JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M409987200 on January 13, 2005

J. Biol. Chem., Vol. 280, Issue 14, 14240-14251, April 8, 2005
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
280/14/14240    most recent
M409987200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bracken, C. P.
Right arrow Articles by Peet, D. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bracken, C. P.
Right arrow Articles by Peet, D. J.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Activity of Hypoxia-inducible Factor 2{alpha} Is Regulated by Association with the NF-{kappa}B Essential Modulator*

Cameron P. Bracken, Murray L. Whitelaw, and Daniel J. Peet{ddagger}

From the School of Molecular and Biomedical Science and the Centre for the Molecular Genetics of Development, University of Adelaide, Adelaide, South Australia, 5005, Australia

Received for publication, August 31, 2004 , and in revised form, January 11, 2005.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The hypoxia-inducible factors 1{alpha} (HIF-1{alpha}) and 2{alpha} (HIF-2{alpha}) are key regulators of the transcriptional response to low oxygen and are closely related in domain architecture, DNA binding, and activation mechanisms. Despite these similarities, targeted disruption of the HIF-{alpha} genes in mice results in distinctly different phenotypes demonstrating nonredundancy of function, although the underlying mechanisms remain unclear. Here we report on the novel and specific interaction of HIF-2{alpha}, but not HIF-1{alpha}, with the NF-{kappa}B essential modulator (NEMO) using immunoprecipitation, mammalian two-hybrid, and in vitro protein interaction assays. Reporter gene assays demonstrate that this interaction specifically enhances normoxic HIF-2{alpha} transcriptional activity, independently of the HIF-2{alpha} transactivation domain, consistent with a model by which NEMO aids CBP/p300 recruitment to HIF-2{alpha}. In contrast, HIF-2{alpha} overexpression does not alter NF-{kappa}B signaling, suggesting that the functional consequence of the HIF-2{alpha}/NEMO interaction is limited to the HIF pathway. The specificity of NEMO for HIF-2{alpha} represents one of the few known differential protein-protein interactions between the HIF-{alpha} proteins, which has important implications for the activity of HIF-2{alpha} and is also the first postulated NF-{kappa}B-independent role for NEMO.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Aerobic organisms are critically dependent upon the supply of oxygen for fundamental processes such as energy production. Consequently, oxygen deprivation represents a serious cellular stress, which is a major modulator of gene expression. Central to this response in both adult and embryonic organisms are the hypoxia-inducible transcription factors, HIF-1{alpha}1 and HIF-2{alpha}, members of the basic helix-loop-helix/Per-Arnt-Sim transcription factor family.

Under normoxic conditions, the HIF-{alpha} proteins are rapidly degraded and transcriptionally repressed. During hypoxia, stabilized HIF-{alpha} proteins migrate into the nucleus and heterodimerize with the obligate basic helix-loop-helix/Per-Arnt-Sim partner protein, the aryl hydrocarbon nuclear translocator ARNT (also called HIF-1{beta}). The heterodimer then binds hypoxic response elements (HREs) within the regulatory regions of a variety of target genes to up-regulate their expression (1). These genes typically function to both increase oxygen supply to tissues and facilitate metabolic adaptation to hypoxia.

HIF-1{alpha} and HIF-2{alpha} possess 48% amino acid sequence similarity, overlapping expression patterns, and a common requirement for ARNT to bind DNA and up-regulate expression of a largely shared group of target genes. In addition, the activity of both proteins is controlled through hydroxylation of key proline and asparagine residues in the conserved oxygen-dependent degradation domain and transactivation domain (TAD), respectively, regulating protein stability and transactivation potential (2–4). However, despite these similarities, HIF-1{alpha}- and HIF-2{alpha}-deficient mice manifest distinct phenotypes and hence have nonredundant functions. HIF-1{alpha}-deficient mice display defective vasculature and mesenchymal cell death (5, 6). In contrast, HIF-2{alpha}-deficient mice are reported to manifest defective vascular remodelling (7) or decreased catecholamine (8), lung surfactant (9), or hematopoietic cell production (10). Most recently, HIF-2{alpha}-deficient mice have been reported to exhibit a multiple organ pathology, consistent with mitochondrial disease (11). Concomitant with these phenotypes, there is a growing body of evidence demonstrating different responses between the HIF-{alpha} proteins in relation to cellular localization, hypoxic responsiveness, and target gene expression (12–14). Despite this information, however, little is known of the mechanisms underlying these functional differences.

In an effort to further understand differential HIF-{alpha} regulation, a yeast two-hybrid screen was performed using as bait a C-terminal portion of HIF-2{alpha}, which represents the region of greatest sequence divergence between the HIF-{alpha} proteins (mHIF-2{alpha} residues 565–820). The NF-{kappa}B essential modulator (NEMO, also called IKK-{gamma} and IKK complex-associated protein-1) was identified as a HIF-2{alpha}-interacting protein. Mammalian two-hybrid, GST pull-down, and co-immunoprecipitation assays demonstrated that the interaction of NEMO is specific for HIF-2{alpha} and not HIF-1{alpha}. Furthermore, we demonstrate that this physical interaction has a functional effect, specifically increasing the normoxic activity of HIF-2{alpha}, but not HIF-1{alpha}, in a dose-dependent manner, consistent with a model by which NEMO aids CBP/p300 recruitment to HIF-2{alpha}.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Plasmid Construction—HRE-luciferase (15), 5xGalRE-luciferase (16), and the control Renilla luciferase (RLTK-luciferase; Promega) reporter plasmids have been described previously, as have pEF-hHIF-1{alpha}-IRES-puro and pEF-mHIF2{alpha}-IRES-puro (4). Key experiments were repeated with human HIF-2{alpha}, excised AseI/XbaI from HIF2{alpha}-pcDNA3 (Dr. R. Bruick, University of Texas), and cloned into pEF-IRES-puro by NdeI/SpeI. 4xNF{kappa}B RE-luciferase was a gift from Dr. A. Bert (Institute for Medical and Veterinary Science, Adelaide, Australia). mHIF-2{alpha}(565–820)-pDBLeu, used for yeast two-hybrid screening, was generated by inserting a HIF-2{alpha} PCR product into pDBLeu (Invitrogen) by SpeI/NotI. hHIF-1{alpha}(597–775) and mHIF-2{alpha}(565–820) were cloned into pET-32a (Novagen) for in vitro translation by NcoI/NotI digestion of a HIF-1{alpha} PCR product or HIF2{alpha}-pDBLeu, respectively, into similarly digested pET-32a. hHIF-1{alpha}(597–775) and hHIF-1{alpha}(597–824) PCR products and mHIF-2{alpha}(565–820)-pDBLeu and mHIF-2{alpha}(565–870)-pD-BLeu were cut with NheI/NotI and inserted into similarly digested pEF-bos-GalDBD. pEF-hHIF-1{alpha} (597–775)-GalDBD-bos was digested NdeI/NotI for cloning of this HIF-1{alpha} insert into similarly digested pEF-bos-VP16. mHIF-2{alpha}(565–820) was fused with VP16 by SpeI/NotI HIF-2{alpha} excision from pDBLeu and insertion into NheI/NotI-digested pEF-bos-VP16. NEMO was cloned into the pEF-6Myc-bos and pEF-GalDBD-bos expression vectors by SalI/NotI from pPC86 (Invitrogen cDNA library). To generate pEF-6Myc-bos, a 6-Myc tag was amplified by PCR and cloned KpnI/SalI into pEF-bos (17). NEMO N- and C-terminal deletion mutants and NEMO(1–358) were PCR-amplified and cloned into pEF-bos-GalDBD and pEF-GST-IRES-puro, respectively, by NdeI/NotI digestion. pEF-GST-IRES-puro itself was generated by the XhoI/MluI insertion of GST from pGEX-3T (Amersham Biosciences) into pEF-IRES-puro. NEMO was cloned in the reverse direction to generate an antisense construct by SalI/XbaI digestion of pEF-bos-6Myc-NEMO and NheI/XhoI of pEF-IRES-puro (18). NRP (Johan Peranen, University of Helsinki) was amplified by PCR and ligated into pEF-bos-GalDBD by SalI/NotI. The p300-VP16 expression vector was a gift from George Muscat (University of Queensland). pEF-bos-VP16 and pEF-bos-GalDBD plasmids were generated by inserting the oligonucleotide TCGAGAGCCCCACCCCGGGTACCGACTGGAATCATGCTAGCGGATCCGCGGCCGCTAAGTAAGT into SalI/XbaI-digested GalO and pNL-VP16, then excising the multiple cloning site and either VP16-AD or GalDBD with BglII/XbaI, and inserting into BamHI/XbaI-digested pEF-bos (17).

Yeast Two-hybrid Screening—Yeast two-hybrid screening of 1.5 x 106 transformants from a E10.5 whole mouse cDNA library (Invitrogen) was performed using the Proquest Matchmaker two-hybrid system (Invitrogen). Initial selection was performed on -Leu/-Trp/-His + 30 mM 3-aminotriazole plates, prior to more stringent analysis with the two additional reporters.

Cell Culture and Reporter Assays—HEK 293T and Jurkat cells were routinely grown at 37°C, 5% CO2 in Dulbecco's modified Eagle's medium (Invitrogen) or RPMI (Invitrogen), respectively, supplemented with 10% fetal calf serum. Transient transfections into 40–60% confluent 293Ts or 2 x 105 Jurkat cells/well (24 well tray format) were performed using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions. The amounts of DNA transfected are given within the figure legends. The total amount of DNA transfected into each well was normalized with the addition of appropriate empty vector (pEF-IRES-puro or pEF-BOS). Luciferase activity was determined using the dual luciferase reagent assay system (Promega) according to the manufacturer's instructions, using RLTK-luciferase as a transfection control.

GST Pull-downs, Co-immunoprecipitation, and Western Blotting— Preparation of whole cell extracts were performed as previously described (19). 35S-labeled proteins were generated using the TNT-coupled reticulocyte lysate system (Promega) as per the manufacturer's instruction. In pull-down assays, 200 µg of total protein (whole cell extracts) was incubated with 50 µl of 50% glutathione-agarose (Scientifix) and bound at 4°C for 1 h in 0.5 ml of phosphate-buffered saline with 1 mM phenylmethylsulfonyl fluoride. Resin was washed three times with phosphate-buffered saline with centrifuging after each wash (1,000 rpm/1 min/4°C) and eluted by boiling in 2x SDS sample buffer. {alpha}-ARNT immunoprecipitation (see Fig. 2C) was performed as previously described, using 250 µg of total protein and an anti-ARNT polyclonal rabbit serum raised against residues 1–140 of human ARNT (20). {alpha}-NEMO immunoprecipitation (see Fig. 2D) was performed as above, using 400 µg of hypotonic extract, prepared by suspension in hypotonic extract buffer (10 mM Tris, pH 8, 1.5 mM MgCl2, 10 mM NaCl, 10% glycerol, 1x protease inhibitor mixture, 1 mM dithiothreitol, 1 mM phenylmethylsulfonyl fluoride), freezing at -80°C, thawing on ice and incubation with 420 mM NaCl (30 min/4°C), and centrifugation to obtain solubilized protein. Western blots were performed by separating proteins by SDS-PAGE, transferring to nitrocellulose, and detecting using {alpha}-Myc 9E10 mouse monoclonal, {alpha}-GalDBD (Santa Cruz), {alpha}-NEMO (Santa Cruz), or a rabbit {alpha}-HIF-2{alpha} (inoculated with HIF-2{alpha}(565–820)) polyclonal serum and visualized by horseradish peroxidase-conjugated secondary antibodies (DAKO) or a protein-A horseradish peroxidase conjugate (ICN) for NEMO immunoprecipitation.



View larger version (26K):
[in this window]
[in a new window]
  		FIG. 2.
NEMO and HIF-2{alpha} expressed in 293T cells interact by GST-pull-down and co-immunoprecipitation assays. A, plasmids encoding NEMO-Myc and GST-HIF-2{alpha} (565–820) were transiently transfected (300 ng) into 293T cells, and whole cell extracts were prepared and incubated with glutathione-agarose. After washing, the bound proteins were eluted and separated by SDS-PAGE (10% gel), transferred to a nitrocellulose membrane, and Western blotted with {alpha}-Myc antibodies (upper right panel) or {alpha}-HIF-2{alpha} antibodies (bottom panel). The upper left panel represents an {alpha}-Myc Western blot of 30 ng of whole cell extract. Myc mouse adiponectin receptor-1 was used as a control (ctrl myc). B, in vitro translated [35S]Met-labeled HIF-{alpha} protein was incubated with whole cell extract from 293T cells transiently transfected with GST-NEMO(1–358) (300 ng) and incubated with glutathione-agarose. After washing, the bound proteins were eluted, separated by SDS-PAGE (10% gel), and visualized by autoradiography (middle panel). The right panel represents a longer exposure of the HIF-1{alpha} pull-down lanes. The left panel represents 10% input. C, plasmids encoding full-length ARNT, Myc-NEMO, and Myc-HIF{alpha} were transiently transfected (600 ng) in 293T cells, and whole cell extracts were prepared. The proteins were immunoprecipitated using an {alpha}-ARNT antibody (or preimmune control), washed, eluted, separated by SDS-PAGE, and Western blotted with {alpha}-Myc (middle panel) or {alpha}-ARNT antibodies (lower panel). The upper panel represents an {alpha}-Myc Western blot of 30 ng of whole cell extract. D, HepG2 cells were untreated or treated with dipyridyl (5 h), prior to making hypotonic extracts and immunoprecipitating (IP) with {alpha}-NEMO or {alpha}-GalDBD antibodies. The bound proteins were then washed, eluted, separated by SDS-PAGE, and Western blotted with {alpha}-HIF-2{alpha} (upper panel) or {alpha}-NEMO (lower panel) antibodies. The hypotonic extract lanes (lanes 1 and 4) represent 5% input.

 

   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Identification of NEMO as a HIF-2{alpha}-interacting Protein—To identify novel HIF-2{alpha}-interacting proteins, amino acids 565–820 of mouse HIF-2{alpha} fused to the Gal4 DNA-binding domain (Gal4DBD) were used as bait in a yeast two-hybrid screen of a mouse E10.5 cDNA library. This region of HIF-2{alpha} represents the area of greatest amino acid sequence divergence between the HIF-{alpha} proteins (Fig. 1A). The screening of 1.5 x 106 separate transformants yielded 33 clones positive for each of the Ura, LacZ, and His reporter genes. Among these, full-length NEMO was identified as a candidate-interacting protein.



View larger version (22K):
[in this window]
[in a new window]
  		FIG. 1.
NEMO, but not NEMO-related protein, specifically interacts with HIF-2{alpha} in mammalian cells. A, schematic representation of the HIF-{alpha} proteins showing basic helix-loop-helix (bHLH), Per-Arnt-Sim homology (PAS), oxygen-dependent degradation (ODDD), and N- and C-terminal transactivation domains (N-TAD and C-TAD). The percentages of amino acid similarities between corresponding domains are indicated, as is the HIF-2{alpha} region used as bait in the yeast two-hybrid screening. B and C, 293T cells were transiently transfected with a Gal4 response element-driven reporter (5xGalRE-luciferase, 150 ng), pEF-bos expression vectors (100 ng), and the RLTK-luciferase internal control plasmid (10 ng), to which luciferase activity was normalized. 10 h post-transfection, the cells were exposed to hypoxia (<1% O2) or retained at normoxia for an additional 14 h. The results, shown in fold induction over GalDBD alone, are in triplicate ± S.D. and representative of three independent experiments.

 
NEMO is required for NF-{kappa}B activation by virtually all known stimuli, acting as a nonenzymatic molecular scaffold to assemble the IKK complex containing both IKK-{alpha} and IKK-{beta} kinases (21–28). This complex is then able to phosphorylate and initiate the ubiquitylation and degradation of the inhibitory I{kappa}B proteins in response to NF-{kappa}B-activating stimuli. It is postulated NEMO may have additional scaffolding roles, binding upstream NF-{kappa}B activators and recruiting them to the IKK complex.

To confirm the HIF-2{alpha}/NEMO interaction in a mammalian system, two-hybrid assays were performed in HEK 293T cells after switching the identity of the fusion partners relative to the yeast system (Fig. 1B). Results demonstrate both HIF-2{alpha}(565–820)-VP16 and full-length HIF-2{alpha} interact with Gal4DBD-NEMO under normoxic and hypoxic conditions. Strikingly, mammalian two-hybrid assays indicate that NEMO does not interact with the corresponding region of HIF-1{alpha}(597–775) and interacts only very weakly with full-length protein.

NRP, or FIP2, is a Golgi-associated, cytokine-inducible protein with 53% amino acid similarity to NEMO (29, 30). To confirm the specificity of the NEMO/HIF-2{alpha} interaction, NRP-GalDBD fusions were also analyzed by mammalian two-hybrid assay. The results demonstrate that the interaction between HIF-2{alpha} and NEMO is specific because NRP does not interact with HIF-2{alpha} (Fig. 1C).

The interaction of HIF-2{alpha} and NEMO within cells was confirmed using GST pull-down experiments with protein extracts from cells expressing Myc-tagged NEMO and HIF-2{alpha}-GST fusion proteins. Using glutathione-agarose, HIF-2{alpha} (565–820)-GST, but not GST itself, effectively pulled down full-length Myc-tagged NEMO (Fig. 2A, upper right panel). An unrelated Myc-tagged protein, mouse adiponectin receptor 1, was included as a control and was not pulled down by either HIF-2{alpha}(565–820)-GST or GST alone. The specific pull-down of NEMO-Myc, but not adiponectin receptor-Myc, by HIF-2{alpha}(565–820)-GST is not due to differences in expression levels of Myc-tagged proteins (Fig. 2A, upper left panel) or the level of HIF-2{alpha}-GST bound to glutathione-agarose between samples (Fig. 2A, bottom panel).

To further characterize this interaction, pull-down experiments were performed using in vitro transcribed/translated HIF-{alpha} protein and mammalian cell extracts containing GST-NEMO. As anticipated, HIF-2{alpha}(565–820) was pulled down strongly by NEMO(1–358)-GST relative to GST alone, whereas NEMO(1–358)-GST did not efficiently pull-down the equivalent region of HIF-1{alpha} (Fig. 2B, middle panel). In this experiment, HIF-1{alpha} was translated less efficiently than HIF-2{alpha}; however, an overexposure of the autoradiogram demonstrates that the very low levels of HIF-1{alpha} pulled down by GST is nonspecific and not enhanced by NEMO (Fig. 2B, right panel). Furthermore, in multiple other experiments with varying levels of in vitro transcribed and translated HIF-1{alpha}, only very low levels of nonspecific binding were ever observed. This parallels Fig. 1 in that NEMO specifically associates with HIF-2{alpha} but not HIF-1{alpha}.

ARNT immunoprecipitation was also able to co-precipitate full-length Myc-tagged NEMO when co-transfected with HIF-2{alpha} but not HIF-1{alpha} (Fig. 2C). This not only provides further evidence for the interaction of NEMO and HIF-2{alpha} in vivo but also suggests the possibility of NEMO being present within transcriptionally active HIF-2{alpha}/ARNT heterodimeric complexes. Significantly, the overexpression of NEMO did not significantly affect the ability of ARNT to immunoprecipitate HIF-{alpha}.

Finally, these experiments were all performed using overexpressed proteins. Therefore, it was critical to demonstrate the interaction between endogenous HIF-2{alpha} and NEMO. Because normoxic HIF-2{alpha} was not detectable in any cell line tested, includingmouseembryonicfibroblasts(12),weutilizeddipyridyl-treated HepG2 cells, which expressed considerable amounts of HIF-2{alpha} protein. The mammalian two-hybrid assays have previously demonstrated that the HIF-2{alpha}/NEMO interaction can occur equally well in hypoxic or normoxic conditions (Fig. 1B). Immunoprecipitation experiments using {alpha}-NEMO antibodies clearly show that endogenous HIF-2{alpha} co-immunoprecipitates with endogenous NEMO, and this is specific because the use of a nonspecific antibody has no effect (Fig. 2D). In this experiment, immunoprecipitated NEMO and HIF-2{alpha} ran slightly higher in size to that observed in protein extracts, presumably because of the abundance of protein within immunoprecipitated samples. In conjunction with Fig. 1, these results indicate that in both yeast and mammalian cells, NEMO physically interacts with HIF-2{alpha} but not HIF-1{alpha}.

Defining a Minimal HIF-2{alpha}-binding Site on NEMO—Based upon the predicted domain architecture of NEMO from its primary amino acid sequence (Fig. 3A), a series of N- and C-terminal NEMO deletion mutants were fused to the Gal4 DNA-binding domain and analyzed for HIF-2{alpha} interaction via mammalian two-hybrid assays. Full interaction was maintained with removal of both the N-terminal 49 amino acids of NEMO and the C-terminal zinc finger domain (Fig. 3B, deletion mutant 50–358). Further deletion at either end resulted in a dramatic loss of HIF-2{alpha} binding. Western analysis confirmed that the loss of reporter activity was not a result of decreased protein expression, because Gal4DBD-NEMO deletions (for example amino acids 1–302 and 196–358), which bind HIF-2{alpha} poorly, expressed better than the 1–358 and 50–358 constructs that bind HIF-2{alpha} with the same affinity as full-length NEMO (Fig. 3C). These data demonstrate that amino acids 50–358 of NEMO are required for high affinity interaction with amino acids 565–820 of HIF-2{alpha}.



View larger version (28K):
[in this window]
[in a new window]
  		FIG. 3.
HIF-2{alpha}(565–820) interacts with NEMO(50–358). A, schematic representation of the NEMO protein with predicted coiled coil (CC), leucine zipper (LZ), and zinc finger (ZnF) domains. The numbers indicate amino acids for mouse NEMO. B, 293T cells were transiently transfected with 5xGalRE-luciferase (150 ng), expression vectors (100 ng), and the RLTK-luciferase internal control plasmid (10 ng) to which luciferase was normalized. 10 h post-transfection cells were either exposed to hypoxia (<1% O2) or retained at normoxia, for an additional 14 h. The results are given in triplicate ± S.D. and representative of three independent experiments. C, whole cell extracts of 293T cells transiently transfected with GalDBD-NEMO deletion mutants (100 ng) were separated by SDS-PAGE (10% gel), transferred to nitrocellulose, and Western blotted with {alpha}-Gal antibodies.

 
NEMO Dose-dependently Increases HIF-2{alpha} Activity—To characterize the functional effect of the HIF-2{alpha}/NEMO interaction, NEMO was overexpressed in HEK 293T cells co-transfected with a HRE luciferase reporter gene together with either HIF-2{alpha} or HIF-1{alpha} (Fig. 4A). HIF-{alpha} overexpression increased HRE activity at normoxia, presumably through titration of inhibitory hydroxylases. NEMO overexpression dose-dependently increased normoxic HIF-2{alpha}-dependent reporter gene activity but had no significant effect with HIF-1{alpha}. At the highest levels of NEMO, HIF-2{alpha}-driven reporter expression increased to a maximum of ~3-fold. As a result of either a nonspecific NEMO overexpression effect or the potential weak interaction between NEMO and full-length HIF-1{alpha}, transfection of highest NEMO levels also resulted in a small increase in HIF-1{alpha}-dependent reporter activity. Hypoxia, a major stimulus of HIF-{alpha} activation, dramatically increased reporter activity, overriding the positive influence of NEMO at the lower HIF-2{alpha} levels in normoxia (Fig. 4A). NEMO expression similarly increased normoxic HIF-2{alpha}, but not HIF-1{alpha}, reporter activity in Jurkat cells in a dose-dependent manner, demonstrating that this effect is not specific for 293T cells (Fig. 4B).



View larger version (28K):
[in this window]
[in a new window]
  		FIG. 4.
NEMO specifically increases HIF-2{alpha} activity at normoxia. 293T cells (A) or Jurkat cells (B) were transiently co-transfected with a 4xHRE-luciferase reporter gene (10 ng) and expression plasmids, or corresponding empty vector, for HIF-{alpha} (10 ng) and NEMO (0–400 ng as indicated), together with the RLTK-luciferase internal control (10 ng). 293T cells were incubated at normoxia (16 h) or normoxia followed by hypoxia (both for 8 h), whereas Jurkat cells were maintained at normoxia for 12 h prior to lysis. The results are given in triplicate ± S.D. and representative of three experiments. C, 293T cells were transfected with 200 ng of GalDBD expression vectors and HRE-luciferase, RLTK-luciferase, and HIF-{alpha} vectors as detailed above. Luciferase activity was determined 14 h post-transfection.

 
To support the notion that the effect of NEMO overexpression on HIF-2{alpha} activity is a result of physical interaction, Gal4DBD-tagged NEMO deletion mutants were also assayed for their affect on HRE-driven reporter activity (Fig. 4C). In agreement with data in Fig. 3B, GalDBD-NEMO deletion mutants capable of HIF-2{alpha} binding up-regulated HIF-2{alpha} activity to similar extents, whereas an interaction-deficient NEMO deletion mutant (GalDBD-NEMO 1–302) did not significantly alter HIF-2{alpha} activity. As anticipated, none of the NEMO constructs had a significant affect on HIF-1{alpha} activation. Taken together, these data demonstrate that NEMO is specifically able to up-regulate HIF-2{alpha} transcriptional activity on a HRE-driven reporter gene in a cellular context and that this is dependent upon its high affinity interaction with HIF-2{alpha}.

HIF-2{alpha} Does Not Affect NF-{kappa}B Activation—Because NEMO is essential for NF-{kappa}B activation in response to virtually all known stimuli (21, 23), we assessed the effect of transient overexpression of HIF-{alpha} on a NF-{kappa}B-responsive reporter gene. In both 293T (Fig. 5A) and Jurkat (Fig. 5B) cells, expression of neither HIF-1{alpha} nor HIF-2{alpha} significantly changed NF-{kappa}B reporter activity under these assay conditions. Similarly, HIF-{alpha} expression did not have a major effect on NF-{kappa}B activation by the known inducers tumor necrosis factor {alpha} or phorbol 12-myristate 13-acetate in 293T cells (Fig. 5C).



View larger version (19K):
[in this window]
[in a new window]
  		FIG. 5.
HIF-{alpha} does not affect NF-{kappa}B reporter activity. 293T cells (A) or Jurkat cells (B) were transiently co-transfected with a luciferase reporter gene controlled by four NF-{kappa}B response elements (4xNRE-luciferase, 100 ng) and expression plasmids for HIF-1{alpha} or HIF-2{alpha} (as indicated), together with RLTK-luciferase internal control (10 ng). The cells were maintained at normoxia for 18 h, and the results are given in triplicate ± S.D. and representative of three independent experiments. C, 293T cells were transfected with 4xNRE-luciferase (100 ng), HIF-{alpha} expression plasmid (200 ng), and RLTK-luciferase internal control (10 ng). 14 h post-transfection, the cells were treated with tumor necrosis factor {alpha} (20 ng/ml) or phorbol 12-myristate 13-acetate (10 ng/ml) and assayed for luciferase activity 8 h later.

 
Endogenous NEMO Increases HIF-2{alpha} Activity—To investigate the influence of endogenous NEMO on HIF-2{alpha} activity, the cDNA for NEMO was subcloned into an expression vector in the reverse orientation to produce an antisense transcript, enabling down-regulation of cellular NEMO levels in 293T cells. As expected, expression of antisense NEMO resulted in the decreased activity of a HRE reporter gene driven by HIF-2{alpha} but not HIF-1{alpha} (Fig. 6A). The reduction in HIF-2{alpha} activity, although significant, was not complete. This is likely attributable to the incomplete knockdown of NEMO expression, as shown with co-expression of the antisense transcript with trace amounts of Myc-tagged NEMO (Fig. 6B), or factors other than solely NEMO being responsible for the higher intrinsic activity of HIF-2{alpha}, compared with HIF-1{alpha}, on a HRE reporter. For example, differential activity of the N-terminal TAD. In addition to NEMO overexpression in Fig. 4, these data implicate endogenous NEMO in the regulation of the normoxic activity of HIF-2{alpha}.



View larger version (18K):
[in this window]
[in a new window]
  		FIG. 6.
Antisense NEMO specifically reduces normoxic HIF-2{alpha} activity. A, 293T cells were transiently co-transfected with a 4xHRE-luciferase reporter (10 ng), RLTK-luciferase internal control (10 ng), HIF-{alpha} expression (10 ng), and antisense NEMO (or control) vectors (500 ng). Luciferase activity was assayed 24 h post-transfection, and the results are presented in triplicate ± S.D. and representative of three independent experiments. B, 293T cells were transiently co-transfected with Myc-tagged NEMO (5 ng) and antisense NEMO or the empty vectors as controls. 18 h post-transfection, the whole cell extracts were separated by SDS-PAGE (10% gel), transferred to nitrocellulose, and Western blotted with an {alpha}-Myc antibody.

 
NEMO Regulation Is Not Dependent upon ARNT Heterodimerization, the HIF-2{alpha} C-TAD, or Protein Stability—Because the C-TAD of HIF-2{alpha} is hypoxically regulated, crucial to HIF-2{alpha} activity, and adjacent to the NEMO-interacting region, we investigated whether the C-TAD is required for the ability of NEMO to up-regulate HIF-2{alpha} activity. The minimal NEMO-interacting region of HIF-2{alpha} (565–820), or a larger region including the C-TAD (565–874), were fused to the Gal4 DNA-binding domain, as were the corresponding regions of HIF-1{alpha}. These constructs were transfected into 293T cells in the presence or absence of NEMO and analyzed for transcriptional activity on a Gal4-responsive reporter gene. NEMO expression specifically increased the activity of both HIF-2{alpha} constructs by similar amounts (~2-fold), although total reporter activity mediated by HIF-2{alpha} 565–820 is greatly reduced because of the absence of an endogenous transactivation domain (Fig. 7A). Thus, up-regulation of HIF-2{alpha} activity by NEMO is not dependent upon the HIF-2{alpha} C-TAD. Consistent with previous data, NEMO had no effect on HIF-1{alpha} constructs, regardless of C-TAD presence or absence. Western analysis of whole cell lysates from the same transfected cells demonstrated that the up-regulation of HIF-2{alpha} activity by NEMO is not attributable to changes in HIF-2{alpha} protein levels, because no significant difference was observed with NEMO overexpression (Fig. 7B). Thus, NEMO/HIF-2{alpha} interaction does not appear to regulate HIF-2{alpha} activity by altering protein stability. This is supported by pulse-chase experiments indicating that NEMO does not specifically increase HIF-2{alpha} stability compared with HIF-1{alpha} (data not shown). Therefore, NEMO appears to specifically increase the transcriptional activity of the HIF-2{alpha} C terminus in a protein stability and C-TAD-independent manner.



View larger version (21K):
[in this window]
[in a new window]
  		FIG. 7.
NEMO specifically up-regulates activity of the HIF-2{alpha} C terminus in a C-TAD independent manner. A, 293T cells were transiently co-transfected with 5xGalRE-luciferase (150 ng), RLTK-luciferase internal control (10 ng), GalDBD-HIF{alpha} (10 ng), and NEMO-Myc expression (or empty) vectors (400 ng). The cells were maintained at normoxia for 14 h prior to analysis, and the results are presented in triplicate ± S.D. and representative of three independent experiments. B, samples of the lysates from A were separated by SDS-PAGE (10% gel), transferred to a nitrocellulose membrane, and Western blotted using {alpha}-GalDBD antibodies.

 
Another possible mechanism of NEMO action is increasing HIF-2{alpha}/ARNT heterodimerization. Co-immunoprecipitation experiments, however, demonstrate that the ability of HIF-2{alpha} to heterodimerize with ARNT is not affected by NEMO overexpression (Fig. 2C).

NEMO Increases HIF-2{alpha} Activity via p300 Recruitment— NEMO is predominantly localized in the cytoplasm (Ref. 24 and data not shown). However, recent data has indicated a potential nuclear role. Genotoxic stress has been found to direct the sumoylation of a non-IKK-associated portion of NEMO, resulting in nuclear accumulation (31), whereas tumor necrosis factor {alpha} has been shown to induce recruitment of NEMO to the I{kappa}B{alpha} promoter (32). Furthermore, NEMO is reported to shuttle between the nucleus and cytoplasm and compete with IKK{alpha} and p65 for CBP binding (33).

Because CBP/p300 is recruited to the HIF-{alpha} C-TAD for transcriptional activation under hypoxia (4, 34–42) and is also capable of binding NEMO (33), we hypothesized the C-TAD-independent association of CBP/p300 with HIF-2{alpha} via NEMO at normoxia as a potential mechanism by which NEMO specifically up-regulates HIF-2{alpha} activity. To test this hypothesis, HIF-2{alpha}(565–820) and HIF-1{alpha}(597–775)-GalDBD fusion proteins, which lack the endogenous transactivation domains and hence would not be expected to independently bind p300, were expressed with NEMO-Myc and full-length p300-VP16 (Fig. 8A). Expression of NEMO-Myc or p300 alone increased HIF-2{alpha} but not HIF-1{alpha}, reporter activity. However, co-expression of NEMO and p300 with HIF-2{alpha}-GalDBD led to a striking and specific increase in reporter activation that was more than the additive for the expression of NEMO or p300 individually, demonstrating synergistic activity.



View larger version (21K):
[in this window]
[in a new window]
  		FIG. 8.
NEMO increases HIF-2{alpha} activity via p300 recruitment. 293T cells were transiently co-transfected with HIF-{alpha} (10 ng), NEMO-Myc and p300-VP16 (400 ng) expression plasmids, RLTK-luciferase internal control (10 ng), and either 5xGalRE-luciferase (150 ng) (in A) or 4xHRE-luciferase (10 ng) reporter genes (in B). The cells were maintained at normoxia for 14 h prior to analysis, and the results are presented in triplicate ± S.D. and representative of three independent experiments.

 
To confirm this mechanism with full-length, untagged HIF-{alpha} protein, HRE reporter gene activity was analyzed with NEMO and p300 co-expression at normoxia (Fig. 8B). As anticipated, the expression of NEMO or p300 with HIF-2{alpha}, but not HIF-1{alpha}, yielded a 2-fold increase in reporter activity, which was dramatically increased upon NEMO and p300 co-expression. Similar co-expression with HIF-1{alpha} gave a far smaller increase in activity, consistent with the small increase observed in the absence of additional HIF-{alpha}. This is at least partially attributable to a small HIF-independent effect of NEMO and p300 overexpression on reporter activity because increases were seen with the coexpression of NEMO and p300 on both HRE (Fig. 8B) and GalRE (Fig. 8A) reporter constructs. Similar results were also seen with CBP overexpression (data not shown).

These data indicate that NEMO and CBP/p300 act synergistically to increase HIF-2{alpha}, but not HIF-1{alpha}, activity, suggesting a model by which NEMO facilitates CBP/p300 recruitment to HIF-2{alpha}. Such a model is further supported by data in Fig. 2C, demonstrating the co-immunoprecipitation of NEMO by {alpha}-ARNT antibodies, suggesting that NEMO is present in transcriptionally active HIF-2{alpha}/ARNT heterodimeric complexes. This is consistent with previously published data showing that NEMO can shuttle between the nucleus and cytoplasm and compete with IKK{alpha} and p65 for CBP binding (33).


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
In this study, we present mammalian two-hybrid and GST pull-down data demonstrating that NEMO differentially interacts with amino acids 565–820 of HIF-2{alpha}, but not HIF-1{alpha}. Data are also presented in which endogenous HIF-2{alpha} is co-immunoprecipitated with endogenous by NEMO. Furthermore, we show this interaction has a functional consequence. First, normoxic activity of HIF-2{alpha} is increased in a dose-dependent manner upon NEMO overexpression, and second, transfection of an antisense NEMO construct decreases HIF-2{alpha} dependent reporter gene activity, indicating that endogenous NEMO contributes to HIF-2{alpha} activity. This is consistent with a model by which NEMO is able to bind and recruit co-activators (CBP/p300) to HIF-2{alpha}, supported by reporter gene assays where HIF-2{alpha}, but not HIF-1{alpha}, activity increases synergistically upon NEMO and p300 co-expression. The ability of NEMO to bind CBP has been recently reported (33).

These data also show that NEMO up-regulates HIF-2{alpha} activity at normoxia but not hypoxia where increased HIF-2{alpha} activity overrode any discernable effect of NEMO. Importantly, the HIF-{alpha} proteins have been shown to be functional in the absence of hypoxia, as demonstrated in HIF-1{alpha} -/- macrophages and embryonic stem cells, which express reduced levels of HIF-{alpha} target genes at normoxia (5, 43). The interaction of NEMO with HIF-2{alpha} may therefore contribute to a physiologically important normoxic role, given that reduction in endogenous NEMO by antisense expression specifically reduced HIF-2{alpha} activity.

Several lines of evidence also implicate stimuli other than hypoxia as physiological HIF-2{alpha} inducers. The finding that HIF-2{alpha} -/- embryonic stem cells are only resistant to hypoglycemic, but not hypoxic, induced apoptosis, implies that hypoglycemic stress may represent such a stimuli (13), as may cellular acidosis, stabilizing HIF-{alpha} protein via nucleolar sequestration of the Von Hippel-Lindau protein (44). Multiple growth factors have also been implicated in HIF-{alpha} induction (reviewed in Ref. 45). Furthermore, specific cell lines and tissues such as fibroblasts, macrophages, neutrophils, arterial endothelia, and neonatal rat brains display strong endogenous, normoxic immunoreactivity of HIF-2{alpha} (12, 46–50). Given a number of these studies report cytoplasmic localization of HIF-2{alpha}, and the implication that hypoxia may not be the sole stimulus for HIF-2{alpha} activity in vivo, our data demonstrate a mechanism by which NEMO may lead to transcriptionally active HIF-2{alpha} at normoxia.

Despite the high similarity of HIF-1{alpha} and HIF-2{alpha} with respect to amino acid sequence, domain architecture, DNA binding, and activation pathway, HIF-1{alpha}- and HIF-2{alpha}-deficient mice exhibit dramatically different phenotypes, indicating nonredundant protein functions. HIF-1{alpha} -/- embryos die by E11 displaying defective vascularization, cardiovascular malformation, and failure of neural tube closure because of mesenchymal cell death (5, 6). A different vascular phenotype has been reported for HIF-2{alpha} -/- embryos, with death by E12.5 because of insufficient vascular remodelling (7). Interestingly, other studies using HIF-2{alpha}-deficient mice report different phenotypes including bradycardia from impaired catecholamine production (8), respiratory distress syndrome from reduced lung surfactant (9), impaired survival of bone marrow hematopoietic cells (10), and abnormalities in metabolism and reactive oxygen species homeostasis (11).

Underlying these knock-out phenotypes, there is a growing body of evidence demonstrating the differences between the molecular responses of HIF-1{alpha} and HIF-2{alpha}. In mouse embryonic fibroblasts for example, HIF-2{alpha}, in contrast to HIF-1{alpha}, is reported to be cytoplasmically expressed at normoxia, unresponsive to hypoxia, and displays no endogenous transactivation. Furthermore, HIF-2{alpha} is reported to be nonresponsive to the primary mechanisms of HIF regulation involving proline and asparagine hydroxylation in this cell type (12). Glycolytic enzymes appear to be specifically up-regulated by HIF-1{alpha} (14), whereas the Rta gene of Kaposi's sarcoma-associated herpesvirus (51), the tyrosine kinase Tie2 (52), the vascular endothelial growth factor receptor Flt-1 (53), and erythropoietin (54) are reported HIF-2{alpha} targets. As mentioned previously, HIF-2{alpha} -/-, unlike HIF-1{alpha} -/-, embryonic stem cells are only resistant to hypoglycemic, although not hypoxic, induced apoptosis (13), whereas the renal cell carcinoma cell line 786-0 has been used to implicate HIF-2{alpha}, and not HIF-1{alpha}, in the tumorgenicity of subcutaneously injected immunocompromised mice (55).

In contrast to this growing body of evidence demonstrating clear differences between HIF-1{alpha} and HIF-2{alpha} function, few mechanisms are known to account for this nonredundancy. A reducing activity supplied by the redox factor Ref-1 is required for HIF-2{alpha} DNA binding, although not for HIF-1{alpha}, which constitutively binds DNA (56). HIF-2{alpha} has also been reported to specifically associate with the Ets1 transcription factor in Flk-1 gene expression (57). Lastly, PI3K inhibitors are reported to specifically inhibit HIF-1{alpha} hypoxic induction (58).

The identification of NEMO as a HIF-2{alpha}, but not HIF-1{alpha}, interacting protein in both yeast and mammalian cells, represents one of the few characterized protein interactions with specificity between the HIF-{alpha} proteins. Furthermore, the fact that both overexpressed, and antisense, NEMO modulates HIF-2{alpha} activity identifies NEMO as a novel and specific activator of HIF-2{alpha} at normoxia.

NF-{kappa}B signaling plays a critical role in the regulation of apoptotic and immune responses, and the NEMO protein is required for the activation of this pathway by virtually all known stimuli, acting as a nonenzymatic scaffold to assemble the IKK complex, a focal point for NF-{kappa}B regulation (21–28). This is reflected by the reported signal-regulated, post-translational modifications of NEMO, including IKK-{beta}- and protein kinase C{alpha}-dependent phosphorylation (59, 60), sumoylation (31), and ubiquitylation (61, 62). NEMO-deficient mice die early in embryogenesis (E12.5) from massive liver apoptosis, a similar phenotype to that reported for RelA and IKK-{beta} deficiency (63, 64). The physiological importance of NEMO is further underscored by the distinct X-linked human diseases incontinentia pigmenti and anhidrotic ectodermal dysplasia that have been linked to NEMO mutation (reviewed in Ref. 65).

Other non-IKK NEMO-binding factors have been identified, including both viral and nonviral proteins (23, 66–74). In each of these cases, the interaction with NEMO regulated NF-{kappa}B activity. Previous reports have demonstrated a secondary pool of NEMO that is not IKK-associated (33). Furthermore, this pool is able to shuttle into the nucleus and interact with the co-activator CBP. The fact that HIF-2{alpha} overexpression does not alter NF-{kappa}B activity demonstrates the first NF-{kappa}B independent role for NEMO, consistent with a model by which NEMO functions as a scaffold, recruiting CBP/p300 to HIF-2{alpha} and thereby increasing HIF2{alpha} normoxic activity. Future work to characterize the role of NEMO in the regulation of HIF-2{alpha} activity will require the identification and analysis of endogenous HIF-2{alpha}-specific target genes.


   FOOTNOTES
 
* This work was supported by the National Heart Foundation of Australia. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

{ddagger} To whom correspondence should be addressed. Tel.: 61-18-8303-5367; Fax: 61-8-8303-4348.

1 The abbreviations used are: HIF, hypoxia-inducible factor; HRE, hypoxia-response element; NEMO, NF-{kappa}B essential modulator; TAD, transactivation domain; ARNT, aryl hydrocarbon receptor nuclear translocator; CBP, cAMP-responsive element-binding protein-binding protein; GST, glutathione S-transferase; DBD, DNA-binding domain; En, embryonic day n; IKK, I{kappa}B kinase complex; NRP, NEMO-related protein; C-TAD, C-terminal TAD. Back


   ACKNOWLEDGMENTS
 
The NF-{kappa}B-luc reporter was a gift from Dr. Andrew Bert (IMVS, Adelaide, Australia). Dr. Richard Bruick (University of Texas) supplied human HIF2{alpha}-pcDNA3, Dr. George Muscat (University of Queensland) supplied p300-VP16, and NRP-pGEM was provided by Dr. Johan Peranen (University of Helsinki). We thank the Peet and Whitelaw laboratories for critical reading of this manuscript.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Wang, G. L., Jiang, B. H., Rue, E. A., and Semenza, G. L. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 5510-5514[Abstract/Free Full Text]
  2. Jaakkola, P., Mole, D. R., Tian, Y. M., Wilson, M. I., Gielbert, J., Gaskell, S. J., Kriegsheim, A., Hebestreit, H. F., Mukherji, M., Schofield, C. J., Maxwell, P. H., Pugh, C. W., and Ratcliffe, P. J. (2001) Science 292, 468-472[Abstract/Free Full Text]
  3. Ivan, M., Kondo, K., Yang, H., Kim, W., Valiando, J., Ohh, M., Salic, A., Asara, J. M., Lane, W. S., and Kaelin, W. G., Jr. (2001) Science 292, 464-468[Abstract/Free Full Text]
  4. Lando, D., Peet, D. J., Whelan, D. A., Gorman, J. J., and Whitelaw, M. L. (2002) Science 295, 858-861[Abstract/Free Full Text]
  5. Iyer, N. V., Kotch, L. E., Agani, F., Leung, S. W., Laughner, E., Wenger, R. H., Gassmann, M., Gearhart, J. D., Lawler, A. M., Yu, A. Y., and Semenza, G. L. (1998) Genes Dev. 12, 149-162[Abstract/Free Full Text]
  6. Kotch, L. E., Iyer, N. V., Laughner, E., and Semenza, G. L. (1999) Dev. Biol. 209, 254-267[CrossRef][Medline] [Order article via Infotrieve]
  7. Peng, J., Zhang, L., Drysdale, L., and Fong, G. H. (2000) Proc. Natl. Acad. Sci. U. S. A. 97, 8386-8391[Abstract/Free Full Text]
  8. Tian, H., Hammer, R. E., Matsumoto, A. M., Russell, D. W., and McKnight, S. L. (1998) Genes Dev. 12, 3320-3324[Abstract/Free Full Text]
  9. Compernolle, V., Brusselmans, K., Acker, T., Hoet, P., Tjwa, M., Beck, H., Plaisance, S., Dor, Y., Keshet, E., Lupu, F., Nemery, B., Dewerchin, M., Van Veldhoven, P., Plate, K., Moons, L., Collen, D., and Carmeliet, P. (2002) Nat. Med. 8, 702-710[Medline] [Order article via Infotrieve]
  10. Scortegagna, M., Morris, M. A., Oktay, Y., Bennett, M., and Garcia, J. A. (2003) Blood 102, 1634-1640[Abstract/Free Full Text]
  11. Scortegagna, M., Ding, K., Oktay, Y., Gaur, A., Thurmond, F., Yan, L. J., Marck, B. T., Matsumoto, A. M., Shelton, J. M., Richardson, J. A., Bennett, M. J., and Garcia, J. A. (2003) Nat. Genet. 35, 331-340[CrossRef][Medline] [Order article via Infotrieve]
  12. Park, S. K., Dadak, A. M., Haase, V. H., Fontana, L., Giaccia, A. J., and Johnson, R. S. (2003) Mol. Cell. Biol. 23, 4959-4971[Abstract/Free Full Text]
  13. Brusselmans, K., Bono, F., Maxwell, P., Dor, Y., Dewerchin, M., Collen, D., Herbert, J. M., and Carmeliet, P. (2001) J. Biol. Chem. 276, 39192-39196[Abstract/Free Full Text]
  14. Hu, C. J., Wang, L. Y., Chodosh, L. A., Keith, B., and Simon, M. C. (2003) Mol. Cell. Biol. 23, 9361-9374[Abstract/Free Full Text]
  15. Ema, M., Taya, S., Yokotani, N., Sogawa, K., Matsuda, Y., and Fujii-Kuriyama, Y. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 4273-4278[Abstract/Free Full Text]
  16. Pongratz, I., Antonsson, C., Whitelaw, M. L., and Poellinger, L. (1998) Mol. Cell. Biol. 18, 4079-4088[Abstract/Free Full Text]
  17. Goldman, L. A., Cutrone, E. C., Kotenko, S. V., Krause, C. D., and Langer, J. A. (1996) BioTechniques 21, 1013-1015[Medline] [Order article via Infotrieve]
  18. Hobbs, S., Jitrapakdee, S., and Wallace, J. C. (1998) Biochem. Biophys. Res. Commun. 252, 368-372[CrossRef][Medline] [Order article via Infotrieve]
  19. Whitelaw, M., Pongratz, I., Wilhelmsson, A., Gustafsson, J. A., and Poellinger, L. (1993) Mol. Cell. Biol. 13, 2504-2514[Abstract/Free Full Text]
  20. Woods, S. L., and Whitelaw, M. L. (2002) J. Biol. Chem. 277, 10236-10243[Abstract/Free Full Text]
  21. Yamaoka, S., Courtois, G., Bessia, C., Whiteside, S. T., Weil, R., Agou, F., Kirk, H. E., Kay, R. J., and Israel, A. (1998) Cell 93, 1231-1240[CrossRef][Medline] [Order article via Infotrieve]
  22. Rothwarf, D. M., Zandi, E., Natoli, G., and Karin, M. (1998) Nature 395, 297-300[CrossRef][Medline] [Order article via Infotrieve]
  23. Li, Y., Kang, J., Friedman, J., Tarassishin, L., Ye, J., Kovalenko, A., Wallach, D., and Horwitz, M. S. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 1042-1047[Abstract/Free Full Text]
  24. Mercurio, F., Murray, B. W., Shevchenko, A., Bennett, B. L., Young, D. B., Li, J. W., Pascual, G., Motiwala, A., Zhu, H., Mann, M., and Manning, A. M. (1999) Mol. Cell. Biol. 19, 1526-1538[Abstract/Free Full Text]
  25. Poyet, J. L., Srinivasula, S. M., Lin, J. H., Fernandes-Alnemri, T., Yamaoka, S., Tsichlis, P. N., and Alnemri, E. S. (2000) J. Biol. Chem. 275, 37966-37977[Abstract/Free Full Text]
  26. Li, X. H., Fang, X., and Gaynor, R. B. (2001) J. Biol. Chem. 276, 4494-4500[Abstract/Free Full Text]
  27. Yamamoto, Y., Kim, D. W., Kwak, Y. T., Prajapati, S., Verma, U., and Gaynor, R. B. (2001) J. Biol. Chem. 276, 36327-36336[Abstract/Free Full Text]
  28. Tegethoff, S., Behlke, J., and Scheidereit, C. (2003) Mol. Cell. Biol. 23, 2029-2041[Abstract/Free Full Text]
  29. Li, Y., Kang, J., and Horwitz, M. S. (1998) Mol. Cell. Biol. 18, 1601-1610[Abstract/Free Full Text]
  30. Schwamborn, K., Weil, R., Courtois, G., Whiteside, S. T., and Israel, A. (2000) J. Biol. Chem. 275, 22780-22789[Abstract/Free Full Text]
  31. Huang, T. T., Wuerzberger-Davis, S. M., Wu, Z. H., and Miyamoto, S. (2003) Cell 115, 565-576[CrossRef][Medline] [Order article via Infotrieve]
  32. Anest, V., Hanson, J. L., Cogswell, P. C., Steinbrecher, K. A., Strahl, B. D., and Baldwin, A. S. (2003) Nature 423, 659-663[CrossRef][Medline] [Order article via Infotrieve]
  33. Verma, U. N., Yamamoto, Y., Prajapati, S., and Gaynor, R. B. (2004) J. Biol. Chem. 279, 3509-3515[Abstract/Free Full Text]
  34. Arany, Z., Huang, L. E., Eckner, R., Bhattacharya, S., Jiang, C., Goldberg, M. A., Bunn, H. F., and Livingston, D. M. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 12969-12973[Abstract/Free Full Text]
  35. Sang, N., Fang, J., Srinivas, V., Leshchinsky, I., and Caro, J. (2002) Mol. Cell. Biol. 22, 2984-2992[Abstract/Free Full Text]
  36. Ruas, J. L., Poellinger, L., and Pereira, T. (2002) J. Biol. Chem. 277, 38723-38730[Abstract/Free Full Text]
  37. Freedman, S. J., Sun, Z. Y., Poy, F., Kung, A. L., Livingston, D. M., Wagner, G., and Eck, M. J. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, 5367-5372[Abstract/Free Full Text]
  38. Ema, M., Hirota, K., Mimura, J., Abe, H., Yodoi, J., Sogawa, K., Poellinger, L., and Fujii-Kuriyama, Y. (1999) EMBO J. 18, 1905-1914[CrossRef][Medline] [Order article via Infotrieve]
  39. Kallio, P. J., Okamoto, K., O'Brien, S., Carrero, P., Makino, Y., Tanaka, H., and Poellinger, L. (1998) EMBO J. 17, 6573-6586[CrossRef][Medline] [Order article via Infotrieve]
  40. Ebert, B. L., and Bunn, H. F. (1998) Mol. Cell. Biol. 18, 4089-4096[Abstract/Free Full Text]
  41. Carrero, P., Okamoto, K., Coumailleau, P., O'Brien, S., Tanaka, H., and Poellinger, L. (2000) Mol. Cell. Biol. 20, 402-415[Abstract/Free Full Text]
  42. Gu, J., Milligan, J., and Huang, L. E. (2001) J. Biol. Chem. 276, 3550-3554[Abstract/Free Full Text]
  43. Cramer, T., Yamanishi, Y., Clausen, B. E., Forster, I., Pawlinski, R., Mackman, N., Haase, V. H., Jaenisch, R., Corr, M., Nizet, V., Firestein, G. S., Gerber, H. P., Ferrara, N., and Johnson, R. S. (2003) Cell 112, 645-657[CrossRef][Medline] [Order article via Infotrieve]
  44. Mekhail, K., Gunaratnam, L., Bonicalzi, M. E., and Lee, S. (2004) Nat. Cell Biol. 6, 642-647[CrossRef][Medline] [Order article via Infotrieve]
  45. Bilton, R. L., and Booker, G. W. (2003) Eur. J. Biochem. 270, 791-798[Medline] [Order article via Infotrieve]
  46. Talks, K. L., Turley, H., Gatter, K. C., Maxwell, P. H., Pugh, C. W., Ratcliffe, P. J., and Harris, A. L. (2000) Am. J. Pathol. 157, 411-421