Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M412721200 on January 27, 2005

J. Biol. Chem., Vol. 280, Issue 13, 12956-12966, April 1, 2005
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
280/13/12956    most recent
M412721200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wen, J.
Right arrow Articles by Noguchi, C. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wen, J.
Right arrow Articles by Noguchi, C. T.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Tal1/SCL Binding to Pericentromeric DNA Represses Transcription*

Jie Wen{ddagger}, Suming Huang§, Svetlana D. Pack¶, Xiaobing Yu{ddagger}||, Stephen J. Brandt**, and Constance Tom Noguchi{ddagger}{ddagger}{ddagger}

From the {ddagger}Molecular Medicine Branch and §Laboratory of Molecular Biology, NIDDK and the Surgical Neurology Branch, NINDS, National Institutes of Health, Bethesda, Maryland 20892 and the **Departments of Medicine, Cell and Developmental Biology, and Cancer Biology, Vanderbilt University Medical Center and the Tennessee Valley Veterans Affairs Healthcare System, Nashville, Tennessee 37232

Received for publication, November 10, 2004 , and in revised form, January 26, 2005.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Tal1/SCL is a basic helix-loop-helix transcription factor critical for normal hematopoiesis. To understand the mechanisms underlying transcriptional regulation by Tal1/SCL, we combined an in vitro DNA binding strategy and an in vivo chromatin immunoprecipitation analysis to search for Tal1/SCL target regions in K562 erythroleukemia cells. A 0.4-kb genomic DNA clone containing two Tal1/SCL binding E-boxes and GATA- and SATB1-binding motifs (EEGS) was identified that localized to the pericentromeric region with high homology to satellite 2 DNA. Pericentric DNA is related to heterochromatin and gene inactivation. We found that Tal1/SCL could complex with the histone H3 lysine 9 (H3K9)-specific methyltransferase Suv39H1. Binding of Tal1/SCL to EEGS chromatin correlated with hypermethylation of H3K9 and the association of heterochromatin protein HP1 to this region. In Rep4 reporter gene assays, EEGS affected repression in a manner dependent on the expression level of Tal1/SCL that was accompanied by increased H3K9 methylation in chromatin associated with EEGS and a linked promoter. A specific histone deacetylase inhibitor, trichostatin A, relieved Tal1/SCL-mediated repression by EEGS. In addition, SATB1 bound EEGS chromatin and promoted Tal1/SCL EEGS-dependent repression. We expand the list of potential interacting partners for Tal1/SCL by demonstrating direct associations of Tal1/SCL with SATB1 and with Suv39H1. These results reveal a novel mechanism of action for Tal1/SCL and implicate heterochromatin-like silencing via a cis-acting binding motif for transcriptional repression.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Modification of the N termini in core histones by acetylation, phosphorylation, or methylation affects chromatin-based modulation of gene expression and contributes to the epigenetic control of gene regulation (1, 2). Gene inactivation is associated with the lowest level of histone acetylation, condensed chromatin regions, and methylation of histone H3 at lysine 9 (H3-MeK9), whereas gene activation is associated with a marked increase in histone acetylation. The highest levels of acetylation are observed at regulatory regions upstream of genes, as exemplified by the 5'-hypersensitive region of the chicken {beta}-globin locus where high histone acetylation protects the downstream promoter DNA from methylation (3, 4). Tissue-specific transcription factors, including NF-E2 and GATA-1, promote transcription of the {beta}-globin genes by inducing both histone acetylation and methylation of histone H3 lysine 4 (H3-MeK4) (3, 5). SATB1 can recruit histone remodeling enzymes to activate or repress gene expression (6, 7) and has been implicated in regulation of globin gene expression (8, 9). Methylation of histone H3 at lysine 9 (H3-MeK9) by site-specific histone methyltransferases, such as Suv39H1, generates a binding site for heterochromatin protein 1 (HP1). This contributes to propagation of heterochromatic subdomains (10) and illustrates the link between H3-MeK9, gene silencing, and heterochromatin formation. The Suv39h-HP1 histone methylation system is required for DNA methylation at pericentric heterochromatin (11) where histone deacetylation and methylation participate in chromosome segregation mediated by mSds3, a protein associated with the mSin3-HDAC (histone deacetylase) corepressor complex (12). Transcriptional repression can be mediated by mSin3A interaction with sequence-specific transcription factors such as Tal1/SCL, and Tal1/SCL-mSin3A repression can be relieved by the specific histone deacetylase inhibitor, trichostatin A (TSA)1 (13).

Tal1/SCL, a basic helix-loop-helix transcription factor, is indispensable for embryonic survival and hematopoietic stem cell formation during development (14, 15). In adult mice, Tal1/SCL is not required for hematopoietic stem cell reconstitution of bone marrow but is required for differentiation along the erythroid lineage (16) Tal1/SCL forms heterodimers with other basic helix-loop-helix proteins, including E2A and E47, and recognizes E-box motifs (CANNTG) in DNA with a preferred binding sequence of 5'-AACAGATGGT-3' (17). These Tal1/SCL heterodimers can regulate transcription positively or negatively by association with transcriptional coactivators or corepressors (13, 18). Cooperation of Tal1/SCL with partners LMO2, GATA-1, E47, and coactivator CBP/p300 positively regulates select erythroid gene expression and erythropoiesis (18–20). Such a Tal1-SCL multiprotein complex with Ldb1 activates protein 4.2 through two E-box GATA elements (20) and with Sp1 regulates glycophorin A (21). A Tal1-SCL multifactorial complex enhances the c-kit promoter in B-cells but does not require Tal1/SCL or GATA-binding motifs (22). The DNA binding domain is dispensable for Tal1/SCL rescue of hematopoietic stem cell formation (23) and for erythroid differentiation of human CD34+ cells, although some differences are observed in CD34 function and glycophorin A expression (24). In early erythroid cells, histone acetylation of the {alpha}-globin gene is initiated at the far upstream region and is associated with binding by a complex containing GATA-2 (prior to the induction of GATA-1), NF-E2, and Tal1/SCL (25). One proposed role for Tal1/SCL in the {beta}-globin locus is the enhancer activity of hypersensitivity site 2 in the locus control region (26) that is required for high level transcription of the {beta}-like globin genes (27). Tal1/SCL interacts with the nuclear corepressor mSin3A, a subunit of the nucleosome remodeling and histone deacetylase complex, and the histone deacetylase HDAC1 to repress transcription (13). This suggests that alteration in chromatin structure may underlie Tal1/SCL-mediated transcriptional repression. Hence, Tal1/SCL associates with ubiquitous and tissue-specific transcription factors to regulate gene expression and can function as a transcription activator or repressor depending on its interacting partners.

Although the Tal1/SCL-preferred DNA-binding sequence is known, only a small number of Tal1/SCL target genes have been identified (20–22, 28). Therefore, delineation of the genomic regions to which Tal1/SCL is recruited should provide insight into the mechanisms of Tal1/SCL-directed gene expression during hematopoiesis. In searching for additional Tal1/SCL genomic binding sites, we isolated an in vivo Tal1/SCL target sequence from K562 erythroid cells. This sequence, EEGS, localizes to chromosome 1 and other chromosomes at the pericentromere, a region associated with formation of heterochromatin and gene silencing. We established that the EEGS element is a target of Tal1-mediated repression through a chromatin remodeling mechanism involving H3K9 methylation and HP1 binding. Our study expands the interacting partners for Tal1/SCL and suggests a novel mechanism by which Tal1/SCL can repress transcription.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Cell Culture and Nuclear Extracts—Erythroleukemia K562 cells and HeLa cells were cultured in RPMI 1640 medium (Invitrogen) and supplemented with 10% fetal bovine serum, penicillin, and streptomycin (100 µl/ml) at 37 °C with 5% CO2. For RT-PCR expression analysis, the total RNA was prepared from washed cells, and first strand cDNA was synthesized using Moloney murine leukemia virus-reverse transcriptase and oligo(dT)16 (PE Applied Biosystems, Foster City, CA). PCR analysis was carried out using gene-specific primers. Nuclear extracts were prepared from K562 cells as described previously (29). K562 cells were centrifuged at 1000 rpm for 5 min, washed with cold phosphate-buffered saline, resuspended in buffer containing 10 mM Hepes, 1.5 mM MgCl2, 10 mM KCl, 0.5 mM dithiothreitol, and 0.5 mM phenylmethylsulfonyl fluoride, and incubated on ice for 5 min. Cells were centrifuged at 2000 rpm for 2 min and washed with 1 ml of the same buffer. The cell pellet was resuspended in 2x volume of 20 mM Hepes, 25% glycerol, 0.42 M NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 0.5 mM dithiothreitol, and 0.5 mM phenylmethylsulfonyl fluoride and incubated on ice for 30 min. The cell suspension was centrifuged at 10,000 rpm for 10 min at 4 °C and the supernatant collected.

Isolation of Tal1/SCL-bound DNA Fragments in Vitro—Genomic DNA target sites for Tal1/SCL were isolated by incubating genomic DNA with K562 nuclear extract followed by isolation of DNA-Tal1-SCL complexes using a Tal1/SCL-specific antibody (Geneka Biotechnology, Inc., Quebec, Canada) (30). In brief, K562 genomic DNA was sonicated to an average size of 0.6 kb, ligated to a common linker DNA fragment (sense, 5'-GCGGTGACCCGGGAGATCTGAATTC-3'; antisense, 5'-GAATTCAGATC-3'), and incubated with K562 nuclear extract. DNA-protein complexes were immunoprecipitated with anti-Tal1/SCL antibody and isolated using protein G-agarose in 1 ml of binding buffer and overnight rotation at 4 °C. The reaction mixture was centrifuged for 10 s, washed rapidly several times with binding buffer (20 mM Tris-HCl, pH 8.0, 0.5 mM EDTA, 5 mM MgCl2), and digested with proteinase K. DNA was purified by phenol/chloroform extraction and ethanol-precipitated. The DNA was then amplified by ligation-mediated PCR using the oligonucleotides previously described as primers. The selection procedure of binding, immunoprecipitation, and ligation-mediated PCR was repeated using 100 ng of amplified DNA, and after three cycles of selection, a library was constructed by ligation of the PCR product into the pCR 4-TOPO vector (Invitrogen).

DNA Binding Assays—For electromobility shift assays (EMSA), DNA probes were labeled with [{gamma}-32P]ATP using T4 polynucleotide kinase (New England Biolabs, Beverly, MA). Binding of nuclear extract to DNA probes was carried out in a 24-µl reaction volume containing 20 mM Tris-HCl, pH 8.0, 100 mM NaCl, 1 mM EDTA, 5% Nonidet P-40, and 0.1 mg/µl Nonidet P-40, 0.1 mg/µl bovine serum albumin, and 10 mM dithiothreitol. The reaction mix was incubated for 30 min at 4–10 °C. DNA-protein complexes were analyzed by electrophoresis in a 4% non-denaturing polyacrylamide gel, followed by autoradiography.

Slide Preparation—Metaphase chromosome spreads were prepared from the peripheral blood leukocytes of a male donor. Whole blood cells were grown for 72–96 h in RPMI medium (Invitrogen) supplemented with 15% fetal bovine serum, penicillin/streptomycin (100 units/ml), and phytohemagglutinin (5 µg/ml) (Murex Diagnostic Ltd., Dartford, UK). Cells were treated with ethidium bromide (5 mg/ml) for 1.5 h, and the reaction was stopped with colcemid (0.05 mg/ml) treatment for 15 min during the log phase growth followed by treatment in hypotonic KCl (0.54%) for 15 min at 37 °C. The cells were then harvested and fixed in cold (-20 °C) methanol/acetic acid (3:1). Fresh slides were equilibrated in 2x SSC solution at 37 °C and dehydrated in increasing ethanol solutions of 70, 80, and 95%.

Fluorescence in Situ Hybridization—Fluorescence in situ hybridization (FISH) was performed as described previously (31, 32). In brief, the DNA probe from the BAC clone (a 129-kb human genomic fragment containing the entire EEGS sequence) (Research Genetics, Huntsville, AL) was labeled with digoxigenin-11-dUTP (Vysis, Downers Grove, IL) by nick translation (Roche Applied Science) and ethanol-precipitated in the presence of 50x herring sperm DNA and 50x Cot-1 human DNA. The DNA pellet was resuspended in Hybrisol solution (50% deionized formamide, 10% dextran sulfate, 2x SSC) to a final concentration of 25 ng/ml. Slides were denatured in 70% formamide, 2x SSC at 72 °C for 2 min, dehydrated sequentially in cold (-20 °C) ethanol solutions of 70, 85, and 100% for 2 min, and air-dried. Probes were denatured at 78 °C for 10 min and then incubated for 30 min at 37 °C for preannealing. A total of 250 µg of DNA probe was applied to the slide. Overnight hybridization was done in a humidified chamber at 37 °C. Post-hybridization washes were at 45 °C in 50% formamide, 2x SSC (three times for 5 min), 1x SSC (two times for 5 min), and 0.1x SSC (two times for 5 min). Detection was performed using rhodamine-conjugated anti-digoxigenin rhodamine (40 min at 37 °C), followed by washing in 4x SSC, 0.1% Tween 20 solution at room temperature for 2 min and then followed by counterstaining with DAPI antifade (0.25 mg/ml).

Digital Image Analysis—Digital acquisition of gray scale images was done using a charge-coupled device Photometrics CCD camera SenSys (Photometrics, Ltd., Tucson, AZ) interfaced to a Power PC 1800 computer and mounted on a Zeiss Axiophot-2 epifluorescence microscope. Images were acquired by using filters specific for DAPI, fluorescein, and rhodamine (TR1, TR2, and TR3 from Chroma Technologies, Brattleboro, VT, and IP Lab Image software from Scanalytics Inc., Fairfax, VA) (31).

Chromatin Immunoprecipitation—Chromatin immunoprecipitation (ChIP) was carried out as described previously (33). Formaldehyde was added to the cell cultures at a concentration of 1% (v/v) of the culture medium. Fixation proceeded at 22 °C for 10 min and was stopped by the addition of 125 mM glycine. Cells were washed twice with phosphate-buffered saline, resuspended in binding buffer containing 0.1% SDS, 0.1% sodium deoxycholate, 1% Triton X-100, and 140 mM NaCl (RIPA buffer), and incubated at room temperature for 10 min. The lysed cells were sonicated for 4 min at a power setting level of 4 with the Ultrasonic Processor (HEAT system, Farmingdale, NY). Cell debris was removed by brief centrifugation (4000 rpm for 1 min). 300 µl of the chromatin suspension and 20 µl of protein A-Sepharose beads were used for immunoprecipitation with anti-Tal1/SCL antibody, anti-SATB1 serum, or preimmune serum. The immunoprecipitates (IP fraction) were washed three times with RIPA buffer. After reversal of cross-linking at 65 °C for 8 h, DNA was purified by proteinase K digestion, phenol/chloroform extraction, and ethanol precipitation. The PCR primers for the EEGS element are as follows: forward, 5'-TCAATAATGATCCCTTTCGAGTCC-3'; reverse, 5'-TGGAAACACCATCGAATTGAAAC-3'. After PCR analysis, the reaction products were confirmed by DNA sequencing.

Construction of Reporter Gene Plasmid—Pairs of complementary oligonucleotides (104 bp) were synthesized based on the native or mutated EEGS sequence (Table IV) containing the core-binding domain. To create the luciferase reporter plasmid pEEGS, the EEGS oligonucleotides were annealed and inserted into the BglII and KpnI sites of the pGL2-promoter vector containing the SV40 promoter and the luciferase reporter gene (Promega, Madison, WI). To create the pREP4/Luc-EEGS reporter vector, the EEGS-SV40 promoter fragment was excised from pEEGS and inserted between the KpnI and Hind III sites of pREP4/Luc. For each transfection, 1.0 x 107 K562 or HeLa cells were transfected with a total of 5 µg of plasmid DNA using the Superfect reagent (Qiagen, Valencia, CA). After 48 h, cells were harvested and lysed in 300 µl of reporter lysis buffer (Promega, Madison WI), and luciferase activity was assayed using a Monolight 2010 luminometer (Analytical Luminescence Laboratory, San Diego, CA). The RSV-{beta}-galactosidase vector (Promega, Madison, WI) (0.1 µg) was cotransfected as an internal control for normalizing transfection efficiency. For cotransfection, 2.5 µg of the reporter gene construct was cotransfected with the Tal1/SCL expression vector (hTal1/SCL-pcDNA1.1), SATB1 expression vector (pECE-AT 1146) (34), or vector without insert to make up the 5 µg total of plasmid DNA. Means ± S.D. were determined from independent transfection assays (n = 3).

Coimmunoprecipitation—For coimmunoprecipitation, 100 µg of cell nuclear extract was incubated with antibody to Tal1/SCL (from E. Bresnick), SUV39H1 or SATB1, or preimmune serum (as negative control) and protein A-agarose (Santa Cruz Biotechnology, Santa Cruz, CA) in 1 ml of binding buffer (0.5% Nonidet P-40, 10 mM Tris-HCl, 150 mM NaCl, 2 mM EDTA, 10% glycerol, 10 µg/ml leupeptin, 10 µg/ml aprotinin) for 3 h at 5 °C. The reaction mixture was pelleted by brief centrifugation. The pellet was resuspended in 1 ml of binding buffer, rotated at 5 °C for 5 min, and briefly centrifuged. The washing process was repeated three times. The immunoprecipitated complexes were separated on a polyacrylamide gel. Antibody to Tal1/SCL (Geneka Biotechnology, Inc., Quebec, Canada), SUV39H1, or SATB1 was used for Western blot analysis of bound proteins.

Real Time Quantitative PCR Analysis—Real time quantitative analysis was carried out as described previously (35). In brief, PCR analyses were used to determine the amount of selected ChIP DNA using DNA-specific primers and fluorescent-labeled TaqMan probes (6-carboxyfluorescein as the 5'-fluorescent reporter, tetramethylrhodamine as 3' end quencher) in an ABI 7700 sequence detector (Applied Biosystems, Foster City, CA). DNA concentration was measured by PicoGreen double-stranded DNA quantitation reagent (Molecular Probes, Inc., Eugene, OR). 2 ng of reference genomic DNA (Ref) and 2 ng of DNA from the ChIP selected immunoprecipitated fraction (IP) were used as template for PCR. Enrichment of the specific sequences in the IP fraction was determined by comparison with the reference control. At low amplification the threshold cycle number (Ct) is directly proportional to the amount of corresponding specific DNA and is in the linear range for the respective DNA pools. Each cycle represents a 2x amplification of the product. The fold difference of the enrichment in the ChIP-selected DNA IP fraction relative to genomic DNA Ref fraction is determined by IP/Ref = 2 (Ct(Ref) - Ct(IP)) (36). Primers and probe for EEGS were synthesized (forward, 5'-CAATAATGATCCCTTTCGAG-3'; reverse, 5'-GCTAAAGGAATCAACATCG-3'; probe, 5'-CGTTTCAATTCGATGGTGTTTC-3').


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Isolation of New Genomic Tal1/SCL-binding Sites—Earlier searches for Tal1/SCL-binding sequences identified Tal1/SCL-specific DNA motifs but were less successful in identifying target genes (28, 37). In ChIP assays, 10% of the Tal1/SCL-binding motifs from murine erythroleukemia cells appeared in tandem with a GATA site, including one that exhibited positive transcriptional activity and localized to the intron of a gene of unknown function that was homologous to the corresponding sequence for the N terminus of otegelin (28). To expand on target genes of Tal1/SCL, we combined an in vitro DNA binding strategy with ChIP. This method was used previously to identify a class of chromatin boundary elements (30). The preliminary in vitro screen offered the ability to perform several cycles of selection with the possibility of enriching the Tal1/SCL-specific target DNA sequences that were then confirmed by ChIP analysis. Total K562 genomic DNA was fragmented, ligated to a common linker DNA, and incubated with K562 nuclear extract. Complexes containing Tal1/SCL binding to DNA were selected by immunoprecipitation using Tal1/SCL-specific antibody. Purified DNA was PCR-amplified, and the selection process was repeated to increase specificity for enrichment of DNA fragments binding to Tal1/SCL. The sequences were confirmed by EMSA incorporating the preferred Tal1/SCL-binding sequence into the probe T1 (5'-ACCTGAACAGATGGTCGGCT-3') (Fig. 1A, lanes 1–10). DNA was subjected to three cycles of selection, and DNA fragments exhibiting Tal1/SCL binding were used for library construction. Individual clones demonstrating competition for Tal1/SCL binding were sequenced and compared with previously sequenced genomic DNA using the National Center for Biotechnology Information advanced BLAST search (38). Among the 75 sequenced DNA clones that varied in length from 300 to 500 bp, no known genes were identified. About 60% of the fragments share homology to the genomic DNA working draft sequences from different chromosomes. One clone, EEGS, of 388 bp had the highest homology score from the BLAST search and exhibited full-length homology with genomic DNA. EEGS was able to compete for Tal1/SCL binding at a level comparable with the preferred Tal1/SCL-binding sequence (Fig. 1A, lanes 11–14). The specific binding of EEGS to Tal1 was further confirmed by the titration of EEGS as competitor in EMSA (Fig. 1B).



View larger version (33K):
[in this window]
[in a new window]
  		FIG. 1.
Isolation of genomic Tal1/SCL-binding sites. A, enrichment for DNA fragments binding to Tal1/SCL was assayed by EMSA. All lanes contain radiolabeled Tal1/SCL-preferred DNA-binding sequence (T1) as probe and K562 nuclear extract. Competitors used to compete for Tal1/SCL binding were no competitor (NC)(lanes 1 and 12). PCR amplification of DNA was from the first cycle of immunoselection of SCL/Tal1-DNA complexes at 50, 500, and 5000 ng (lanes 2–4, respectively); from the second cycle of selection (lanes 5–7, respectively); from the third cycle of selection (lanes 8–10, respectively), and EEGS DNA (E) (lane 13) that competes for Tal1/SCL binding comparable with T1 (lane 14). No nuclear extract (ne) was used in lane 11. B, radiolabeled Tal1/SCL probe is competed by increasing amounts of EEGS at 50, 100, 150, and 200 ng (lanes 2–5). C, EEGS DNA sequence shows homology to human satellite DNA. HST3 indicates HSSAT3 (GI: 36345), HSII indicates HUMSATIIX (GI: 1220362), HIII indicates HSSATIIIA (GI: 36364), and SATB1 indicates satellite 2 sequence identified as a SATB1-binding site (63). Two E-boxes (dark underline) and GATA-binding motif (wavy underline) are indicated. D, EEGS chromosome localization is determined using metaphase chromosomes for FISH and BAC (CITBI-E1) isolated from a human genomic BAC library and contains the full-length EEGS sequence (rhodamine signal). I, hybridization to the pericentromeric region of chromosome 1q12 is shown. II, rhodamine image of the same metaphase is shown separately. III, DAPI-inverted image is used for chromosomal identification. IV, DAPI image is used to visualize individual chromosomes.

 
The EEGS Sequence Localized in Satellite DNA—EEGS contains two E-box motifs, including the preferred Tal1/SCL-binding motif CAGATG (17), a GATA-binding site, and an overlapping SATB1-binding sequence consisting of multiple short ATC sequences of 15–19 bp (Fig. 1C). SATB1 bound a double-stranded base unpairing region and specifically recognized a specialized DNA context (an ATC sequence context rather than simply "ATC-rich") characterized by a cluster of sequence stretches with well mixed As and Ts but either Cs or Gs exclusively on one strand (39). There are 17 5'-TCCATTC repeats in EEGS that overlapped with 12 repeats of 5'-GA(T/A)TCCATTC. EEGS (E-box 1/E-box 2/GATA/SATB1) is highly homologous to satellite DNA 2. EEGS shared 95–98% homology with human satellite DNA 2 (HUMSATIIX), human satellite DNA 3 sequence (HSSAT3), and the boundary between satellite 3 and alphoid sequence (HSSATIIIA).

Chromosome Localization of EEGS and Tal1/SCL Binding—To determine EEGS chromosomal localization, we identified a BAC clone from a human genomic library that contained the entire EEGS sequence. This clone was used as a probe for FISH analysis. The strongest hybridization signal mapped to chromosomal band 1q12 (Fig. 1D, I–IV). Cross-hybridization with other chromosomes seen as the light background may be indicative of other repetitive sequences within the BAC clone.

Tal1/SCL Binds to EEGS in Vivo—A direct association in vivo between Tal1/SCL and EEGS was demonstrated by ChIP (Fig. 2A). Chromatin prepared from K562 erythroleukemia cells was immunoprecipitated with anti-Tal1/SCL antibody. DNA was isolated and analyzed by PCR using primers specific for EEGS (Fig. 1C). Tal1/SCL-selected chromatin DNA gave rise to an EEGS-specific product (Fig. 2A, lanes 3–5). In contrast, no product was observed using primers specific for {beta}-actin (Fig. 2A, lanes 11–13). Furthermore, DNA from chromatin selection using preimmune serum did not produce any EEGS-specific product (Fig. 2A, lane 8). These data show that EEGS can bind Tal1/SCL in vivo (Fig. 2A) as well as in vitro (Fig. 1, A and B). To determine whether the two E-box motifs in EEGS could bind directly to Tal1/SCL, probes were designed for EMSA that were specific for E-box1 or E-box2 (Fig. 2, B and C). We found that Tal1/SCL in K562 nuclear extract bound to the E-box1 probe (5'-GATTCCATTTGATTCCATTC-3') (Fig. 2C, lane 1). Tal1/SCL binding was effectively competed with cold probe (Fig. 2C, lane 2) but not with E-box1 mutated to CATCCG (Fig. 2C, lane 3). Binding was diminished in the presence of anti-Tal1/SCL antibody, and a higher molecular weight band appeared (Fig. 2C, lane 4). Binding of Tal1/SCL to E-box2 (5'-ATTTCCATCTGATGATGATTGATTC-3') was also observed (Fig. 2C, lane 5 and 8). Binding was competed by cold probe (Fig. 2C, lane 6) but not by a competitor in which E-box2 was mutated to CATCCG (Fig. 2C, lane 7). Addition of anti-Tal1/SCL antibody introduced a high molecular weight super-shift band (Fig. 2C, lane 9). These data show that both E-box1 and E-box2 are capable of binding to Tal1/SCL.



View larger version (28K):
[in this window]
[in a new window]
  		FIG. 2.
Tal1/SCL and GATA-binding motifs in EEGS. A, in vivo ChIP was carried out using K562 cells and anti-Tal1/SCL antibody ({alpha}-Tal1) (lanes 3–5 and 8–10) or preimmune serum ({alpha})(lane 13). Arrows show positions of the forward and reverse EEGS PCR primers indicated in Fig. 1 (lanes 2–5 and 12 and 13). The amount of Tal1/SCL selected ChIP DNA used was 10 pg (lane 3), 100 pg (lane 4), and 1 ng (lane 5). PCR primers for the {beta}-actin gene were used for analysis of 10 pg (lane 8), 100 pg (lane 9), and 1 ng (lane 10) of Tal1/SCL selected ChIP DNA as a negative control. M and C indicate markers and control genomic DNA, respectively. B, EMSA was used to assess transcription factor binding to EEGS in vitro. Probes taken from the EEGS sequence were specific for E-box2 (E2), E-box2 with the GATA motif (E2G), and E-box2 with a mutated GATA motif (E2mutG). C, protein binding to EEGS motifs was determined using K562 nuclear extract (NC, lanes 1, 5, and 8). Competitors for the E-box1 (E1) probe were E1 (lane 2) and mutE1 (lane 3). Competitors for the E-box2 (E2) probe were E2 (lane 6) and mutE2 (lane 7). Lanes 4 and 9 contain Tal1/SCL-specific antibody ({alpha}-Tal1) that introduces a new shift band of higher molecular weight (arrowhead). D, protein binding to the GATA motif was observed using K562 nuclear extract. Probes used were E2, E2G, and E2mutG as indicated. Competitors for the E2G probe were no competitor (NC, lanes 2, 5, and 7), a GATA-1-specific competitor (G, lane 3), E2G (lane 4), and the preferred Tal1/SCL sequence (T1, lane 8). Binding to the GATA motif was reduced by antibodies specific for GATA-1 ({alpha}-GATA1, lane 10) and GATA-2 ({alpha}-GATA2, lane 11) but not by preimmune serum ({alpha}, lane 9). E, protein binding to the SATB1 motif (EEGS-S) was observed by using Jurkat nuclear extract containing high level of endogenous SATB1. No nuclear extract (ne) is indicated in lane 1. Competitors for the EEGS-S probe were no competitor (NC, lane 2), the SATB1-binding site from the immunoglobulin heavy-chain enhancer (39) (wild type (25)7) (lane 3), cold probe (lane 4), and a mutant SATB1-binding sequence (mut (24)8, lane 5). Lane 6 contains anti-SATB1 antibody ({alpha}-SATB1). F, ChIP was repeated in K562 cells with antibodies specific for Tal1/SCL ({alpha}T, lane 3) or SATB1 ({alpha}S, lanes 6–9) or preimmune serum ({alpha}, lane 4). Selected ChIP DNA was amplified using PCR primers for EEGS (lanes 2–9). The amount of SATB1 selected ChIP DNA used was 10 pg (lane 6), 100 pg (lane 7), 1 ng (lane 8) and 10 ng (lane 9). M indicates markers, and C indicates control genomic DNA.

 
Tal1/SCL is known to interact with GATA-1 through the transcription factor LMO2 that acts as a bridging molecule between Tal1/SCL and GATA-1 (19). To assess the binding capacity of the GATA motif in EEGS, several probes were constructed (Fig. 2D). Probe E2G spanned the E-box2 (CATCTG) and GATA (TGATAC) motifs (5'-CATTTCCATCTGATGATGATTCCATTCGATTCCATTCAATGATACC-3'). This probe resulted in an additional band migrating faster than the Tal1/SCL band (Fig. 2D, lane 2) compared with probe E2 (Fig. 2D, lane 1), and both bands were competed with cold probe (Fig. 2D, lane 4). Only the faster migrating band was competed with a GATA-1-specific DNA competitor (Fig. 2D, lane 3), suggesting that this faster migrating band represented binding by a GATA-binding protein. The faster migrating band was also absent in assays using probe E2mutG with the GATA motif mutated to TCTATC (Fig. 2D, lane 6). We could not distinguish between GATA-1 and GATA-2 binding as both proteins yielded similarly shifted bands and bound to the GATA-specific DNA competitor. Addition of anti-GATA-1 (Fig. 2D, lane 10) or anti-GATA-2 (Fig. 2D, lane 11) antibodies diminished the intensity of this band. The absence of a bandshift with the GATA antibodies is likely due to the fact that these antibodies were raised against the peptide involved in DNA binding.

In addition to the E-box, EEGS contains an ATC-rich SATB1-binding sequence. By using this SATB1-binding site as a probe (EEGS-S, 5'-ATT CGA TTC CAT TCT ATG ACG ATT CCA TTC ATT TCC ATC TGA TGA TGA TTC CAT TCG ATT CCA TTC AAT GAT-3') in EMSA, we showed that EEGS binds SATB1 in vitro (Fig. 2E). The binding of SATB1 to EEGS was competed by the SATB1-binding site taken from the immunoglobulin heavy chain enhancer (wild type (25)7) (5'-(TCTTTAATTTCTAATATATTTAGAA)7-3') (Fig. 2E, lane 3) and also by cold probe (Fig. 2E, lane 4). A mutated core sequence (mut (24)8 (5'-(TCTTTAATTTCTACTGCTTTAGAA)8-3') (39) did not compete for the binding by SATB1 (Fig. 2E, lane 5). Specific binding by SATB1 was confirmed by using a rabbit anti-SATB1 serum that markedly reduced the intensity of the SATB1-probe complex (Fig. 2E, lane 6). Binding of SATB1 to EEGS in vivo was also demonstrated by ChIP analysis of K562 cells using a SATB1 antibody (Fig. 2F). A PCR product using EEGS-specific primers was produced by using DNA from anti-SATB1-selected chromatin (Fig. 2F, lanes 6–9) comparable with that from anti-Tal1/SCL-selected chromatin (Fig. 2F, lane 3), whereas no PCR product was observed in DNA selected using preimmune serum ({alpha}) (Fig. 2F, lane 4).

EEGS Mediates Negative Transcriptional Activity—Tal1/SCL binding to the EEGS sequence, which was localized to the chromosome 1 pericentromere, raised the possibility that EEGS might be involved in pericentromere-mediated heterochromatin formation and transcriptional repression. An updated BLAST search showed EEGS localization to pericentromeric regions in chromosomes 1q11, 1q12, 10q11, and 22q11. A BLAST search showed that EEGS also localized to the pericentromere of chromosome 2 (2p11.1). Pericentromeric heterochromatin can be transcriptionally active and gives rise to transcripts spanning the major satellite repeats (11). EEGS sequence homology searches identified corresponding transcripts in a differential library constructed from human primary erythroid progenitor cells (40). To determine the effect of EEGS on transcription activity, a luciferase reporter gene was constructed containing the EEGS core sequence upstream of the SV40 promoter (EEGS-SV) (Fig. 3A). These constructs were transfected into K562 cells, and reporter gene activity was determined. The EEGS core sequence reduced promoter activity by 2.7-fold. Repression by EEGS was further enhanced by cotransfection with expression vectors for Tal1/SCL or SATB1 (Fig. 3B). Repression by EEGS was diminished with mutation of E-box1 or E-box2. Mutation of both E-boxes in the same construct eliminated repression and restored transcriptional activity close to that for the SV40 control vector without EEGS. Cotransfection with the expression vector for Tal1/SCL had little effect on transcriptional activity of the mutant EEGS when both E-boxes were mutated. Repression by EEGS was reduced but detectable following mutation of the GATA-binding site and decreased even further when combined with mutation of E-box1 or E-box2. In HeLa cells that do not express Tal1/SCL or SATB1, EEGS did not repress transcription, and activity of the EEGS-SV construct was comparable with the SV40 control construct (Fig. 3C). Most interestingly, cotransfection of EEGS-SV with the Tal1/SCL expression vector in HeLa cells decreased EEGS-SV reporter gene activity by 3-fold. Cotransfection of EEGS-SV with the SATB1 expression vector also decreased reporter gene activity but to a lesser extent than Tal1/SCL. Cotransfection with both expression vectors for Tal1/SCL and SATB1 with EEGS-SV resulted in the greatest reduction in EEGS-SV reporter gene activity. These results suggest that EEGS can act in an inhibitory role on transcription activity in a Tal1/SCL (and to a lesser extent SATB1)-dependent manner that requires the E-box and GATA motifs for optimal activity.



View larger version (26K):
[in this window]
[in a new window]
  		FIG. 3.
Luciferase reporter gene assays of the EEGS core sequence. A, the EEGS core sequence containing the two E-boxes (E1 and E2), the GATA motif (G), SATB1-binding site (S), and respective EEGS mutants (regions mutated indicated by X) were cloned 5' of the SV40 promoter linked to a luciferase reporter gene. B, the luciferase activity was determined after transfection of the reporter gene construct into K562 cells. Constructs assayed were a promoterless pGL-basic construct (cross-hatched bar) used as a negative control (NC), the SV40 promoter (open bar) used as a positive control, and the EEGS core and EEGS mutations with the SV40 promoter (solid bars). Cotransfections with Tal1/SCL and SATB1 expression vectors are indicated. EEGS mutations (shown as X) of E-box1, E-box2, and the GATA motif as indicated were also assayed. C, reporter gene constructs with (solid bars) and without EEGS (open bar) were assayed in HeLa cells. Cotransfections with Tal1/SCL and SATB1 expression vectors are also indicated.

 
Tal1/SCL Increases H3-MeK9 at EEGS—Methylation of histone H3 at lysine 9 (H3-MeK9) is a hallmark of repressive chromatin and provides a high affinity ligand for binding of the HP1 family of heterochromatin proteins (1). To explore further the mechanism of transcriptional Tal1/SCL repression, ChIP analysis, and quantitative TaqMan real time PCR, analyses were employed to determine enrichment or depletion of H3-MeK9 in EEGS chromatin. Anti-dimethyl-histone 3 lysine 9 antibody (Upstate Biotechnology, Inc.) was used for immunoprecipitation of specific chromatin complexes containing histone 3 methylated at lysine 9 (Fig. 4A). We found that in K562 cells, association of EEGS with methylated H3 at lysine 9 increased 3-fold with Tal1/SCL overexpression. This change correlated with an increase in HP1 binding to EEGS, and ChIP was repeated using anti-HP1 antibody (Upstate Biotechnology, Inc.) (Fig. 4B). Quantitative real time PCR revealed a 24-fold increase in HP1 association with EEGS chromatin when Tal1/SCL expression was enforced. In Tal1/SCL-overexpressed cells, the large difference in HP1 binding to EEGS compared with H3 methylation of EEGS-associated chromatin may reflect in part additional contributions from mono- or trimethylated histone 3 lysine 9 or differences in the efficiency of the respective antibodies in the ChIP assay. Nevertheless, these data indicate that Tal1/SCL repression was associated with modification of EEGS chromatin, including an increase in H3-MeK9 and a corresponding increase in HP1 recruitment, and ultimately formation of an inactive transcriptional state in this region.



View larger version (18K):
[in this window]
[in a new window]
  		FIG. 4.
Tal1/SCL and EEGS histone methylation. A, in vivo ChIP was carried out using antibody specific for histone 3 methylated at lysine 9 (H3-MeK9) and K562 cells without and with overexpression of Tal1/SCL (K562/Tal1). PCR primers and probe specific for EEGS were used for real time PCR quantification of the corresponding amount of DNA present. Results were normalized to genomic DNA. As a negative control, ChIP analysis using preimmune serum is included. B, ChIP was repeated using antibody specific for heterochromatin protein HP1 and EEGS-specific DNA quantified by real time PCR. C, proteins isolated from nuclear extract using anti-Tal1/SCL antibody ({alpha}-Tal1), preimmune serum ({alpha}), or anti-Suv39H1 antibody ({alpha}-SUV) were subjected to Western blot analysis using antibody specific for histone methylase Suv39H1 or Tal1/SCL. The Suv39H1 (SUV) and Tal1/SCL controls are also shown.

 
The methyltransferase Suv39H1 can direct histone H3-MeK9 and heterochromatin-dependent gene silencing (41). Therefore, we used coimmunoprecipitation analysis to determine whether Tal1/SCL could interact with Suv39H1 to facilitate specific histone methylation. Nuclear extract from K562 cells was immunoprecipitated with anti-Tal1/SCL antibody (Santa Cruz Biotechnology). Western blotting using anti-Suv39H1 antibody (Upstate Biotechnology, Inc.) was employed to analyze the protein composition of the precipitated protein complexes. A specific band for Suv39H1 was identified in the Tal1/SCL immune precipitates but not in the preimmune serum control (Fig. 4C). Similarly, Tal1/SCL was coimmunoprecipitated with Suv39H1 using anti-Suv39H1 antibody. These results provide evidence for a complex between Tal1-SCL and Suv39H1. Such a complex raised the possibility that Tal1/SCL may act as a transcriptional repressor by promoting the recruitment of this methyltransferase to specific genomic regions.

Tal1/SCL Promotes a Transcriptionally Repressed State Mediated through EEGS—Endogenous EEGS sequences were enriched in specific markers of inactive chromatin, including MeK9 and HP1 binding, with increased Tal1/SCL expression. In reporter gene assays, we found that EEGS promoted transcriptional repression in the presence of endogenous or elevated Tal1/SCL. To confirm that Tal1/SCL-mediated repression by EEGS occurred within the context of appropriate chromatin remodeling, we used the Epstein-Barr virus episomal reporter gene system to mimic the chromatin environment in cells, and we evaluated EEGS activity. The EEGS-SV40 promoter fragment was cloned into the pREP4/luc to create pREP4/EEGS-Luc, which was transfected into K562 cells and into HeLa cells (Fig. 5). We found that in K562 cells EEGS significantly decreased promoter activation and decreased luciferase activity compared with promoter alone (Fig. 5A). Promoter activity was further decreased by cotransfection with a Tal1/SCL expression vector. In HeLa cells, EEGS had no effect on promoter activity in the absence of Tal1/SCL. With cotransfection of Tal1/SCL, luciferase activity was significantly decreased. Mutation of EEGS had no effect on promoter activity even with cotransfection of Tal1/SCL, which provided evidence for the Tal1/SCL-dependent repression of transcription activity by EEGS.



View larger version (31K):
[in this window]
[in a new window]
  		FIG. 5.
Tal1/SCL-mediated repression involves repressive chromatin formation. A, the EEGS core and flanking SV40 promoter was cloned into a pREP4/Luc vector and transfected into K562 cells. Constructs assayed were a promoterless pREP4/Luc construct (cross-hatched bar) used as a negative control (NC), the SV40 promoter (open bar) used as a positive control, and the EEGS core with the SV40 promoter (solid bar). Cotransfection with an expression vector for Tal1/SCL (Tal1) is also indicated. B, constructs were also assayed in HeLa cells that lack endogenous Tal1. Cotransfections with expression vectors for Tal1/SCL and for SATB1 are also shown. EEGS with mutations of E-box1 and E-box2 ({Delta}EEGS, solid bar) was also assayed. C, coimmunoprecipitation of Jurkat cells (lanes 1–6) that express high levels of Tal1/SCL and SATB1, and K562 (lanes 7–12) cells using SATB1-(lanes 2 and 8) and Tal1/SCL (lanes 5 and 11)-specific antibodies show by Western blotting a Tal1/SCL-(lanes 2 and 8) and SATB1 (lanes 5 and 11)-specific band, respectively. Preimmune serum ({alpha}) is used as control (lanes 1, 4, 7, and 10), and nuclear extract from Jurkat (lanes 3 and 6) and K562 (lanes 9 and 12) are also included.

 
SATB1 Interacts with Tal1/SCL—The binding of SATB1 to EEGS and the ability of SATB1 to modulate chromatin remodeling raised the possibility that SATB1 could be involved in the Tal1/SCL-mediated repression by EEGS. We cotransfected pREP4/EEGS-Luc with expression vectors for Tal1/SCl and SATB1 into HeLa cells. Quantification of luciferase activity revealed that SATB1 enhanced repression of EEGS by Tal1 (Fig. 5B). We then used coimmunoprecipitation in K562 cells to determine whether there was a direct association between Tal1/SCL and SATB1 (Fig. 5C). We also carried out similar immunoprecipitation studies in Jurkat cells that expressed high levels of Tal1/SCL and SATB1 endogenously. SATB1-containing protein complexes were isolated from the nuclear extract by immunoprecipitation using anti-SATB1 serum and were analyzed by Western blotting using anti-Tal1/SCL antibody. In both K562 and Jurkat cells, a protein of the proper molecular weight recognized by the Tal1/SCL antibody was observed in the anti-SATB1 immune complexes (Fig. 5C, lanes 2 and 8), but not when preimmune serum was used (Fig. 5C, lanes 1 and 7). In the converse experiment, anti-Tal1/SCL antibody was used to immunoprecipitate protein complexes from the nuclear extract and analyzed by Western blotting using anti-SATB1 serum. Again, for both K562 and Jurkat nuclear extracts, a SATB1 band was detected in the Tal1-SCL complexes (Fig. 5C, lanes 5 and 11). In contrast, no interaction was observed between the Tal1-SCL and the SWI/SNF complex in analogous experiments using antibodies specific for SWI/SNF proteins (data not shown). The protein bands from Jurkat cells were more intense, reflecting the higher level of Tal1/SCL and SATB1 expressed in these cells. These data suggest that Tal1/SCL and SATB1 may be associated in a common multiprotein complex during erythroid differentiation.

Tal1/SCL-mediated Repression by EEGS Includes Formation of Repressive Chromatin—To explore whether there was alteration of chromatin structure in the EEGS-containing construct, anti-dimethyl-histone 3 lysine 9 antibody was used for the immunoprecipitation of specific chromatin complexes containing histone 3 methylated at lysine 9 (Fig. 6A). We found that in K562 cells, increased Tal1/SCL expression enriched histone H3 methylation at lysine 9 (H3-MeK9) associated with EEGS chromatin. In contrast, only low levels of H3-MeK9 were detected when the EEGS site was mutated (pREP4/{Delta}EEGS-Luc or {Delta}EEGS), even with Tal1/SCL overexpression. Although there were no Tal1/SCL-binding sites in the SV40 promoter, we observed a similar association of H3-MeK9 in the SV40 promoter linked to EEGS. To determine whether the increase in EEGS chromatin H3-MeK9 by Tal1/SCL also correlated with an increase in HP1 binding to EEGS in pREP4/EEGS-Luc, ChIP was repeated using anti-HP1 antibody (Upstate Biotechnology, Inc.) (Fig. 6B). Quantitative real time PCR showed an increase of HP1 association with EEGS chromatin when Tal1/SCL expression was enforced. Again, overexpressed Tal1/SCL elicited only low levels of HP1 recruitment in the mutant {Delta}EEGS construct. For the EEGS-linked SV40 promoter, increased Tal1/SCL also increased HP1 associated with the SV40 promoter linked to EEGS but not the SV40 promoter linked with the mutant {Delta}EEGS.



View larger version (21K):
[in this window]
[in a new window]
  		FIG. 6.
Tal1/SCL increases EEGS histone methylation and flanking DNA sequence. A, in vivo ChIP was carried out using antibody specific for histone H3 methylated at lysine 9 (H3-MeK9) in K562 cells transfected with the pREP4/EEGS-Luc construct to examine chromatin associated with EEGS and the flanking SV40 promoter fragment. PCR primers and probe specific for the EEGS core and SV40 promoter were used for real time PCR quantification of the corresponding amount of DNA associated with HF3-MeK9 with and without overexpression of Tall/SCL. B, ChIP was repeated using antibody specific for heterochromatin protein HP1 and DNA corresponding to chromatin associated with HP1 from EEGS, and flanking SV40 promoter was quantified by real time PCR.

 
Tal1/SCL recruits mSin3A and histone deacetylase to function as a transcriptional repressor. Histone deacetylation is known to precede histone 3 lysine 9 methylation (3, 42). Thus, hypermethylation of histone 3 lysine 9 in chromatin associated with EEGS may be a consequence of histone deacetylation during the formation of inactive transcriptional chromatin. To test these possibilities, we treated K562 cells with the HDAC inhibitor TSA and cotransfected the cells with pREP4/EEGS-Luc and the expression vector for Tal1/SCL (Fig. 7). We observed that repression of luciferase activity by increased Tal1/SCL was relieved in a dose-dependent manner by addition of TSA (Fig. 7A). ChIP analysis showed that TSA increased acetylation of histone H3 and H4 associated with pREP4/EEGS-Luc (Fig. 7B). Concomitantly, TSA decreased H3-MeK9 and HP1 associated with pREP4/EEGS-Luc. These data suggested that Tal1/SCL-mediated repression of transcription activity via EEGS required histone deacetylation.



View larger version (13K):
[in this window]
[in a new window]
  		FIG. 7.
Histone acetylation relieves repression by EEGS. A, K562 cells containing pREP4/EEGS-Luc and expression vector for Tal1/SCL to maximize repression by EEGS were treated with trichostatin A (TSA) from 20 to 100 nM and showed a dose-dependent decrease in transcription repression by EEGS (solid bars). As a positive control, the construct containing only the SV40 promoter is included (open bar). B, in vivo ChIP was carried out using antibodies specific for acetylated histone H3 and H4 in cells in K562 cells with (solid bars) and without (open bars) TSA treatment and containing pREP4/EEGS-Luc and Tal1/SCL expression vectors. Acetylated histone H3 and H4 associated with the EEGS core and SV40 promoter were quantified by real time PCR and normalized to the amount of product obtained from genomic DNA (fold difference). C, in vivo ChIP analysis of TSA-treated K562 cells (solid bars) compared with no treatment (open bars) was repeated using antibodies specific to H3-MeK9 and HP1.

 
Tal1/SCL Inhibits Tropomodulin 4 Expression—Because EEGS mapping to the pericentromere of chromosome 1 (1q11, 1q12) has characteristics of human satellite repeats, EEGS transcription regulation was expected to be species-specific. Localization of tropomodulin 4 to 1q12 prompted us to examine tropomodulin 4 expression in K562 cells. Tropomodulin is an actin-capping protein with several isoforms that exhibit varying tissue specificity. Originally identified in erythrocytes, tropomodulin isoforms can be ubiquitous (tropomodulin 3) or tissue-specific, with tropomodulin 4 found only in muscle and lens (43, 44). Tropomodulin 4 expression was observed in adult chicken erythrocytes but not in human erythroid cells (45, 46). Most surprisingly, we found that K562 cells exhibited a low level of tropomodulin 4 transcripts (Fig. 8A). Quantitative RT-PCR with primers and probes specific for human tropomodulin 4 indicated that the level of tropomodulin 4 in K562 cells was 0.15 times the level in human skeletal muscle mRNA (Fig. 8B). We identified two E-boxes upstream of the tropomodulin 4 coding region (340 bp 5' and 646 bp 5'), but no Tal1/SCL binding was observed by ChIP analysis (data not shown). With overexpression of Tal1/SCL in K562 cells, the level of tropomodulin 4 decreased to 30-fold less than that in skeletal muscle. This decrease in tropomodulin 4 expression was accompanied by a 7-fold increase in H3-MeK9 in tropomodulin 4-associated chromatin (Fig. 8C). Although HP1 did not appear to bind to tropomodulin 4 in K562 cells, HP1 binding to tropomodulin 4 chromatin was readily detected in Tal1/SCL-overexpressing K562 cells (Fig. 8D). The marked increase in H3-MeK9 and HP1 associated with tropomodulin 4 chromatin in Tal1/SCL-overexpressing K562 cells suggested a shift toward a transcriptionally inactive state and was consistent with decreased tropomodulin 4 expression. Note, however, that tropomodulin 4 maps to the telomeric end of 1q12 and the possibility remains that regulation by Tal1/SCL may be via other regulatory mechanisms.



View larger version (15K):
[in this window]
[in a new window]
  		FIG. 8.
Tal1/SCL represses tropomodulin 4 expression in erythroid cells. A, RT-PCR analysis of mRNA from human skeletal muscle, K562 cells, and K562 cells overexpressing Tal1/SCL (K562/Tal1). B, real time quantitative RT-PCR was used to determine human tropomodulin 4. expression. C, in vivo ChIP analysis of tropomodulin 4 using H3-MeK9-specific antibody and K562 and K562/Tal1 cells. D, ChIP analysis of tropomodulin 4 using HP1-specific antibody. Control indicates ChIP analysis using preimmune serum.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
Overexpression of Tal1/SCL in human hematopoietic CD34+ cells increased the long term culture initiating cell (LTC-IC) potential, an activity that required Tal1/SCL DNA binding (24). We hypothesize that Tal1/SCL binding to EEGS DNA found in pericentric satellite DNA may not be related to specific gene expression during erythroid differentiation as observed for glycophorin A. Rather, Tal1/SCL binding to EEGS may be related to chromatin organization such as pericentric heterochromatin and may provide clues to its function in maintaining LTC-IC potential in early human hematopoietic progenitor cells.

We demonstrate for the first time that Tal1/SCL, a lineage-specific transcription factor, binds in vivo to pericentric DNA and increases H3-MeK9 and HP1 association with EEGS chromatin and transcription repression. This illustrates a new mechanism for Tal1/SCL as a repressor of transcription beyond its association with the corepressor mSin3A (13). Enzymes that alter N-terminal histone tails and proteins that bind to specific modifications provide sequential changes in histones and chromatin structure that give rise to a "histone code" for epigenetic regulation (1). Actively transcribed genes are generally associated with euchromatin, whereas silent genes tend to be associated with heterochromatin. Heterochromatin is characterized by hypoacetylation and hypermethylation at lysine 9 of histone 3 (H3-K9) and enriched in HP1 (47, 48). HP1 is sufficient to generate silent chromatin in regions of the genome with transcriptional potential, is relatively independent of DNA sequences, and depends on the extent of H3-MeK9. Pericentric DNA contains high copy tandem repeats (satellite DNAs) linked to formation of heterochromatin (49). Some repressors operate at short distances usually binding to the promoter region and recruiting histone deacetylases to remove acetyl groups from the lysine residues of histone tails (50, 51). In contrast, the spread of long range repression is believed to involve propagation of histone hypoacetylation and generation of H3-MeK9 along the chromatin fiber throughout a region (3, 42). Localization of EEGS to pericentric DNA suggests that Tal1/SCL repression via EEGS may have regional rather than gene-specific effects.

The effects of Tal1/SCL on chromatin remodeling of EEGS DNA are functionally linked to a shift toward a transcriptionally repressive state. The pREP4 reporter gene construct displays most of the hallmarks of normal chromatin structure; it contains the Epstein-Barr virus origin of replication and a transcription unit for EBNA-1 that ensures episomal replication of the plasmid in mammalian cells (52). The increase of H3-MeK9 and HP1 in chromatin associated with EEGS and the linked promoter suggests that Tal1/SCL can act as repressor through heterochromatin formation. Methylation of H3K9 by Suv39H1 provides a docking site for dynamic HP1 binding. Suv39h histone methyltransferase activity is required for mammalian pericentric heterochromatin formation and for genomic stability during development (53). The absence of Suv39h results in low level H3-K9 methylation at pericentric DNA (11). In addition, major satellite repeats localized at pericentric heterochromatin exhibit an increase in transcriptional activity in murine embryonic stem cells lacking Suv39h. Further study is necessary to determine whether interaction between Tal1/SCL and Suv39H1, as predicted by the coimmunoprecipitation results, is responsible for hypermethylation and HP1 binding to chromatin in pericentric EEGS DNA and flanking regions. The histone deacetylase inhibitor, TSA, increased EEGS histone acetylation, decreased EEGS-associated H3-MeK9 and HP1, and blocked Tal1/SCL-mediated repression by EEGS in a dose-dependent manner. This is supportive of the notion that deacetylation precedes methylation of histone tails and is consistent with previously described Tal1/SCL repressor activity via interaction with the corepressor mSin3A.

In addition EEGS DNA binding to Tal1/SCL, EEGS binds to SATB1 in vivo. In T-cells, SATB1 acts as landing platform for chromatin modifiers and can recruit mSin3A, HDAC, and other subunits of the nucleosome remodeling and histone deacetylase chromatin remodeling complex to mediate deacetylation of histones (6, 7). The identification of a protein complex containing Tal1/SCL and SATB1 along with the enhancement of Tal1/SCL-mediated repression by increasing SATB1 loading suggests that Tal1/SCL-mediated repression via EEGS may result from interaction with several proteins that affect chromatin remodeling. Interaction of Tal1/SCL and SATB1 with mSin3A may be particularly relevant because its associated protein, mSds3, an essential component of the mSin3-HDAC corepressor complex, appears to be required for pericentric heterochromatin formation and chromosome segregation in mammalian cells (12). Indeed, repression by a Tal1/SCL-binding motif overlapping with a SATB1-binding site may not be unique to EEGS. We identified a second Tal1/SCL binding DNA fragment, E5S, that contains five E-boxes and a region that is 97% homologous to both a SATB1-binding motif and to DNA that binds to vimentin, an intermediate filament protein that behaves like a nuclear matrix protein (54). E5S also decreases transcription activity in reporter gene assays (data not shown). If Tal1/SCL binding to pericentric EEGS DNA plays a role in maintaining LTC-IC potential in early human hematopoietic progenitor cells or in erythroid differentiation, an analogous interaction might be expected in the mouse. For example, a MAR from the murine insulin-like growth factor 2 gene (gi:2405571) that contains a SATB1-binding motif colocalizes with several candidate E-boxes and GATA motifs. Several mouse major {gamma}-satellite repeats localizing to pericentric heterochromatin also contain the consensus E-box CANNTG motifs (55). Although SATB1 contributes to Tal1/SCL repression via EEGS, it is not required as demonstrated by EEGS-mediated repression in HeLa cells.

Satellite repeats from pericentric heterochromatin are not transcriptionally inert, and it is possible to generate transcripts from major satellite repeats (11). Furthermore, several EEGS-containing clones corresponding to RNA transcripts are found in a subtracted library specific for differentiating primary erythroid progenitor cells (40). Although we were not able to identify any genes encoded in proximity of EEGS sequences, Tal1/SCL affected repression in erythroid cells of the tropomodulin 4 gene that also localized to chromosome 1q12. Tal1/SCL overexpression increased associated H3-MeK9 and HP1, consistent with a shift toward a less transcriptionally active state. Repression of tropomodulin 4 in erythroid cells mediated by Tal1/SCL may relate to spreading of a heterochromatin state from the pericentromere, although tropomodulin 4 is located distal to the centromere at 1q12.

In the nucleus, repetitive DNA can localize to form regions of chromatin in a repressed state, which can "spread" stochastically to nearby genes (56). Repression can also act "in trans," and the subnuclear localization of differentially expressed genes to these heterochromatin compartments relates to transcription repression. For example, the {beta}-globin gene cluster is segregated from {alpha}-satellite-rich heterochromatin in differentiating erythroid cells but is associated with pericentric heterochromatin in lymphocytes in which the globin genes are silenced (57, 58). Activation of differentiation stage-specific enhancers such as the HS2 (hypersensitive site 2) core in the 5' locus control region of the {beta}-globin cluster can prevent a gene from residing in proximity to heterochromatin to maintain an active state via hyperacetylation of histones (57). Alternatively, DNA binding of select transcription factors such as Ikaros during B-lymphocyte differentiation can mediate gene silencing and sequester genes close to pericentromeric regions (59, 60). The spatial arrangements of centromeric heterochromatin are different between fibroblasts and hematopoietic cells with distinct myeloid and lymphoid patterns, raising the possibility of tissue-specific heterochromatin organization (61). It has been speculated that different satellite repeats may form distinct heterochromatin compartments and participate in celltype stage-specific gene regulation by providing binding sites for specific transcription factors (56). Furthermore, the histone code is read in the context of other interactions (62). We provide evidence for Tal1/SCL binding in vivo to pericentric EEGS DNA to promote a transcriptionally repressive state. This activity exemplifies epigenetic regulation through histone modification and the histone code. Potential interactions of Tal1/SCL with mSin3A and possibly Suv39H1 have implications for Tal1/SCL binding to EEGS in pericentric heterochromatin formation in hematopoietic/erythroid cells (11, 12). The actions of Tal1/SCL in regulating LTC-IC potential in early human hematopoietic progenitor cells may involve modulation of higher order chromatin organization above and beyond its ability to affect chromatin acetylation or methylation at the sites of specific genes. The extent to which Tal1/SCL-mediated transcription repression of pericentric chromatin contributes to the maintenance of hematopoietic cells in a less differentiated pluripotent or multipotent state warrants further investigation.


   FOOTNOTES
 
* The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

|| Present address: Institute for Cell Engineering, The Johns Hopkins University School of Medicine, Baltimore, MD 21205. Back

{ddagger}{ddagger} To whom correspondence should be addressed: Molecular Medicine Branch, NIDDK, National Institutes of Health, Bldg. 10, Rm. 9N307, 10 Center Dr., MSC 1822, Bethesda, MD 20892-1822. Tel.: 301-496-1163; Fax: 301-402-0101; E-mail: cnoguchi{at}helix.nih.gov.

1 The abbreviations used are: TSA, trichostatin A; ChIP, chromatin immunoprecipitation; RT, reverse transcription; EMSA, electromobility shift assays; FISH, fluorescence in situ hybridization; DAPI, 4,6-diamidino-2-phenylindole; HDAC, histone deacetylase; IP, immunoprecipitated; mut, mutant. Back


   ACKNOWLEDGMENTS
 
We thank Alan N. Schechter and Terumi Kohwi-Shigematsu for helpful discussion and Emory Bresnick for Tal1/SCL antibody.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Jenuwein, T., and Allis, C. D. (2001) Science 293, 1074-1080[Abstract/Free Full Text]
  2. Felsenfeld, G., and Groudine, M. (2003) Nature 421, 448-453[CrossRef][Medline] [Order article via Infotrieve]
  3. Litt, M. D., Simpson, M., Gaszner, M., Allis, C. D., and Felsenfeld, G. (2001) Science 293, 2453-2455[Abstract/Free Full Text]
  4. Mutskov, V. J., Farrell, C. M., Wade, P. A., Wolffe, A. P., and Felsenfeld, G. (2002) Genes Dev. 16, 1540-1554[Abstract/Free Full Text]
  5. Kiekhaefer, C. M., Grass, J. A., Johnson, K. D., Boyer, M. E., and Bresnick, E. H. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, 14309-14314[Abstract/Free Full Text]
  6. Yasui, D., Miyano, M., Cai, S., Varga-Weisz, P., and Kohwi-Shigematsu, T. (2002) Nature 419, 641-645[CrossRef][Medline] [Order article via Infotrieve]
  7. Cai, S., Han, H. J., and Kohwi-Shigematsu, T. (2003) Nat. Genet. 34, 42-51[CrossRef][Medline] [Order article via Infotrieve]
  8. Case, S. S., Huber, P., and Lloyd, J. A. (1999) DNA Cell Biol. 18, 805-817[CrossRef][Medline] [Order article via Infotrieve]
  9. Cunningham, J. M., Purucker, M. E., Jane, S. M., Safer, B., Vanin, E. F., Ney, P. A., Lowrey, C. H., and Nienhuis, A. W. (1994) Blood 84, 1298-1308[Abstract/Free Full Text]
  10. Lachner, M., O'Carroll, D., Rea, S., Mechtler, K., and Jenuwein, T. (2001) Nature 410, 116-120[CrossRef][Medline] [Order article via Infotrieve]
  11. Lehnertz, B., Ueda, Y., Derijck, A. A., Braunschweig, U., Perez-Burgos, L., Kubicek, S., Chen, T., Li, E., Jenuwein, T., and Peters, A. H. (2003) Curr. Biol. 13, 1192-1200[CrossRef][Medline] [Order article via Infotrieve]
  12. David, G., Turner, G. M., Yao, Y., Protopopov, A., and DePinho, R. A. (2003) Genes Dev. 17, 2396-2405[Abstract/Free Full Text]
  13. Huang, S., and Brandt, S. J. (2000) Mol. Cell. Biol. 20, 2248-2259[Abstract/Free Full Text]
  14. Porcher, C., Swat, W., Rockwell, K., Fujiwara, Y., Alt, F. W., and Orkin, S. H. (1996) Cell 86, 47-57[CrossRef][Medline] [Order article via Infotrieve]
  15. Robb, L., Elwood, N. J., Elefanty, A. G., Kontgen, F., Li, R., Barnett, L. D., and Begley, C. G. (1996) EMBO J. 15, 4123-4129[Medline] [Order article via Infotrieve]
  16. Mikkola, H. K., Klintman, J., Yang, H., Hock, H., Schlaeger, T. M., Fujiwara, Y., and Orkin, S. H. (2003) Nature 421, 547-551[CrossRef][Medline] [Order article via Infotrieve]
  17. Hsu, H. L., Huang, L., Tsan, J. T., Funk, W., Wright, W. E., Hu, J. S., Kingston, R. E., and Baer, R. (1994) Mol. Cell. Biol. 14, 1256-1265[Abstract/Free Full Text]
  18. Huang, S., Qiu, Y., Stein, R. W., and Brandt, S. J. (1999) Oncogene 18, 4958-4967[CrossRef][Medline] [Order article via Infotrieve]
  19. Wadman, I. A., Osada, H., Grutz, G. G., Agulnick, A. D., Westphal, H., Forster, A., and Rabbitts, T. H. (1997) EMBO J. 16, 3145-3157[CrossRef][Medline] [Order article via Infotrieve]
  20. Xu, Z., Huang, S., Chang, L. S., Agulnick, A. D., and Brandt, S. J. (2003) Mol. Cell. Biol. 23, 7585-7599[Abstract/Free Full Text]
  21. Lahlil, R., Lecuyer, E., Herblot, S., and Hoang, T. (2004) Mol. Cell. Biol. 24, 1439-1452[Abstract/Free Full Text]
  22. Lecuyer, E., Herblot, S., Saint-Denis, M., Martin, R., Begley, C. G., Porcher, C., Orkin, S. H., and Hoang, T. (2002) Blood 100, 2430-2440[Abstract/Free Full Text]
  23. Porcher, C., Liao, E. C., Fujiwara, Y., Zon, L. I., and Orkin, S. H. (1999) Development (Camb.) 126, 4603-4615[Abstract]
  24. Ravet, E., Reynaud, D., Titeux, M., Izac, B., Fichelson, S., Romeo, P. H., Dubart-Kupperschmitt, A., and Pflumio, F. (2004) Blood 103, 3326-3335[Abstract/Free Full Text]
  25. Anguita, E., Hughes, J., Heyworth, C., Blobel, G. A., Wood, W. G., and Higgs, D. R. (2004) EMBO J. 23, 2841-2852[CrossRef][Medline] [Order article via Infotrieve]
  26. Elnitski, L., Miller, W., and Hardison, R. (1997) J. Biol. Chem. 272, 369-378[Abstract/Free Full Text]
  27. Bender, M. A., Bulger, M., Close, J., and Groudine, M. (2000) Mol. Cell 5, 387-393[CrossRef][Medline] [Order article via Infotrieve]
  28. Cohen-Kaminsky, S., Maouche-Chretien, L., Vitelli, L., Vinit, M. A., Blanchard, I., Yamamoto, M., Peschle, C., and Romeo, P. H. (1998) EMBO J. 17, 5151-5160[CrossRef][Medline] [Order article via Infotrieve]
  29. Deininger, P. L., Jolly, D. J., Rubin, C. M., Friedmann, T., and Schmid, C. W. (1981) J. Mol. Biol. 151, 17-33[CrossRef][Medline] [Order article via Infotrieve]
  30. Cuvier, O., Hart, C. M., and Laemmli, U. K. (1998) Mol. Cell. Biol. 18, 7478-7486[Abstract/Free Full Text]
  31. Pack, S. D., Zbar, B., Pak, E., Ault, D. O., Humphrey, J. S., Pham, T., Hurley, K., Weil, R. J., Park, W. S., Kuzmin, I., Stolle, C., Glenn, G., Liotta, L. A., Lerman, M. I., Klausner, R. D., Linehan, W. M., and Zhuang, Z. (1999) Cancer Res. 59, 5560-5564[Abstract/Free Full Text]
  32. Pinkel, D., Straume, T., and Gray, J. W. (1986) Proc. Natl. Acad. Sci. U. S. A. 83, 2934-2938[Abstract/Free Full Text]
  33. Liu, R., Liu, H., Chen, X., Kirby, M., Brown, P. O., and Zhao, K. (2001) Cell 106, 309-318[CrossRef][Medline] [Order article via Infotrieve]
  34. Kohwi-Shigematsu, T., Maass, K., and Bode, J. (1997) Biochemistry 36, 12005-12010[CrossRef][Medline] [Order article via Infotrieve]
  35. Yu, X., Shacka, J. J., Eells, J. B., Suarez-Quian, C., Przygodzki, R. M., Beleslin-Cokic, B., Lin, C. S., Nikodem, V. M., Hempstead, B., Flanders, K. C., Costantini, F., and Noguchi, C. T. (2002) Development (Camb.) 129, 505-516[Medline] [Order article via Infotrieve]
  36. Litt, M. D., Simpson, M., Recillas-Targa, F., Prioleau, M. N., and Felsenfeld, G. (2001) EMBO J. 20, 2224-2235[CrossRef][Medline] [Order article via Infotrieve]
  37. Hsu, H. L., Wadman, I., Tsan, J. T., and Baer, R. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 5947-5951[Abstract/Free Full Text]
  38. Altschul, S. F., Madden, T. L., Schaffer, A. A., Zhang, J., Zhang, Z., Miller, W., and Lipman, D. J. (1997) Nucleic Acids Res. 25, 3389-3402[Abstract/Free Full Text]
  39. Dickinson, L. A., Joh, T., Kohwi, Y., and Kohwi-Shigematsu, T. (1992) Cell 70, 631-645[CrossRef][Medline] [Order article via Infotrieve]
  40. Gubin, A. N., Njoroge, J. M., Bouffard, G. G., and Miller, J. L. (1999) Genomics 59, 168-177[CrossRef][Medline] [Order article via Infotrieve]
  41. Nielsen, S. J., Schneider, R., Bauer, U. M., Bannister, A. J., Morrison, A., O'Carroll, D., Firestein, R., Cleary, M., Jenuwein, T., Herrera, R. E., and Kouzarides, T. (2001) Nature 412, 561-565[CrossRef][Medline] [Order article via Infotrieve]
  42. Noma, K., Allis, C. D., and Grewal, S. I. (2001) Science 293, 1150-1155[Abstract/Free Full Text]
  43. Cox, P. R., and Zoghbi, H. Y. (2000) Genomics 63, 97-107[CrossRef][Medline] [Order article via Infotrieve]
  44. Fischer, R. S., Quinlan, R. A., and Fowler, V. M. (2003) FEBS Lett. 547, 228-232[CrossRef][Medline] [Order article via Infotrieve]
  45. Almenar-Queralt, A., Lee, A., Conley, C. A., Ribas de Pouplana, L., and Fowler, V. M. (1999) J. Biol. Chem. 274, 28466-28475[Abstract/Free Full Text]
  46. Conley, C. A., Fritz-Six, K. L., Almenar-Queralt, A., and Fowler, V. M. (2001) Genomics 73, 127-139[CrossRef][Medline] [Order article via Infotrieve]
  47. Eissenberg, J. C., and Elgin, S. C. (2000) Curr. Opin. Genet. Dev. 10, 204-210[CrossRef][Medline] [Order article via Infotrieve]
  48. Rea, S., Eisenhaber, F., O'Carroll, D., Strahl, B. D., Sun, Z. W., Schmid, M., Opravil, S., Mechtler, K., Ponting, C. P., Allis, C. D., and Jenuwein, T. (2000) Nature 406, 593-599[CrossRef][Medline] [Order article via Infotrieve]
  49. Saveliev, A., Everett, C., Sharpe, T., Webster, Z., and Festenstein, R. (2003) Nature 422, 909-913[CrossRef][Medline] [Order article via Infotrieve]
  50. Shi, Y., Sawada, J., Sui, G., el Affar, B., Whetstine, J. R., Lan, F., Ogawa, H., Po-Shan Luke, M., and Nakatani, Y. (2003) Nature 422, 735-738[CrossRef][Medline] [Order article via Infotrieve]
  51. Subramanian, T., and Chinnadurai, G. (2003) FEBS Lett. 540, 255-258[CrossRef][Medline] [Order article via Infotrieve]
  52. van der Vlag, J., den Blaauwen, J. L., Sewalt, R. G., van Driel, R., and Otte, A. P. (2000) J. Biol. Chem. 275, 697-704[Abstract/Free Full Text]
  53. Peters, A. H., O'Carroll, D., Scherthan, H., Mechtler, K., Sauer, S., Schofer, C., Weipoltshammer, K., Pagani, M., Lachner, M., Kohlmaier, A., Opravil, S., Doyle, M., Sibilia, M., and Jenuwein, T. (2001) Cell 107, 323-337[CrossRef][Medline] [Order article via Infotrieve]
  54. Tolstonog, G. V., Shoeman, R. L., Traub, U., and Traub, P. (2001) DNA Cell Biol. 20, 509-529[CrossRef][Medline] [Order article via Infotrieve]
  55. Vissel, B., and Choo, K. H. (1989) Genomics 5, 407-414[CrossRef][Medline] [Order article via Infotrieve]
  56. Gasser, S. M. (2001) Cell 104, 639-642[CrossRef][Medline] [Order article via Infotrieve]
  57. Francastel, C., Walters, M. C., Groudine, M., and Martin, D. I. (1999) Cell 99, 259-269[CrossRef][Medline] [Order article via Infotrieve]
  58. Brown, K. E., Amoils, S., Horn, J. M., Buckle, V. J., Higgs, D. R., Merkenschlager, M., and Fisher, A. G. (2001) Nat. Cell Biol. 3, 602-606[CrossRef][Medline] [Order article via Infotrieve]
  59. Brown, K. E., Guest, S. S., Smale, S. T., Hahm, K., Merkenschlager, M., and Fisher, A. G. (1997) Cell 91, 845-854[CrossRef][Medline] [Order article via Infotrieve]
  60. Cobb, B. S., Morales-Alcelay, S., Kleiger, G., Brown, K. E., Fisher, A. G., and Smale, S. T. (2000) Genes Dev. 14, 2146-2160[Abstract/Free Full Text]
  61. Alcobia, I., Dilao, R., and Parreira, L. (2000) Blood 95, 1608-1615[Abstract/Free Full Text]
  62. Yoon, H. G., Choi, Y., Cole, P. A., and Wong, J. (2005) Mol. Cell. Biol. 25, 324-335[Abstract/Free Full Text]
  63. de Belle, I., Cai, S., and Kohwi-Shigematsu, T. (1998) J. Cell Biol. 141, 335-348[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 IOVSHome page
R. Zaccarini, F. P. Cordelieres, P. Martin, and S. Saule
PAX6 P46 Binds Chromosomes in the Pericentromeric Region and Induces a Mitosis Defect When Overexpressed
Invest. Ophthalmol. Vis. Sci., December 1, 2007; 48(12): 5408 - 5419.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
J. M. Salmon, N. J. Slater, M. A. Hall, M. P. McCormack, S. L. Nutt, S. M. Jane, and D. J. Curtis
Aberrant mast-cell differentiation in mice lacking the stem-cell leukemia gene
Blood, November 15, 2007; 110(10): 3573 - 3581.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
A. H. Schuh, A. J. Tipping, A. J. Clark, I. Hamlett, B. Guyot, F. J. Iborra, P. Rodriguez, J. Strouboulis, T. Enver, P. Vyas, et al.
ETO-2 Associates with SCL in Erythroid Cells and Megakaryocytes and Provides Repressor Functions in Erythropoiesis
Mol. Cell. Biol., December 1, 2005; 25(23): 10235 - 10250.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
280/13/12956    most recent
M412721200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wen, J.
Right arrow Articles by Noguchi, C. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wen, J.
Right arrow Articles by Noguchi, C. T.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2005 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement