muscle, a major mass peripheral tissue, would have therapeutic utility and protect against diet-induced obesity.

Similarly, we observed a reduction in the expression of the {gamma}3 subunit of AMP-activated protein kinase in the siNur77-C2C12 cell line. This AMPK isoform is predominantly expressed in type II glycolytic muscle (48). Mutation of AMPK{gamma}3 leads to the dramatic accumulation of glycogen in type II fast twitch white fibers, whereas AMPK{gamma}3 null mice exhibit insulin resistance and triglyceride accumulation (33). AMPK is a critical protein kinase that operates as a metabolic stress sensor and regulator of energy balance, acting to increase fatty acid oxidation and glucose uptake and inhibit triglyceride biosynthesis (33, 49). Furthermore, recent data has suggested that the reduction in adiposity induced by adrenergic agonists involves AMPK activation in peripheral tissues (50). Our data demonstrating that the expression of AMPK{gamma}3 mRNA is dependent on the expression of a nuclear hormone receptor that is hypersensitive to {beta}-adrenergic stimulation is entirely consistent with the role of AMPK in the regulation of energy balance and a sensor of metabolic stress (49). Furthermore, and excitingly, our data implicate the orphan nuclear receptor Nur77 in the regulation of energy homeostasis. The coupled suppression of UCP3 and AMPK{gamma}3 expression is also consistent with the activation of UCP3 in type II fibers by the AMPK activator, AICAR (51).

Suppressed expression of UCP3 and AMPK{gamma}3 mRNA in the siNur77 cell line is consistent with the attenuated lipolysis observed in this cell line. This is entirely consistent with many animal studies that demonstrate muscle-specific overexpression of UCP3 and/or AMPK{gamma}3 leads to preferential lipid utilization and increased lipolysis. Correspondingly, attenuation of UCP3 and/or AMPK{gamma}3 expression leads to triglyceride accumulation and reduced lipolysis (33, 36, 37).

The elevated expression of SREBP-1c mRNA in the siNur77 cell line without the corresponding increases in downstream target genes involved in lipogenesis (e.g. fatty acid synthase, stearoyl-CoA desaturase 1 and 2) is not entirely surprising. This interesting observation, i.e. that the regulation of SREBP-1c may be uncoupled from fatty acid metabolism in skeletal muscle, has been reported in an LXR animal model study (17). This manuscript reported LXR-mediated activation of SREBP-1c in liver and skeletal muscle. However, the mRNAs encoding stearoyl-CoA desaturase-1 and fatty acid synthase were not induced by LXR agonist treatment in muscle (in contrast to the observations in the livers of treated mice).

We also demonstrated that GLUT4 mRNA and protein expression was significantly repressed in the C2C12-siNur77 cell line, which was in accord with the reduction in AMPK{gamma}3 and UCP3 mRNA expression. Many studies have shown links between AMPK, UCP3, and glucose metabolism. For example, AMP kinase activators failed to induce skeletal muscle glucose uptake in the AMPK{gamma}3 knock-out mice (33), overexpression of GLUT4 increases the expression of UCP3 in skeletal muscle (52), and muscle-specific overexpression of UCP3 leads to increased glucose tolerance and a lean phenotype despite hyperphagia (53).

The lower levels and Nur77-dependent expression of the mRNA encoding the fatty acid translocase, CD36, also correlate with the reduction of AMPK{gamma}3 and UCP3 expression, as the {beta}-oxidation demands in these cells would be reduced. Muscle-specific overexpression of CD36 ameliorates insulin resistance and hyperglycemia caused by dominant negative IGF-1 receptor expression. Furthermore, CD36 overexpression normalizes the fatty acid oxidation defect in these mice (54). Correspondingly, CD36 nonsense mutations lead to insulin resistance and familial type II diabetes (55), and CD36 polymorphisms have been linked to increases in free fatty acids and triglycerides (56). Interestingly, we did not observe significant changes in the expression of the genes involved in lipid catabolism and {beta}-oxidation (e.g. LPL and CPT-1). However, this is not surprising as increased or decreased flux of fatty acids through the oxidation pathway does not necessarily require marked changes in genes involved in fat catabolism (45).

Finally, we demonstrated that the expression of the caveolin-3 gene and its encoded protein are attenuated dramatically in the C2C12-siNur77 cell line. Although caveolin-3 has not been directly linked to lipid regulation, studies of the nonmuscle caveolin family member, caveolin-1, have suggested a role for caveolins in cholesterol transport to extracellular cholesterol acceptors such as high density lipoprotein (57, 58). Non-striated muscle caveolins 1 and 2 associate with lipid droplets in cultured cells and in vivo (35). Moreover, caveolin-1 null mice are resistant to diet-induced obesity (59). The studies presented here linking Nur77 expression to the regulation of caveolin-3 mRNA expression, and the Nur77-dependent nature of the other identified genes involved in the regulation of energy balance and expenditure raises the intriguing possibility that caveolin-3 may play a role during increased lipid utilization and lipolysis. This is supported by reports showing that a caveolin-3 mutant associates with lipid droplets in cultured cells (34, 35).

The fact that the expression of this subgroup of genes regulating energy expenditure and balance is dependent on Nur77 expression, and the remarkable sensitivity of Nur77 expression to isoprenaline highlights the crucial role of Nur77 in energy homeostasis (see Fig. 9) and identifies Nur77 as a promising therapeutic target in the treatment of obesity. Skeletal muscle is rapidly emerging as a critical target tissue in the battle against obesity, type II diabetes, dyslipidemia, syndrome X, and atherosclerosis. For example, NRs such as LXR, PPAR{alpha},-{beta}/{delta}, and -{gamma} in skeletal muscle have been shown to be involved in enhancing the insulin-stimulated glucose disposal rate, decreasing triglycerides, and increasing lipid catabolism, cholesterol efflux, and plasma high density lipoprotein C levels (12, 14, 17, 31, 32). Hence, orphan NRs (for example, Nur77) that regulate energy balance in skeletal muscle have enormous pharmacological utility for the treatment of obesity. In conclusion, we suggest that in skeletal muscle cells, Nur77 programs a cascade of gene expression designed to regulate energy expenditure in this major mass lean tissue. Finally, we surmise that Nur77 agonists may have therapeutic utility in the treatment of metabolic diseases including type II diabetes and obesity.


   FOOTNOTES
 
* This study was supported by a National Health and Medical Research Council of Australia project grant. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

|| A Principal Research Fellow of the National Health and Medical Research Council of Australia. To whom correspondence should be addressed. Tel.: 61-7-3346-2222; E-mail: g.muscat{at}imb.uq.edu.au.

1 The abbreviations used are: {beta}-AR, {beta}-adrenergic receptor; siRNA, small interfering RNA; CAV3, caveolin 3; SREBP-1c, sterol regulatory element binding protein-1c; AMPK, AMP-activated protein kinase; LPL, lipoprotein lipase; GLUT4, glucose transporter 4; UCP, uncoupling protein; SNS, sympathetic nervous system; NR, nuclear hormone receptor; PPAR, peroxisome proliferator-activated receptor; Q-RT-PCR, quantitative real time PCR; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; CPT-1, carnitine palmitoyl transferase 1; LXR, liver X receptor; ERR-1, estrogen-related receptor, alpha; ROR, RAR-related orphan receptor; COUP-TF, chicken ovalbumin upstream promoter. Back



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Evans, R. M., Barish, G. D., and Wang, Y. X. (2004) Nat. Med. 10, 355–361[CrossRef][Medline] [Order article via Infotrieve]
  2. Rosmond, R. (2003) Int. J. Obes. Relat. Metab. Disord. 27, 1141–1151[CrossRef][Medline] [Order article via Infotrieve]
  3. Lowell, B. B., and Bachman, E. S. (2003) J. Biol. Chem. 278, 29385–29388[Free Full Text]
  4. Collins, S., Cao, W., and Robidoux, J. (2004) Mol. Endocrinol. 18, 2123–2131[Abstract/Free Full Text]
  5. Bachman, E. S., Dhillon, H., Zhang, C. Y., Cinti, S., Bianco, A. C., Kobilka, B. K., and Lowell, B. B. (2002) Science 297, 843–845[Abstract/Free Full Text]
  6. Enerback, S., Jacobsson, A., Simpson, E. M., Guerra, C., Yamashita, H., Harper, M. E., and Kozak, L. P. (1997) Nature 387, 90–94[CrossRef][Medline] [Order article via Infotrieve]
  7. Gong, D. W., Monemdjou, S., Gavrilova, O., Leon, L. R., Marcus-Samuels, B., Chou, C. J., Everett, C., Kozak, L. P., Li, C., Deng, C., Harper, M. E., and Reitman, M. L. (2000) J. Biol. Chem. 275, 16251–16257[Abstract/Free Full Text]
  8. Vidal-Puig, A. J., Grujic, D., Zhang, C. Y., Hagen, T., Boss, O., Ido, Y., Szczepanik, A., Wade, J., Mootha, V., Cortright, R., Muoio, D. M., and Lowell, B. B. (2000) J. Biol. Chem. 275, 16258–16266[Abstract/Free Full Text]
  9. Arsenijevic, D., Onuma, H., Pecqueur, C., Raimbault, S., Manning, B. S., Miroux, B., Couplan, E., Alves-Guerra, M. C., Goubern, M., Surwit, R., Bouillaud, F., Richard, D., Collins, S., and Ricquier, D. (2000) Nat. Genet. 26, 435–439[CrossRef][Medline] [Order article via Infotrieve]
  10. Zhang, C. Y., Baffy, G., Perret, P., Krauss, S., Peroni, O., Grujic, D., Hagen, T., Vidal-Puig, A. J., Boss, O., Kim, Y. B., Zheng, X. X., Wheeler, M. B., Shulman, G. I., Chan, C. B., and Lowell, B. B. (2001) Cell 105, 745–755[CrossRef][Medline] [Order article via Infotrieve]
  11. Lim, R. W., Yang, W. L., and Yu, H. (1995) Biochem. J. 308, 785–789
  12. Dressel, U., Allen, T. L., Pippal, J. B., Rohde, P. R., Lau, P., and Muscat, G. E. (2003) Mol. Endocrinol. 17, 2477–2493[Abstract/Free Full Text]
  13. Lau, P., Nixon, S. J., Parton, R. G., and Muscat, G. E. (2004) J. Biol. Chem. 279, 36828–36840[Abstract/Free Full Text]
  14. Tanaka, T., Yamamoto, J., Iwasaki, S., Asaba, H., Hamura, H., Ikeda, Y., Watanabe, M., Magoori, K., Ioka, R. X., Tachibana, K., Watanabe, Y., Uchiyama, Y., Sumi, K., Iguchi, H., Ito, S., Doi, T., Hamakubo, T., Naito, M., Auwerx, J., Yanagisawa, M., Kodama, T., and Sakai, J. (2003) Proc. Natl. Acad. Sci. U. S. A. 100, 15924–15929[Abstract/Free Full Text]
  15. Hevener, A. L., He, W., Barak, Y., Le, J., Bandyopadhyay, G., Olson, P., Wilkes, J., Evans, R. M., and Olefsky, J. (2003) Nat. Med. 9, 1491–1497[CrossRef][Medline] [Order article via Infotrieve]
  16. He, W., Barak, Y., Hevener, A., Olson, P., Liao, D., Le, J., Nelson, M., Ong, E., Olefsky, J. M., and Evans, R. M. (2003) Proc. Natl. Acad. Sci. U. S. A. 100, 15712–15717[Abstract/Free Full Text]
  17. Muscat, G. E., Wagner, B. L., Hou, J., Tangirala, R. K., Bischoff, E. D., Rohde, P., Petrowski, M., Li, J., Shao, G., Macondray, G., and Schulman, I. G. (2002) J. Biol. Chem. 277, 40722–40728[Abstract/Free Full Text]
  18. Muoio, D. M., MacLean, P. S., Lang, D. B., Li, S., Houmard, J. A., Way, J. M., Winegar, D. A., Corton, J. C., Dohm, G. L., and Kraus, W. E. (2002) J. Biol. Chem. 277, 26089–26097[Abstract/Free Full Text]
  19. Bookout, A. L., and Mangelsdorf, D. J. (2003) NURSA e-Journal, Vol. 1, No. 6, 1.11082003.1
  20. Wansa, K. D., Harris, J. M., and Muscat, G. E. (2002) J. Biol. Chem. 277, 33001–33011[Abstract/Free Full Text]
  21. Wansa, K. D., Harris, J. M., Yan, G., Ordentlich, P., and Muscat, G. E. (2003) J. Biol. Chem. 278, 24776–24790[Abstract/Free Full Text]
  22. Mir, L. M., Bureau, M. F., Gehl, J., Rangara, R., Rouy, D., Caillaud, J. M., Delaere, P., Branellec, D., Schwartz, B., and Scherman, D. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 4262–4267[Abstract/Free Full Text]
  23. Bing, G. Y., Filer, D., Miller, J. C., and Stone, E. A. (1991) Brain Res. Mol. Brain Res. 11, 43–46[Medline] [Order article via Infotrieve]
  24. Song, K. H., Lee, K., and Choi, H. S. (2002) Endocrinology 143, 2208–2215[Abstract/Free Full Text]
  25. Okabe, T., Takayanagi, R., Adachi, M., Imasaki, K., and Nawata, H. (1998) J. Endocrinol. 156, 169–175[Abstract]
  26. Ramakrishnan, S., Lau, P., Burke, L. J., and Muscat, G. E. (2005) J. Biol. Chem. 280, 8651–8659[Abstract/Free Full Text]
  27. Holst, D., Luquet, S., Kristiansen, K., and Grimaldi, P. A. (2003) Exp. Cell Res. 288, 168–176[CrossRef][Medline] [Order article via Infotrieve]
  28. Holst, D., Luquet, S., Nogueira, V., Kristiansen, K., Leverve, X., and Grimaldi, P. A. (2003) Biochim. Biophys. Acta 1633, 43–50[Medline] [Order article via Infotrieve]
  29. Grimaldi, P. A., Teboul, L., Inadera, H., Gaillard, D., and Amri, E. Z. (1997) Prostaglandins Leukot. Essent. Fatty Acids 57, 71–75[CrossRef][Medline] [Order article via Infotrieve]
  30. Wang, Y. X., Lee, C. H., Tiep, S., Yu, R. T., Ham, J., Kang, H., and Evans, R. M. (2003) Cell 113, 159–170[CrossRef][Medline] [Order article via Infotrieve]
  31. Luquet, S., Lopez-Soriano, J., Holst, D., Fredenrich, A., Melki, J., Rassoulzadegan, M., and Grimaldi, P. A. (2003) FASEB J. 17, 2299–2301[Abstract/Free Full Text]
  32. Wang, Y. X., Zhang, C. L., Yu, R. T., Cho, H. K., Nelson, M. C., Bayuga-Ocampo, C. R., Ham, J., Kang, H., and Evans, R. M. (2004) PLoS Biol. 2, 294
  33. Barnes, B. R., Marklund, S., Steiler, T. L., Walter, M., Hjalm, G., Amarger, V., Mahlapuu, M., Leng, Y., Johansson, C., Galuska, D., Lindgren, K., Abrink, M., Stapleton, D., Zierath, J. R., and Andersson, L. (2004) J. Biol. Chem. 279, 38441–38447[Abstract/Free Full Text]
  34. Pol, A., Luetterforst, R., Lindsay, M., Heino, S., Ikonen, E., and Parton, R. G. (2001) J. Cell Biol. 152, 1057–1070[Abstract/Free Full Text]
  35. Pol, A., Martin, S., Fernandez, M. A., Ferguson, C., Carozzi, A., Luetterforst, R., Enrich, C., and Parton, R. G. (2004) Mol. Biol. Cell 15, 99–110[Abstract/Free Full Text]
  36. Dulloo, A. G., Samec, S., and Seydoux, J. (2001) Biochem. Soc. Trans. 29, 785–791[CrossRef][Medline] [Order article via Infotrieve]
  37. Garcia-Martinez, C., Sibille, B., Solanes, G., Darimont, C., Mace, K., Villarroya, F., and Gomez-Foix, A. M. (2001) FASEB J. 15, 2033–2035[Free Full Text]
  38. Yamauchi, T., Kamon, J., Ito, Y., Tsuchida, A., Yokomizo, T., Kita, S., Sugiyama, T., Miyagishi, M., Hara, K., Tsunoda, M., Murakami, K., Ohteki, T., Uchida, S., Takekawa, S., Waki, H., Tsuno, N. H., Shibata, Y., Terauchi, Y., Froguel, P., Tobe, K., Koyasu, S., Taira, K., Kitamura, T., Shimizu, T., Nagai, R., and Kadowaki, T. (2003) Nature 423, 762–769[CrossRef][Medline] [Order article via Infotrieve]
  39. Matsushita, H., Kurabayashi, T., Tomita, M., Kato, N., and Tanaka, K. (2003) Maturitas 45, 39–45[CrossRef][Medline] [Order article via Infotrieve]
  40. Shiwaku, K., Nogi, A., Anuurad, E., Kitajima, K., Enkhmaa, B., Shimono, K., and Yamane, Y. (2003) Int. J. Obes. Relat. Metab. Disord. 27, 1028–1036[CrossRef][Medline] [Order article via Infotrieve]
  41. Arashiro, R., Katsuren, K., Fukuyama, S., and Ohta, T. (2003) Pediatr. Int. 45, 135–141[CrossRef][Medline] [Order article via Infotrieve]
  42. Kim, O. Y., Cho, E. Y., Park, H. Y., Jang, Y., and Lee, J. H. (2004) Int. J. Obes. Relat. Metab. Disord. 28, 434–441[CrossRef][Medline] [Order article via Infotrieve]
  43. Ellsworth, D. L., Coady, S. A., Chen, W., Srinivasan, S. R., Elkasabany, A., Gustat, J., Boerwinkle, E., and Berenson, G. S. (2002) Int. J. Obes. Relat. Metab. Disord. 26, 928–937[CrossRef][Medline] [Order article via Infotrieve]
  44. Martinez, J. A., Corbalan, M. S., Sanchez-Villegas, A., Forga, L., Marti, A., and Martinez-Gonzalez, M. A. (2003) J. Nutr. 133, 2549–2554[Abstract/Free Full Text]
  45. Moore, G. B., Himms-Hagen, J., Harper, M. E., and Clapham, J. C. (2001) Biochem. Biophys. Res. Commun. 283, 785–790[CrossRef][Medline] [Order article via Infotrieve]
  46. Wang, S., Cawthorne, M. A., and Clapham, J. C. (2002) Ann. N. Y. Acad. Sci. 967, 112–119[Medline] [Order article via Infotrieve]
  47. Clapham, J. C., Coulthard, V. H., and Moore, G. B. (2001) Biochem. Biophys. Res. Commun. 287, 1058–1062[CrossRef][Medline] [Order article via Infotrieve]
  48. Yu, H., Fujii, N., Hirshman, M. F., Pomerleau, J. M., and Goodyear, L. J. (2004) Am. J. Physiol. Cell Physiol. 286, 283–292
  49. Ruderman, N. B., Saha, A. K., and Kraegen, E. W. (2003) Endocrinology 144, 5166–5171[Abstract/Free Full Text]
  50. Minokoshi, Y., Kim, Y. B., Peroni, O. D., Fryer, L. G., Muller, C., Carling, D., and Kahn, B. B. (2002) Nature 415, 339–343[CrossRef][Medline] [Order article via Infotrieve]
  51. Suwa, M., Nakano, H., and Kumagai, S. (2003) J. Appl. Physiol. 95, 960–968[Abstract/Free Full Text]
  52. Tsuboyama-Kasaoka, N., Tsunoda, N., Maruyama, K., Takahashi, M., Kim, H., Cooke, D. W., Lane, M. D., and Ezaki, O. (1999) Biochem. Biophys. Res. Commun. 258, 187–193[CrossRef][Medline] [Order article via Infotrieve]
  53. Clapham, J. C., Arch, J. R., Chapman, H., Haynes, A., Lister, C., Moore, G. B., Piercy, V., Carter, S. A., Lehner, I., Smith, S. A., Beeley, L. J., Godden, R. J., Herrity, N., Skehel, M., Changani, K. K., Hockings, P. D., Reid, D. G., Squires, S. M., Hatcher, J., Trail, B., Latcham, J., Rastan, S., Harper, A. J., Cadenas, S., Buckingham, J. A., Brand, M. D., and Abuin, A. (2000) Nature 406, 415–418[CrossRef][Medline] [Order article via Infotrieve]
  54. Heron-Milhavet, L., Haluzik, M., Yakar, S., Gavrilova, O., Pack, S., Jou, W. C., Ibrahimi, A., Kim, H., Hunt, D., Yau, D., Asghar, Z., Joseph, J., Wheeler, M. B., Abumrad, N. A., and LeRoith, D. (2004) Endocrinology 145, 4667–4676[Abstract/Free Full Text]
  55. Lepretre, F., Vasseur, F., Vaxillaire, M., Scherer, P. E., Ali, S., Linton, K., Aitman, T., and Froguel, P. (2004) Hum. Mutat. 24, 104[Medline] [Order article via Infotrieve]
  56. Ma, X., Bacci, S., Mlynarski, W., Gottardo, L., Soccio, T., Menzaghi, C., Iori, E., Lager, R. A., Shroff, A. R., Gervino, E. V., Nesto, R. W., Johnstone, M. T., Abumrad, N. A., Avogaro, A., Trischitta, V., and Doria, A. (2004) Hum. Mol. Genet. 13, 2197–2205[Abstract/Free Full Text]
  57. Hailstones, D., Sleer, L. S., Parton, R. G., and Stanley, K. K. (1998) J. Lipid Res. 39, 369–379[Abstract/Free Full Text]
  58. Bist, A., Fielding, P. E., and Fielding, C. J. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 10693–10698[Abstract/Free Full Text]
  59. Razani, B., Combs, T. P., Wang, X. B., Frank, P. G., Park, D. S., Russell, R. G., Li, M., Tang, B., Jelicks, L. A., Scherer, P. E., and Lisanti, M. P. (2002) J. Biol. Chem. 277, 8635–8647[Abstract/Free Full Text]
  60. Mahlapuu, M., Johansson, C., Lindgren, K., Hjalm, G., Barnes, B. R., Krook, A., Zierath, J. R., Andersson, L., and Marklund, S. (2004) Am. J. Physiol. Endocrinol. Metab. 286, 194–200

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 J. Appl. Physiol.Home page
E. Kawasaki, F. Hokari, M. Sasaki, A. Sakai, K. Koshinaka, and K. Kawanaka
Role of local muscle contractile activity in the exercise-induced increase in NR4A receptor mRNA expression
J Appl Physiol, June 1, 2009; 106(6): 1826 - 1831.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Endocrinol.Home page
L. C. Chao, S. J. Bensinger, C. J. Villanueva, K. Wroblewski, and P. Tontonoz
Inhibition of Adipocyte Differentiation by Nur77, Nurr1, and Nor1
Mol. Endocrinol., December 1, 2008; 22(12): 2596 - 2608.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Endocrinol.Home page
S. Hummasti and P. Tontonoz
Adopting New Orphans into the Family of Metabolic Regulators
Mol. Endocrinol., August 1, 2008; 22(8): 1743 - 1753.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
M. A. Pearen, S. A. Myers, S. Raichur, J. G. Ryall, G. S. Lynch, and G. E. O. Muscat
The Orphan Nuclear Receptor, NOR-1, a Target of {beta}-Adrenergic Signaling, Regulates Gene Expression that Controls Oxidative Metabolism in Skeletal Muscle
Endocrinology, June 1, 2008; 149(6): 2853 - 2865.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Endocrinol. Metab.Home page
M. Ueno, J. Suzuki, Y. Zenimaru, S. Takahashi, T. Koizumi, S. Noriki, O. Yamaguchi, K. Otsu, W.-J. Shen, F. B. Kraemer, et al.
Cardiac overexpression of hormone-sensitive lipase inhibits myocardial steatosis and fibrosis in streptozotocin diabetic mice
Am J Physiol Endocrinol Metab, June 1, 2008; 294(6): E1109 - E1118.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
A. G. Smith, N. Luk, R. A. Newton, D. W. Roberts, R. A. Sturm, and G. E. O. Muscat
Melanocortin-1 Receptor Signaling Markedly Induces the Expression of the NR4A Nuclear Receptor Subgroup in Melanocytic Cells
J. Biol. Chem., May 2, 2008; 283(18): 12564 - 12570.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Endocrinol.Home page
N. Kumar, D. Liu, H. Wang, J. Robidoux, and S. Collins
Orphan Nuclear Receptor NOR-1 Enhances 3',5'-Cyclic Adenosine 5'-Monophosphate-Dependent Uncoupling Protein-1 Gene Transcription
Mol. Endocrinol., May 1, 2008; 22(5): 1057 - 1064.
[Abstract] [Full Text] [PDF]

Home page
 Physiol. Rev.Home page
G. S. Lynch and J. G. Ryall
Role of {beta}-Adrenoceptor Signaling in Skeletal Muscle: Implications for Muscle Wasting and Disease
Physiol Rev, April 1, 2008; 88(2): 729 - 767.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Endocrinol.Home page
L. C. Chao, Z. Zhang, L. Pei, T. Saito, P. Tontonoz, and P. F. Pilch
Nur77 Coordinately Regulates Expression of Genes Linked to Glucose Metabolism in Skeletal Muscle
Mol. Endocrinol., September 1, 2007; 21(9): 2152 - 2163.
[Abstract] [Full Text] [PDF]

Home page
 DiabetesHome page
L. K. Heilbronn, S. Gregersen, D. Shirkhedkar, D. Hu, and L. V. Campbell
Impaired Fat Oxidation After a Single High-Fat Meal in Insulin-Sensitive Nondiabetic Individuals With a Family History of Type 2 Diabetes
Diabetes, August 1, 2007; 56(8): 2046 - 2053.
[Abstract] [Full Text] [PDF]

Home page
 J BiochemHome page
T. Fumoto, T. Yamaguchi, F. Hirose, and T. Osumi
Orphan Nuclear Receptor Nur77 Accelerates the Initial Phase of Adipocyte Differentiation in 3T3-L1 Cells by Promoting Mitotic Clonal Expansion
J. Biochem., February 1, 2007; 141(2): 181 - 192.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
M. A. Pearen, J. G. Ryall, M. A. Maxwell, N. Ohkura, G. S. Lynch, and G. E. O. Muscat
The Orphan Nuclear Receptor, NOR-1, Is a Target of {beta}-Adrenergic Signaling in Skeletal Muscle
Endocrinology, November 1, 2006; 147(11): 5217 - 5227.
[Abstract] [Full Text] [PDF]

Home page
 Arterioscler. Thromb. Vasc. Bio.Home page
P. I. Bonta, C. M. van Tiel, M. Vos, T. W.H. Pols, J. V. van Thienen, V. Ferreira, E. K. Arkenbout, J. Seppen, C. A. Spek, T. van der Poll, et al.
Nuclear Receptors Nur77, Nurr1, and NOR-1 Expressed in Atherosclerotic Lesion Macrophages Reduce Lipid Loading and Inflammatory Responses
Arterioscler. Thromb. Vasc. Biol., October 1, 2006; 26(10): 2288 - 2288.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Endocrinol. Metab.Home page
A.-M. Axell, H. E. MacLean, D. R. Plant, L. J. Harcourt, J. A. Davis, M. Jimenez, D. J. Handelsman, G. S. Lynch, and J. D. Zajac
Continuous testosterone administration prevents skeletal muscle atrophy and enhances resistance to fatigue in orchidectomized male mice
Am J Physiol Endocrinol Metab, September 1, 2006; 291(3): E506 - E516.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
S. A. Myers, S.-C. M. Wang, and G. E. O. Muscat
The Chicken Ovalbumin Upstream Promoter-Transcription Factors Modulate Genes and Pathways Involved in Skeletal Muscle Cell Metabolism
J. Biol. Chem., August 25, 2006; 281(34): 24149 - 24160.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Cell Physiol.Home page
A. G. Smith and G. E. O. Muscat
Orphan nuclear receptors: therapeutic opportunities in skeletal muscle
Am J Physiol Cell Physiol, August 1, 2006; 291(2): C203 - C217.
[Abstract] [Full Text] [PDF]

Home page
 FASEB J.Home page
D. Mainieri, S. Summermatter, J. Seydoux, J.-P. Montani, S. Rusconi, A. P. Russell, O. Boss, A. J. Buchala, and A. G. Dulloo
A role for skeletal muscle stearoyl-CoA desaturase 1 in control of thermogenesis
FASEB J, August 1, 2006; 20(10): 1751 - 1753.
[Abstract] [Full Text] [PDF]

Home page
 Physiol. GenomicsHome page
T. Kanzleiter, T. Schneider, I. Walter, F. Bolze, C. Eickhorst, G. Heldmaier, S. Klaus, and M. Klingenspor
Evidence for Nr4a1 as a cold-induced effector of brown fat thermogenesis
Physiol Genomics, December 14, 2005; 24(1): 37 - 44.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
280/13/12573    most recent
M409580200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Maxwell, M. A.
Right arrow Articles by Muscat, G. E. O.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Maxwell, M. A.
Right arrow Articles by Muscat, G. E. O.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2005 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement